Starting /dee2/code/volunteer_pipeline.sh SRR7169602 current disk space = 3055148703744 free memory = 1419154092 SRR7169602 SRAfilesize e2992b9d2f55bd025aeabc77fd741815 SRR7169602.sra SRR7169602.sra file validated SRR7169602 is paired end SRR7169602 is conventional basespace SRR7169602 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169602_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.188 34.0 33.0 34.0 31.0 34.0 2 32.99625 34.0 33.0 34.0 29.0 34.0 3 33.1165 34.0 33.0 34.0 30.0 34.0 4 33.42025 34.0 33.0 34.0 33.0 34.0 5 33.372 34.0 33.0 34.0 33.0 34.0 6 36.94525 38.0 37.0 38.0 35.0 38.0 7 37.2515 38.0 38.0 38.0 37.0 38.0 8 37.32925 38.0 38.0 38.0 37.0 38.0 9 37.4735 38.0 38.0 38.0 37.0 38.0 10-14 37.5203 38.0 38.0 38.0 37.8 38.0 15-19 37.505900000000004 38.0 38.0 38.0 37.6 38.0 20-24 37.4979 38.0 38.0 38.0 37.0 38.0 25-29 37.4184 38.0 38.0 38.0 37.6 38.0 30-34 37.258250000000004 38.0 38.0 38.0 37.0 38.0 35-39 37.2704 38.0 38.0 38.0 36.8 38.0 40-44 36.91975 38.0 38.0 38.0 35.6 38.0 45-49 36.76165 38.0 38.0 38.0 34.8 38.0 50-54 36.628 38.0 38.0 38.0 34.2 38.0 55-59 36.64035 38.0 38.0 38.0 34.2 38.0 60-64 36.4604 38.0 38.0 38.0 34.0 38.0 65-69 36.34045 38.0 37.8 38.0 33.6 38.0 70-74 36.19509999999999 38.0 37.0 38.0 33.2 38.0 75-79 36.01155 38.0 37.0 38.0 33.0 38.0 80-84 35.8574 38.0 37.0 38.0 32.2 38.0 85-89 35.6083 38.0 37.0 38.0 30.4 38.0 90-94 35.383250000000004 38.0 36.4 38.0 29.4 38.0 95-99 35.111149999999995 38.0 36.2 38.0 28.4 38.0 100-104 34.677299999999995 38.0 35.6 38.0 26.2 38.0 105-109 34.4226 38.0 35.0 38.0 25.0 38.0 110-114 34.1553 38.0 35.0 38.0 23.0 38.0 115-119 33.95270000000001 38.0 34.6 38.0 21.0 38.0 120-124 33.3359 38.0 33.8 38.0 17.4 38.0 125-129 32.97255 38.0 33.6 38.0 15.0 38.0 130-134 32.74175 38.0 33.2 38.0 15.0 38.0 135-139 32.4211 37.8 33.0 38.0 14.4 38.0 140-144 31.541449999999998 36.6 31.4 38.0 13.6 38.0 145-149 30.1287 36.0 29.4 38.0 4.2 38.0 150-151 25.868375 33.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 2.0 10 0.0 11 3.0 12 3.0 13 5.0 14 2.0 15 6.0 16 6.0 17 7.0 18 15.0 19 19.0 20 11.0 21 13.0 22 17.0 23 15.0 24 24.0 25 26.0 26 33.0 27 46.0 28 34.0 29 64.0 30 66.0 31 94.0 32 105.0 33 152.0 34 230.0 35 447.0 36 1033.0 37 1521.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.13831221353465 14.04691291453222 10.51496360204907 32.29981126988407 2 24.5 14.674999999999999 29.099999999999998 31.724999999999998 3 20.775 18.25 25.624999999999996 35.35 4 22.400000000000002 26.0 22.7 28.9 5 22.8 30.8 23.849999999999998 22.55 6 20.674999999999997 33.074999999999996 25.95 20.3 7 15.2 29.325000000000003 37.875 17.599999999999998 8 17.299999999999997 29.575000000000003 28.95 24.175 9 16.75 26.700000000000003 33.5 23.05 10-14 18.77 32.21 26.369999999999997 22.650000000000002 15-19 18.605 30.755 27.334999999999997 23.305 20-24 19.13 30.869999999999997 26.724999999999998 23.275000000000002 25-29 19.24 30.695 26.22 23.845 30-34 18.63 30.755 26.534999999999997 24.08 35-39 19.939999999999998 29.89 26.645000000000003 23.525 40-44 19.005 30.695 26.8 23.5 45-49 19.595000000000002 29.59 27.284999999999997 23.53 50-54 19.580000000000002 29.709999999999997 27.13 23.580000000000002 55-59 19.345000000000002 29.665000000000003 27.04 23.95 60-64 19.31 29.49 27.189999999999998 24.01 65-69 19.355 29.455 27.43 23.76 70-74 19.455 30.18 26.56 23.805 75-79 19.634999999999998 29.955 26.484999999999996 23.925 80-84 20.34 29.015 26.995 23.65 85-89 19.865 29.37 26.565 24.2 90-94 20.525 29.24 26.31 23.925 95-99 20.119999999999997 28.76 27.13 23.990000000000002 100-104 20.294999999999998 29.520000000000003 26.200000000000003 23.985 105-109 20.18 29.115000000000002 27.445000000000004 23.26 110-114 20.035 29.349999999999998 27.145000000000003 23.47 115-119 20.830000000000002 28.904999999999998 26.82 23.445 120-124 20.265 28.63 26.884999999999998 24.22 125-129 19.715 28.59 27.134999999999998 24.560000000000002 130-134 20.23 29.12 26.33 24.32 135-139 20.505000000000003 28.715000000000003 26.345000000000002 24.435000000000002 140-144 20.615 28.84 26.665 23.880000000000003 145-149 20.94 28.865000000000002 25.95 24.245 150-151 19.7625 29.599999999999998 26.674999999999997 23.962500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.5 21 1.5 22 3.0 23 4.0 24 6.0 25 9.0 26 10.0 27 12.0 28 16.0 29 19.5 30 28.0 31 44.5 32 53.5 33 68.5 34 87.5 35 95.0 36 113.0 37 131.0 38 142.0 39 172.0 40 187.0 41 200.0 42 222.0 43 232.5 44 230.0 45 219.0 46 218.5 47 216.0 48 199.0 49 163.0 50 145.5 51 139.0 52 114.0 53 101.5 54 95.0 55 75.0 56 51.5 57 35.5 58 32.0 59 26.0 60 17.5 61 13.0 62 15.0 63 11.0 64 4.0 65 4.5 66 2.0 67 0.5 68 1.0 69 1.0 70 1.5 71 2.5 72 2.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.2749999999999995 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3920972644377 98.1 2 0.48125633232016213 0.95 3 0.050658561296859174 0.15 4 0.025329280648429587 0.1 5 0.0 0.0 6 0.025329280648429587 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025329280648429587 0.5499999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAAAGCAATCTCGTATGC 22 0.5499999999999999 TruSeq Adapter, Index 5 (97% over 37bp) CCCCACTGCTGCCTCCCGTAGGAGTCTGGACCGTGTCTCAGTTCCAGTGT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.037500000000000006 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.36250000000000004 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.5375000000000001 0.0 0.0 0.0 0.0 102-103 0.675 0.0 0.0 0.0 0.0 104-105 0.85 0.0 0.0 0.0 0.0 106-107 1.0 0.0 0.0 0.0 0.0 108-109 1.1 0.0 0.0 0.0 0.0 110-111 1.2000000000000002 0.0 0.0 0.0 0.0 112-113 1.3375 0.0 0.0 0.0 0.0 114-115 1.525 0.0 0.0 0.0 0.0 116-117 1.75 0.0 0.0 0.0 0.0 118-119 1.9500000000000002 0.0 0.0 0.0 0.0 120-121 2.1625 0.0 0.0 0.0 0.0 122-123 2.5125 0.0 0.0 0.0 0.0 124-125 2.825 0.0 0.0 0.0 0.0 126-127 3.125 0.0 0.0 0.0 0.0 128-129 3.4000000000000004 0.0 0.0 0.0 0.0 130-131 3.575 0.0 0.0 0.0 0.0 132-133 3.8875 0.0 0.0 0.0 0.0 134-135 4.275 0.0 0.0 0.0 0.0 136-137 4.6625 0.0 0.0 0.0 0.0 138-139 4.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGTCTC 10 0.006843168 144.91249 8 >>END_MODULE SRR7169602 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169602_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.81625 33.0 33.0 34.0 32.0 34.0 2 32.85225 34.0 33.0 34.0 32.0 34.0 3 32.94425 34.0 33.0 34.0 32.0 34.0 4 32.9005 34.0 33.0 34.0 32.0 34.0 5 32.87225 34.0 33.0 34.0 32.0 34.0 6 37.02975 38.0 38.0 38.0 37.0 38.0 7 36.94575 38.0 38.0 38.0 37.0 38.0 8 36.98325 38.0 38.0 38.0 37.0 38.0 9 37.061 38.0 38.0 38.0 37.0 38.0 10-14 37.04605 38.0 38.0 38.0 37.0 38.0 15-19 36.9935 38.0 38.0 38.0 37.0 38.0 20-24 36.92085 38.0 38.0 38.0 37.0 38.0 25-29 36.8815 38.0 38.0 38.0 37.0 38.0 30-34 36.763200000000005 38.0 38.0 38.0 36.2 38.0 35-39 36.781600000000005 38.0 38.0 38.0 36.4 38.0 40-44 36.771249999999995 38.0 38.0 38.0 36.4 38.0 45-49 36.64059999999999 38.0 38.0 38.0 35.8 38.0 50-54 36.705799999999996 38.0 38.0 38.0 36.2 38.0 55-59 36.642700000000005 38.0 38.0 38.0 35.8 38.0 60-64 36.52395 38.0 38.0 38.0 35.6 38.0 65-69 36.33685 38.0 38.0 38.0 35.0 38.0 70-74 36.17289999999999 38.0 38.0 38.0 34.6 38.0 75-79 36.1096 38.0 38.0 38.0 34.2 38.0 80-84 36.06685 38.0 38.0 38.0 34.2 38.0 85-89 35.947649999999996 38.0 38.0 38.0 33.6 38.0 90-94 35.68945 38.0 38.0 38.0 32.6 38.0 95-99 35.6358 38.0 38.0 38.0 32.8 38.0 100-104 35.541199999999996 38.0 38.0 38.0 32.6 38.0 105-109 35.34905 38.0 38.0 38.0 31.4 38.0 110-114 35.18044999999999 38.0 38.0 38.0 30.2 38.0 115-119 34.94199999999999 38.0 37.2 38.0 28.2 38.0 120-124 34.708850000000005 38.0 36.8 38.0 27.6 38.0 125-129 34.422000000000004 38.0 36.0 38.0 25.4 38.0 130-134 34.11095 38.0 36.0 38.0 23.0 38.0 135-139 33.68995 38.0 35.2 38.0 17.8 38.0 140-144 33.374 38.0 34.4 38.0 14.2 38.0 145-149 32.845699999999994 38.0 33.2 38.0 10.8 38.0 150-151 28.744375 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 24.0 3 4.0 4 3.0 5 1.0 6 2.0 7 4.0 8 2.0 9 1.0 10 3.0 11 4.0 12 4.0 13 5.0 14 5.0 15 8.0 16 17.0 17 22.0 18 12.0 19 13.0 20 10.0 21 15.0 22 14.0 23 20.0 24 20.0 25 20.0 26 17.0 27 28.0 28 38.0 29 32.0 30 32.0 31 50.0 32 57.0 33 66.0 34 105.0 35 178.0 36 427.0 37 2737.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.772316950852556 23.044132397191575 14.067201604814445 22.116349047141423 2 28.850488354620584 27.798647633358375 25.97044828449787 17.380415727523165 3 21.512647132481845 28.750313047833707 30.904082143751566 18.83295767593288 4 25.344352617079892 33.73403456048084 22.063611319809667 18.8580015026296 5 26.521412471825695 33.35837716003005 21.487603305785125 18.632607062359128 6 23.71056584877316 35.17776664997496 23.15973960941412 17.95192789183776 7 22.283425137706562 22.8342513770656 35.07761642463695 19.804707060590886 8 23.084626940410615 27.1156735102654 25.58838257386079 24.211316975463195 9 24.361542313470206 25.087631447170754 28.592889334001004 21.957936905358036 10-14 24.729567307692307 28.31530448717949 25.83633814102564 21.118790064102562 15-19 25.31804066913753 27.526795552439147 26.670339577281375 20.48482420114194 20-24 24.74330077635863 28.48985725018783 26.37114951164538 20.395692461808164 25-29 24.948660155271725 28.900576008014024 25.925369396443777 20.22539444027047 30-34 24.491635780827405 28.263047180206353 26.8306120404688 20.414704998497445 35-39 24.097170047583273 28.094164788379665 27.157525669922368 20.6511394941147 40-44 24.878537440520912 27.698472326571498 26.841973453543698 20.581016779363885 45-49 24.673178061607814 28.479839719509144 26.491359879789634 20.35562233909341 50-54 24.557976458802905 27.963936889556724 27.312797395442022 20.165289256198346 55-59 24.547958928124217 27.262709742048585 27.16253443526171 21.02679689456549 60-64 24.527923866766844 27.95892812421738 27.25770097670924 20.255447032306538 65-69 24.61808164287503 28.219383921863262 26.85199098422239 20.31054345103932 70-74 25.048835462058605 27.473077886301027 26.756824442774857 20.721262208865515 75-79 24.698221888304534 27.508139243676432 26.972201352366643 20.82143751565239 80-84 24.047082394189832 27.558226897069872 27.137490608564992 21.257200100175307 85-89 24.698221888304534 27.838717756073127 27.488104182319056 19.974956173303283 90-94 24.65437788018433 27.173913043478258 27.644760569024246 20.526948507313165 95-99 24.45401723101583 27.549589260669205 28.16068924063314 19.835704267681827 100-104 24.087152516904585 27.63335837716003 27.943901828199348 20.33558727773604 105-109 24.858502379163536 27.683446030553473 27.317806160781366 20.140245429501626 110-114 24.557976458802905 28.12922614575507 27.92887553218132 19.383921863260706 115-119 24.524143458224803 27.46443598477259 27.75495892606692 20.256461630935686 120-124 24.4326436551275 27.764140073142627 28.210009518561197 19.59320675316868 125-129 24.670640685267745 27.94670139758553 27.515904423182892 19.86675349396383 130-134 24.572745952989525 28.06595499423646 27.634942113967824 19.726356938806195 135-139 24.874724393666064 27.32010422930447 28.016636600521146 19.788534776508317 140-144 24.936093428900808 27.898350959851637 27.54247907373064 19.62307653751692 145-149 25.13658463234926 27.22169314821312 27.93343692045511 19.708285298982506 150-151 24.637137137137138 27.902902902902905 27.77777777777778 19.68218218218218 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 6.0 1 3.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.0 22 0.5 23 0.5 24 1.5 25 2.0 26 2.0 27 3.5 28 5.0 29 7.5 30 7.5 31 9.0 32 17.5 33 27.5 34 38.0 35 52.0 36 67.0 37 77.5 38 102.5 39 129.5 40 152.5 41 192.0 42 241.0 43 282.0 44 285.5 45 274.0 46 275.5 47 264.0 48 232.5 49 210.0 50 199.0 51 177.0 52 139.0 53 120.5 54 98.5 55 68.0 56 57.0 57 42.5 58 27.5 59 24.5 60 20.0 61 12.0 62 11.0 63 8.0 64 6.5 65 4.5 66 1.5 67 1.0 68 3.0 69 3.0 70 0.5 71 0.5 72 0.5 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.17500000000000002 3 0.17500000000000002 4 0.17500000000000002 5 0.17500000000000002 6 0.15 7 0.15 8 0.15 9 0.15 10-14 0.16 15-19 0.16999999999999998 20-24 0.17500000000000002 25-29 0.17500000000000002 30-34 0.16999999999999998 35-39 0.17500000000000002 40-44 0.17500000000000002 45-49 0.17500000000000002 50-54 0.17500000000000002 55-59 0.17500000000000002 60-64 0.17500000000000002 65-69 0.17500000000000002 70-74 0.17500000000000002 75-79 0.17500000000000002 80-84 0.17500000000000002 85-89 0.17500000000000002 90-94 0.18 95-99 0.18 100-104 0.17500000000000002 105-109 0.17500000000000002 110-114 0.17500000000000002 115-119 0.18 120-124 0.19499999999999998 125-129 0.185 130-134 0.23500000000000001 135-139 0.22 140-144 0.245 145-149 0.245 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.23896499238964 97.8 2 0.60882800608828 1.2 3 0.10147133434804667 0.3 4 0.0 0.0 5 0.0 0.0 6 0.025367833587011668 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025367833587011668 0.5499999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 22 0.5499999999999999 Illumina Single End PCR Primer 1 (100% over 50bp) NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.32499999999999996 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.8500000000000001 0.0 0.0 0.0 0.0 104-105 1.0 0.0 0.0 0.0 0.0 106-107 1.1 0.0 0.0 0.0 0.0 108-109 1.2000000000000002 0.0 0.0 0.0 0.0 110-111 1.2999999999999998 0.0 0.0 0.0 0.0 112-113 1.4375 0.0 0.0 0.0 0.0 114-115 1.625 0.0 0.0 0.0 0.0 116-117 1.8625 0.0 0.0 0.0 0.0 118-119 2.0999999999999996 0.0 0.0 0.0 0.0 120-121 2.3875 0.0 0.0 0.0 0.0 122-123 2.75 0.0 0.0 0.0 0.0 124-125 3.0 0.0 0.0 0.0 0.0 126-127 3.3125 0.0 0.0 0.0 0.0 128-129 3.5999999999999996 0.0 0.0 0.0 0.0 130-131 3.8 0.0 0.0 0.0 0.0 132-133 4.2125 0.0 0.0 0.0 0.0 134-135 4.6125 0.0 0.0 0.0 0.0 136-137 5.0625 0.0 0.0 0.0 0.0 138-139 5.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 752036 spots for SRR7169602.sra Written 752036 spots for SRR7169602.sra Read 752036 spots for SRR7169602.sra Written 752036 spots for SRR7169602.sra Read 752036 spots for SRR7169602.sra Written 752036 spots for SRR7169602.sra Read 752036 spots for SRR7169602.sra Written 752036 spots for SRR7169602.sra Read 752036 spots for SRR7169602.sra Written 752036 spots for SRR7169602.sra Read 752036 spots for SRR7169602.sra Written 752036 spots for SRR7169602.sra Read 752036 spots for SRR7169602.sra Written 752036 spots for SRR7169602.sra Read 752036 spots for SRR7169602.sra Written 752036 spots for SRR7169602.sra Read 752036 spots for SRR7169602.sra Written 752036 spots for SRR7169602.sra Read 752036 spots for SRR7169602.sra Written 752036 spots for SRR7169602.sra Read 752036 spots for SRR7169602.sra Written 752036 spots for SRR7169602.sra Read 752036 spots for SRR7169602.sra Written 752036 spots for SRR7169602.sra Read 752036 spots for SRR7169602.sra Written 752036 spots for SRR7169602.sra Read 752036 spots for SRR7169602.sra Written 752036 spots for SRR7169602.sra Read 752051 spots for SRR7169602.sra Written 752051 spots for SRR7169602.sra Read 752036 spots for SRR7169602.sra Written 752036 spots for SRR7169602.sra Read 752036 spots for SRR7169602.sra Written 752036 spots for SRR7169602.sra Read 752036 spots for SRR7169602.sra Written 752036 spots for SRR7169602.sra Read 752036 spots for SRR7169602.sra Written 752036 spots for SRR7169602.sra Read 752036 spots for SRR7169602.sra Written 752036 spots for SRR7169602.sra SRR ids: ['SRR7169602.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mz0kk710 SRR7169602.sra spots: 15040735 blocks: [[1, 752036], [752037, 1504072], [1504073, 2256108], [2256109, 3008144], [3008145, 3760180], [3760181, 4512216], [4512217, 5264252], [5264253, 6016288], [6016289, 6768324], [6768325, 7520360], [7520361, 8272396], [8272397, 9024432], [9024433, 9776468], [9776469, 10528504], [10528505, 11280540], [11280541, 12032576], [12032577, 12784612], [12784613, 13536648], [13536649, 14288684], [14288685, 15040735]] SRR7169602 file size 5075111 SRR7169602 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169602 SRR7169602_1.fastq SRR7169602_2.fastq Input file: SRR7169602_1.fastq Paired file: SRR7169602_2.fastq trimmed: SRR7169602-trimmed-pair1.fastq, SRR7169602-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:15:48 2025 >> started Tue Feb 11 09:16:04 2025 >> done (16.665s) 15040735 read pairs processed; of these: 41361 ( 0.27%) short read pairs filtered out after trimming by size control 177163 ( 1.18%) empty read pairs filtered out after trimming by size control 14822211 (98.55%) read pairs available; of these: 7814031 (52.72%) trimmed read pairs available after processing 7008180 (47.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 9 0.00% 20 10 0.00% 21 11 0.00% 22 10 0.00% 23 15 0.00% 24 46 0.00% 25 18 0.00% 26 12 0.00% 27 25 0.00% 28 61 0.00% 29 27 0.00% 30 26 0.00% 31 30 0.00% 32 25 0.00% 33 20 0.00% 34 31 0.00% 35 36 0.00% 36 43 0.00% 37 54 0.00% 38 41 0.00% 39 44 0.00% 40 56 0.00% 41 51 0.00% 42 56 0.00% 43 63 0.00% 44 83 0.00% 45 111 0.00% 46 117 0.00% 47 131 0.00% 48 168 0.00% 49 169 0.00% 50 202 0.00% 51 235 0.00% 52 274 0.00% 53 310 0.00% 54 238 0.00% 55 263 0.00% 56 278 0.00% 57 283 0.00% 58 308 0.00% 59 313 0.00% 60 314 0.00% 61 371 0.00% 62 445 0.00% 63 482 0.00% 64 552 0.00% 65 624 0.00% 66 882 0.01% 67 1110 0.01% 68 1471 0.01% 69 4612 0.03% 70 8931 0.06% 71 7746 0.05% 72 5694 0.04% 73 3547 0.02% 74 2634 0.02% 75 2306 0.02% 76 2212 0.01% 77 2116 0.01% 78 2186 0.01% 79 2302 0.02% 80 2598 0.02% 81 2862 0.02% 82 3092 0.02% 83 3530 0.02% 84 5253 0.04% 85 6328 0.04% 86 6561 0.04% 87 6856 0.05% 88 7516 0.05% 89 8032 0.05% 90 8484 0.06% 91 8686 0.06% 92 9200 0.06% 93 9737 0.07% 94 10299 0.07% 95 11058 0.07% 96 11679 0.08% 97 12056 0.08% 98 12400 0.08% 99 12430 0.08% 100 13745 0.09% 101 14243 0.10% 102 14922 0.10% 103 16050 0.11% 104 16549 0.11% 105 17892 0.12% 106 18338 0.12% 107 19033 0.13% 108 19939 0.13% 109 21036 0.14% 110 21711 0.15% 111 22351 0.15% 112 23337 0.16% 113 25633 0.17% 114 26030 0.18% 115 27888 0.19% 116 28406 0.19% 117 29684 0.20% 118 30359 0.20% 119 31028 0.21% 120 32707 0.22% 121 34009 0.23% 122 35592 0.24% 123 37502 0.25% 124 40081 0.27% 125 41551 0.28% 126 43218 0.29% 127 45656 0.31% 128 47544 0.32% 129 49551 0.33% 130 51786 0.35% 131 53594 0.36% 132 56049 0.38% 133 59543 0.40% 134 63242 0.43% 135 67485 0.46% 136 71691 0.48% 137 76451 0.52% 138 80190 0.54% 139 85956 0.58% 140 91958 0.62% 141 100788 0.68% 142 110924 0.75% 143 127613 0.86% 144 144160 0.97% 145 171276 1.16% 146 211471 1.43% 147 287572 1.94% 148 435067 2.94% 149 858400 5.79% 150 3549729 23.95% 151 7008180 47.28% 14822211 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=4.31 fanout-score-rank=35 prefix-density=0.64 prefix-fanout=1.0 sequence=GATCGTCGCCTTGGTGAGCCGTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=36 fanout-score=395.76 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=25.3 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAACAAGGAGTTCAGCAGCCTGTACTCCATGGTAAGGATCAATATGGAATCCGGATTTTCCATGCACAATGATCTCAGCA criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=3.30 fanout-score-rank=37 prefix-density=0.73 prefix-fanout=2.6 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.02 sequence-density-rank=39 fanout-score=129.31 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=12.6 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCACGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGAT SRR7169602 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:17:13 Started mapping on | Feb 11 09:17:14 Finished on | Feb 11 09:19:26 Mapping speed, Million of reads per hour | 404.24 Number of input reads | 14822211 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 12582576 Uniquely mapped reads % | 84.89% Average mapped length | 288.77 Number of splices: Total | 10059409 Number of splices: Annotated (sjdb) | 9860836 Number of splices: GT/AG | 9893708 Number of splices: GC/AG | 127377 Number of splices: AT/AC | 8949 Number of splices: Non-canonical | 29375 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.03% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 268826 % of reads mapped to multiple loci | 1.81% Number of reads mapped to too many loci | 29345 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 13.01% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1994341 1994341 1994341 N_multimapping 268826 268826 268826 N_noFeature 336918 12417699 404787 N_ambiguous 176193 2219 77452 UnstrandedReadsAssigned:12069465 PositiveStrandReadsAssigned:162658 NegativeStrandReadsAssigned:12100337 Dataset is classified negative stranded MeadianReadLen=147 20thPercentileLength=143 echo kmer=139 SRR7169602 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169602-trimmed-pair1.fastq SRR7169602-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,822,211 reads, 12,880,836 reads pseudoaligned [quant] estimated average fragment length: 230.218 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,056 rounds 52401 SRR7169602.ke.tsv 34699 SRR7169602.se.tsv 87100 total ==> SRR7169602.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1788.78 269 10.1645 Potri.005G024800.1.v4.1 1035 805.782 51 4.27804 Potri.004G059700.1.v4.1 961 731.787 6 0.55419 Potri.007G009000.2.v4.1 1416 1186.78 0 0 Potri.003G141000.2.v4.1 2943 2713.78 273 6.79955 Potri.016G087400.1.v4.1 270 79.7263 1122.08 951.294 Potri.015G069301.1.v4.1 564 336.718 0 0 Potri.010G195200.1.v4.1 1773 1543.78 80 3.50265 Potri.012G127500.1.v4.1 977 747.782 12041 1088.38 ==> SRR7169602.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1527 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 464 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169602 completed mapping pipeline successfully