Starting /dee2/code/volunteer_pipeline.sh SRR7169603 current disk space = 3055556116480 free memory = 1416697524 SRR7169603 SRAfilesize 788ede8e0a34518682edf638c224f6ec SRR7169603.sra SRR7169603.sra file validated SRR7169603 is paired end SRR7169603 is conventional basespace SRR7169603 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169603_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0455 34.0 33.0 34.0 33.0 34.0 2 33.34775 34.0 34.0 34.0 33.0 34.0 3 33.4895 34.0 34.0 34.0 33.0 34.0 4 33.564 34.0 34.0 34.0 33.0 34.0 5 33.55025 34.0 34.0 34.0 33.0 34.0 6 37.2095 38.0 38.0 38.0 36.0 38.0 7 37.411 38.0 38.0 38.0 37.0 38.0 8 37.48275 38.0 38.0 38.0 37.0 38.0 9 37.50875 38.0 38.0 38.0 38.0 38.0 10-14 37.5644 38.0 38.0 38.0 38.0 38.0 15-19 37.53645 38.0 38.0 38.0 38.0 38.0 20-24 37.54065 38.0 38.0 38.0 37.8 38.0 25-29 37.529650000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.516149999999996 38.0 38.0 38.0 37.8 38.0 35-39 37.4114 38.0 38.0 38.0 37.4 38.0 40-44 37.3708 38.0 38.0 38.0 37.0 38.0 45-49 37.314099999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.2778 38.0 38.0 38.0 37.0 38.0 55-59 37.2605 38.0 38.0 38.0 36.6 38.0 60-64 37.27055 38.0 38.0 38.0 36.6 38.0 65-69 37.1903 38.0 38.0 38.0 36.2 38.0 70-74 37.138850000000005 38.0 38.0 38.0 36.0 38.0 75-79 37.098349999999996 38.0 38.0 38.0 36.0 38.0 80-84 37.0139 38.0 38.0 38.0 36.0 38.0 85-89 36.9934 38.0 38.0 38.0 35.8 38.0 90-94 36.8891 38.0 38.0 38.0 35.2 38.0 95-99 36.793899999999994 38.0 38.0 38.0 34.8 38.0 100-104 36.653800000000004 38.0 38.0 38.0 34.4 38.0 105-109 36.57795 38.0 38.0 38.0 34.4 38.0 110-114 36.41455 38.0 38.0 38.0 34.0 38.0 115-119 36.198 38.0 37.8 38.0 34.0 38.0 120-124 36.04415 38.0 37.4 38.0 33.2 38.0 125-129 35.998999999999995 38.0 37.2 38.0 33.0 38.0 130-134 35.757850000000005 38.0 36.4 38.0 32.0 38.0 135-139 35.4704 38.0 36.0 38.0 31.0 38.0 140-144 35.042 38.0 36.0 38.0 29.2 38.0 145-149 34.60275 38.0 35.0 38.0 28.0 38.0 150-151 31.761000000000003 36.5 31.5 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 1.0 15 1.0 16 1.0 17 0.0 18 2.0 19 1.0 20 4.0 21 4.0 22 5.0 23 6.0 24 7.0 25 9.0 26 14.0 27 12.0 28 13.0 29 35.0 30 33.0 31 52.0 32 61.0 33 72.0 34 105.0 35 240.0 36 575.0 37 2745.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.04515474378488 12.836123795027904 8.777270421106037 37.341451040081175 2 23.075000000000003 14.524999999999999 34.225 28.175 3 20.1 19.825 25.474999999999998 34.599999999999994 4 23.400000000000002 27.6 22.400000000000002 26.6 5 23.35 33.375 23.5 19.775000000000002 6 19.425 35.449999999999996 24.3 20.825 7 14.725 27.150000000000002 40.0 18.125 8 18.224999999999998 25.924999999999997 31.275 24.575 9 17.424999999999997 24.0 34.875 23.7 10-14 19.885 29.99 26.56 23.565 15-19 19.915 28.785 27.339999999999996 23.96 20-24 20.02 28.63 27.465 23.885 25-29 19.84 28.28 27.395000000000003 24.485 30-34 19.88 29.095 26.884999999999998 24.14 35-39 19.475 29.01 27.3 24.215 40-44 20.515 28.575 27.115000000000002 23.794999999999998 45-49 20.14 28.555000000000003 27.265 24.04 50-54 20.13 28.42 27.639999999999997 23.810000000000002 55-59 20.39 28.015 27.229999999999997 24.365000000000002 60-64 20.105 28.549999999999997 27.389999999999997 23.955000000000002 65-69 19.885 27.755000000000003 28.025 24.335 70-74 19.72 28.34 27.560000000000002 24.38 75-79 19.925 29.125 26.99 23.96 80-84 20.355 28.215 27.465 23.965 85-89 20.57 27.77 27.744999999999997 23.915 90-94 20.005 27.865000000000002 27.675 24.455 95-99 20.375 28.055000000000003 27.88 23.69 100-104 20.49 28.439999999999998 26.905 24.165 105-109 20.385 28.425 26.905 24.285 110-114 20.349999999999998 28.310000000000002 27.295 24.044999999999998 115-119 20.59 28.34 27.26 23.810000000000002 120-124 20.549999999999997 28.475 26.88 24.095 125-129 20.48 28.265 27.49 23.765 130-134 20.65 27.93 27.305 24.115000000000002 135-139 20.845 27.900000000000002 26.840000000000003 24.415 140-144 21.22 27.605 27.345000000000002 23.830000000000002 145-149 20.895 27.98 26.88 24.245 150-151 20.8 27.900000000000002 26.724999999999998 24.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 2.5 26 2.0 27 5.0 28 12.0 29 12.5 30 16.5 31 25.5 32 35.0 33 42.0 34 47.5 35 65.0 36 81.0 37 101.5 38 122.0 39 148.0 40 179.5 41 200.0 42 235.5 43 270.0 44 271.0 45 263.5 46 259.5 47 251.5 48 238.0 49 210.5 50 182.5 51 164.5 52 136.5 53 101.5 54 74.0 55 49.5 56 40.5 57 38.0 58 26.0 59 16.0 60 16.0 61 14.0 62 9.0 63 7.5 64 6.0 65 5.5 66 4.0 67 1.0 68 2.0 69 2.5 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.3875 0.0 0.0 0.0 0.0 100-101 0.45 0.0 0.0 0.0 0.0 102-103 0.675 0.0 0.0 0.0 0.0 104-105 0.825 0.0 0.0 0.0 0.0 106-107 1.0125 0.0 0.0 0.0 0.0 108-109 1.125 0.0 0.0 0.0 0.0 110-111 1.2999999999999998 0.0 0.0 0.0 0.0 112-113 1.5625 0.0 0.0 0.0 0.0 114-115 1.875 0.0 0.0 0.0 0.0 116-117 2.05 0.0 0.0 0.0 0.0 118-119 2.175 0.0 0.0 0.0 0.0 120-121 2.375 0.0 0.0 0.0 0.0 122-123 2.7249999999999996 0.0 0.0 0.0 0.0 124-125 2.9625 0.0 0.0 0.0 0.0 126-127 3.3125 0.0 0.0 0.0 0.0 128-129 3.6 0.0 0.0 0.0 0.0 130-131 3.925 0.0 0.0 0.0 0.0 132-133 4.175 0.0 0.0 0.0 0.0 134-135 4.5875 0.0 0.0 0.0 0.0 136-137 4.975 0.0 0.0 0.0 0.0 138-139 5.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATCGGA 10 0.006832588 144.9875 5 >>END_MODULE SRR7169603 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169603_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.87125 33.0 33.0 34.0 32.0 34.0 2 32.95475 34.0 33.0 34.0 32.0 34.0 3 32.9865 34.0 33.0 34.0 33.0 34.0 4 32.993 34.0 33.0 34.0 32.0 34.0 5 32.99625 34.0 33.0 34.0 33.0 34.0 6 37.15225 38.0 38.0 38.0 37.0 38.0 7 37.16425 38.0 38.0 38.0 37.0 38.0 8 37.13025 38.0 38.0 38.0 37.0 38.0 9 37.175 38.0 38.0 38.0 37.0 38.0 10-14 37.1411 38.0 38.0 38.0 37.0 38.0 15-19 37.151650000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.0567 38.0 38.0 38.0 37.0 38.0 25-29 37.07135 38.0 38.0 38.0 37.0 38.0 30-34 37.0266 38.0 38.0 38.0 37.0 38.0 35-39 37.019600000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.0018 38.0 38.0 38.0 37.0 38.0 45-49 37.043350000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.01245 38.0 38.0 38.0 37.0 38.0 55-59 36.94835 38.0 38.0 38.0 37.0 38.0 60-64 36.96375 38.0 38.0 38.0 36.6 38.0 65-69 36.85815000000001 38.0 38.0 38.0 36.2 38.0 70-74 36.796800000000005 38.0 38.0 38.0 36.0 38.0 75-79 36.72755 38.0 38.0 38.0 36.0 38.0 80-84 36.625750000000004 38.0 38.0 38.0 35.4 38.0 85-89 36.537549999999996 38.0 38.0 38.0 35.0 38.0 90-94 36.561400000000006 38.0 38.0 38.0 35.0 38.0 95-99 36.46065 38.0 38.0 38.0 35.0 38.0 100-104 36.40345000000001 38.0 38.0 38.0 34.6 38.0 105-109 36.24615 38.0 38.0 38.0 34.0 38.0 110-114 36.2339 38.0 38.0 38.0 34.0 38.0 115-119 36.03 38.0 38.0 38.0 34.0 38.0 120-124 35.86280000000001 38.0 38.0 38.0 33.4 38.0 125-129 35.605149999999995 38.0 37.6 38.0 31.8 38.0 130-134 35.4292 38.0 36.6 38.0 31.4 38.0 135-139 34.966249999999995 38.0 36.0 38.0 28.6 38.0 140-144 34.625800000000005 38.0 36.0 38.0 27.8 38.0 145-149 34.31055 38.0 35.8 38.0 27.0 38.0 150-151 30.947125 36.5 30.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 3.0 4 5.0 5 0.0 6 1.0 7 1.0 8 1.0 9 0.0 10 0.0 11 3.0 12 7.0 13 0.0 14 1.0 15 5.0 16 4.0 17 3.0 18 4.0 19 2.0 20 4.0 21 8.0 22 7.0 23 13.0 24 7.0 25 19.0 26 15.0 27 16.0 28 21.0 29 26.0 30 38.0 31 33.0 32 56.0 33 85.0 34 111.0 35 168.0 36 445.0 37 2871.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.540696218382166 22.96518908089156 13.072877535687452 26.421237165038818 2 27.680360721442888 26.427855711422843 30.01002004008016 15.881763527054108 3 19.127600902481827 28.60366006517924 33.01579343193783 19.2529456004011 4 23.333333333333332 33.20802005012531 23.483709273182956 19.974937343358395 5 24.50513655725382 37.18366324229516 21.623653219744423 16.68754698070659 6 21.709701679618952 37.17723740285786 23.339182752569563 17.773878164953622 7 20.255703183755326 22.236149410879918 37.152168463274 20.35597894209075 8 23.0383554775633 25.595387315116568 26.648282777638503 24.717974429681625 9 21.604010025062657 24.93734335839599 30.6516290726817 22.807017543859647 10-14 23.076151802276033 28.81636336291172 26.28465433398506 21.82283050082719 15-19 22.91844202716928 28.09664644844353 27.44498471101308 21.539926813374105 20-24 23.028327901729757 28.433191276009023 26.82376535472549 21.714715467535722 25-29 23.15752531835957 27.79003308934122 28.07079113606738 20.981650456231826 30-34 23.45511953089761 27.875507442489848 27.83040144339197 20.83897158322057 35-39 23.3495413303925 27.460023058799937 27.931224622788108 21.25921098801945 40-44 23.06766917293233 28.60651629072682 27.478696741854634 20.847117794486216 45-49 23.453634085213032 27.914786967418546 27.363408521303256 21.268170426065165 50-54 23.23460131308575 27.770260111261464 27.59985967022503 21.395278905427755 55-59 23.79854673014282 27.331495865697818 27.83763467802556 21.0323227261338 60-64 24.025062656641605 27.24310776942356 28.20551378446115 20.526315789473685 65-69 23.937236815720876 28.133146180068174 27.46641267294967 20.463204331261277 70-74 23.893317290820676 27.658294480372987 27.08176668170652 21.366621547099815 75-79 23.64146781632244 27.150591537998796 28.198315620613595 21.00962502506517 80-84 23.63144174854622 27.927611790655703 27.641868859033487 20.799077601764587 85-89 24.285571041812894 27.25859821518099 27.50426150606638 20.951569236939736 90-94 24.02867599137715 27.929011881485938 27.648267909961397 20.394044217175512 95-99 24.294662991731393 26.960661488348787 27.742420446003507 21.002255073916313 100-104 23.981560354762742 27.619381670591775 27.614370897429474 20.784687077216013 105-109 24.07815631262525 27.805611222444888 27.670340681362728 20.445891783567134 110-114 24.718087505638252 27.279105898862326 27.750213000551295 20.252593594948127 115-119 24.200501253132835 27.61904761904762 27.513784461152884 20.666666666666668 120-124 24.127732103469018 27.606777621816725 27.917585722879483 20.34790455183477 125-129 24.15141639508649 28.222612183504637 27.18475808473302 20.441213336675858 130-134 24.68919189893724 27.541608181271304 27.361138961299382 20.40806095849208 135-139 24.459818519075547 27.838772747781622 27.48282949817015 20.21857923497268 140-144 24.84836332648253 28.066569752869817 27.17429445084967 19.910772469797987 145-149 24.829591018444265 28.122493985565356 27.250400962309545 19.797514033680834 150-151 24.674674674674673 28.44094094094094 26.576576576576578 20.307807807807805 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 7.0 1 4.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 2.0 24 1.0 25 0.0 26 1.0 27 2.5 28 3.0 29 6.0 30 8.5 31 9.5 32 13.5 33 22.0 34 37.0 35 53.0 36 62.5 37 87.5 38 127.5 39 163.5 40 194.5 41 231.0 42 256.5 43 276.5 44 292.0 45 280.0 46 271.5 47 270.0 48 268.5 49 248.0 50 195.0 51 146.5 52 110.5 53 79.0 54 64.5 55 51.0 56 35.5 57 25.0 58 19.5 59 18.0 60 13.5 61 10.0 62 7.5 63 5.5 64 6.0 65 6.5 66 3.5 67 1.0 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.2 3 0.27499999999999997 4 0.25 5 0.22499999999999998 6 0.27499999999999997 7 0.27499999999999997 8 0.27499999999999997 9 0.25 10-14 0.265 15-19 0.255 20-24 0.27499999999999997 25-29 0.27 30-34 0.23500000000000001 35-39 0.255 40-44 0.25 45-49 0.25 50-54 0.23500000000000001 55-59 0.22499999999999998 60-64 0.25 65-69 0.26 70-74 0.265 75-79 0.26 80-84 0.26 85-89 0.27 90-94 0.265 95-99 0.22499999999999998 100-104 0.215 105-109 0.2 110-114 0.23500000000000001 115-119 0.25 120-124 0.26 125-129 0.27499999999999997 130-134 0.26 135-139 0.265 140-144 0.255 145-149 0.24 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77420973406925 99.425 2 0.2007024586051179 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025087807325639738 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.475 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.8500000000000001 0.0 0.0 0.0 0.0 106-107 1.0375 0.0 0.0 0.0 0.0 108-109 1.15 0.0 0.0 0.0 0.0 110-111 1.3250000000000002 0.0 0.0 0.0 0.0 112-113 1.5875 0.0 0.0 0.0 0.0 114-115 1.875 0.0 0.0 0.0 0.0 116-117 2.075 0.0 0.0 0.0 0.0 118-119 2.2 0.0 0.0 0.0 0.0 120-121 2.4000000000000004 0.0 0.0 0.0 0.0 122-123 2.75 0.0 0.0 0.0 0.0 124-125 2.9875 0.0 0.0 0.0 0.0 126-127 3.3375 0.0 0.0 0.0 0.0 128-129 3.6375 0.0 0.0 0.0 0.0 130-131 3.975 0.0 0.0 0.0 0.0 132-133 4.2125 0.0 0.0 0.0 0.0 134-135 4.65 0.0 0.0 0.0 0.0 136-137 5.025 0.0 0.0 0.0 0.0 138-139 5.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GACTCTG 10 0.00682755 145.0 5 >>END_MODULE Read 806576 spots for SRR7169603.sra Written 806576 spots for SRR7169603.sra Read 806576 spots for SRR7169603.sra Written 806576 spots for SRR7169603.sra Read 806576 spots for SRR7169603.sra Written 806576 spots for SRR7169603.sra Read 806576 spots for SRR7169603.sra Written 806576 spots for SRR7169603.sra Read 806576 spots for SRR7169603.sra Written 806576 spots for SRR7169603.sra Read 806576 spots for SRR7169603.sra Written 806576 spots for SRR7169603.sra Read 806576 spots for SRR7169603.sra Written 806576 spots for SRR7169603.sra Read 806576 spots for SRR7169603.sra Written 806576 spots for SRR7169603.sra Read 806590 spots for SRR7169603.sra Written 806590 spots for SRR7169603.sra Read 806576 spots for SRR7169603.sra Written 806576 spots for SRR7169603.sra Read 806576 spots for SRR7169603.sra Written 806576 spots for SRR7169603.sra Read 806576 spots for SRR7169603.sra Written 806576 spots for SRR7169603.sra Read 806576 spots for SRR7169603.sra Written 806576 spots for SRR7169603.sra Read 806576 spots for SRR7169603.sra Written 806576 spots for SRR7169603.sra Read 806576 spots for SRR7169603.sra Written 806576 spots for SRR7169603.sra Read 806576 spots for SRR7169603.sra Written 806576 spots for SRR7169603.sra Read 806576 spots for SRR7169603.sra Written 806576 spots for SRR7169603.sra Read 806576 spots for SRR7169603.sra Written 806576 spots for SRR7169603.sra Read 806576 spots for SRR7169603.sra Written 806576 spots for SRR7169603.sra Read 806576 spots for SRR7169603.sra Written 806576 spots for SRR7169603.sra SRR ids: ['SRR7169603.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g4b6e1e6 SRR7169603.sra spots: 16131534 blocks: [[1, 806576], [806577, 1613152], [1613153, 2419728], [2419729, 3226304], [3226305, 4032880], [4032881, 4839456], [4839457, 5646032], [5646033, 6452608], [6452609, 7259184], [7259185, 8065760], [8065761, 8872336], [8872337, 9678912], [9678913, 10485488], [10485489, 11292064], [11292065, 12098640], [12098641, 12905216], [12905217, 13711792], [13711793, 14518368], [14518369, 15324944], [15324945, 16131534]] SRR7169603 file size 5444747 SRR7169603 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169603 SRR7169603_1.fastq SRR7169603_2.fastq Input file: SRR7169603_1.fastq Paired file: SRR7169603_2.fastq trimmed: SRR7169603-trimmed-pair1.fastq, SRR7169603-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 08:59:15 2025 >> started Tue Feb 11 08:59:43 2025 >> done (27.765s) 16131534 read pairs processed; of these: 17100 ( 0.11%) short read pairs filtered out after trimming by size control 56367 ( 0.35%) empty read pairs filtered out after trimming by size control 16058067 (99.54%) read pairs available; of these: 6736559 (41.95%) trimmed read pairs available after processing 9321508 (58.05%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 4 0.00% 20 2 0.00% 21 1 0.00% 22 5 0.00% 23 5 0.00% 24 6 0.00% 25 2 0.00% 26 1 0.00% 27 10 0.00% 28 6 0.00% 29 8 0.00% 30 12 0.00% 31 5 0.00% 32 8 0.00% 33 5 0.00% 34 14 0.00% 35 8 0.00% 36 6 0.00% 37 15 0.00% 38 15 0.00% 39 14 0.00% 40 26 0.00% 41 17 0.00% 42 26 0.00% 43 25 0.00% 44 23 0.00% 45 19 0.00% 46 28 0.00% 47 29 0.00% 48 40 0.00% 49 42 0.00% 50 48 0.00% 51 50 0.00% 52 60 0.00% 53 61 0.00% 54 70 0.00% 55 84 0.00% 56 99 0.00% 57 114 0.00% 58 106 0.00% 59 131 0.00% 60 172 0.00% 61 175 0.00% 62 218 0.00% 63 215 0.00% 64 258 0.00% 65 310 0.00% 66 333 0.00% 67 416 0.00% 68 522 0.00% 69 703 0.00% 70 838 0.01% 71 714 0.00% 72 757 0.00% 73 820 0.01% 74 934 0.01% 75 1065 0.01% 76 1142 0.01% 77 1233 0.01% 78 1412 0.01% 79 1640 0.01% 80 1804 0.01% 81 2040 0.01% 82 2415 0.02% 83 2726 0.02% 84 3678 0.02% 85 4235 0.03% 86 4509 0.03% 87 4974 0.03% 88 5287 0.03% 89 5652 0.04% 90 5904 0.04% 91 6508 0.04% 92 7032 0.04% 93 7611 0.05% 94 8032 0.05% 95 8717 0.05% 96 9089 0.06% 97 9567 0.06% 98 9972 0.06% 99 10359 0.06% 100 11061 0.07% 101 11671 0.07% 102 12494 0.08% 103 13536 0.08% 104 14240 0.09% 105 14880 0.09% 106 15423 0.10% 107 16135 0.10% 108 16386 0.10% 109 16975 0.11% 110 18062 0.11% 111 18690 0.12% 112 19939 0.12% 113 20772 0.13% 114 22267 0.14% 115 23372 0.15% 116 24293 0.15% 117 25179 0.16% 118 26089 0.16% 119 26599 0.17% 120 27469 0.17% 121 28820 0.18% 122 30157 0.19% 123 31602 0.20% 124 33385 0.21% 125 35284 0.22% 126 36221 0.23% 127 38026 0.24% 128 39454 0.25% 129 40604 0.25% 130 42343 0.26% 131 44495 0.28% 132 46796 0.29% 133 49296 0.31% 134 52611 0.33% 135 55195 0.34% 136 58827 0.37% 137 62317 0.39% 138 66167 0.41% 139 70166 0.44% 140 74618 0.46% 141 80254 0.50% 142 88327 0.55% 143 98403 0.61% 144 113267 0.71% 145 132611 0.83% 146 161263 1.00% 147 215306 1.34% 148 321482 2.00% 149 643073 4.00% 150 3415413 21.27% 151 9321508 58.05% 16058067 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=35 prefix-density=0.18 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.10 sequence-density-rank=12 fanout-score=255.58 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=28.2 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.64 fanout-score-rank=43 prefix-density=0.31 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=26 fanout-score=235.26 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=26.0 sequence=GAAGAAGAAGAAA SRR7169603 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:00:39 Started mapping on | Feb 11 09:00:39 Finished on | Feb 11 09:03:15 Mapping speed, Million of reads per hour | 370.57 Number of input reads | 16058067 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 15251414 Uniquely mapped reads % | 94.98% Average mapped length | 294.91 Number of splices: Total | 14611915 Number of splices: Annotated (sjdb) | 14363647 Number of splices: GT/AG | 14391615 Number of splices: GC/AG | 175228 Number of splices: AT/AC | 12200 Number of splices: Non-canonical | 32872 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.86 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 289572 % of reads mapped to multiple loci | 1.80% Number of reads mapped to too many loci | 18495 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.07% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 531772 531772 531772 N_multimapping 289572 289572 289572 N_noFeature 350196 15083490 431328 N_ambiguous 148384 776 61140 UnstrandedReadsAssigned:14752834 PositiveStrandReadsAssigned:167148 NegativeStrandReadsAssigned:14758946 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169603 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169603-trimmed-pair1.fastq SRR7169603-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,058,067 reads, 14,636,489 reads pseudoaligned [quant] estimated average fragment length: 244.642 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,049 rounds 52401 SRR7169603.ke.tsv 34699 SRR7169603.se.tsv 87100 total ==> SRR7169603.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1774.36 266 9.39569 Potri.005G024800.1.v4.1 1035 791.358 26 2.05915 Potri.004G059700.1.v4.1 961 717.408 1 0.0873619 Potri.007G009000.2.v4.1 1416 1172.36 0 0 Potri.003G141000.2.v4.1 2943 2699.36 232 5.38661 Potri.016G087400.1.v4.1 270 77.738 1023 824.766 Potri.015G069301.1.v4.1 564 325.544 0 0 Potri.010G195200.1.v4.1 1773 1529.36 15 0.61471 Potri.012G127500.1.v4.1 977 733.37 9610 821.275 ==> SRR7169603.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1150 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 394 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR7169603 completed mapping pipeline successfully