Starting /dee2/code/volunteer_pipeline.sh SRR7169604 current disk space = 3054467092480 free memory = 1512190040 SRR7169604 SRAfilesize 21639e5530139f4e7976927a564a1a1e SRR7169604.sra SRR7169604.sra file validated SRR7169604 is paired end SRR7169604 is conventional basespace SRR7169604 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169604_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.721 34.0 33.0 34.0 32.0 34.0 2 33.368 34.0 33.0 34.0 33.0 34.0 3 33.43925 34.0 33.0 34.0 33.0 34.0 4 33.437 34.0 34.0 34.0 33.0 34.0 5 33.41675 34.0 33.0 34.0 33.0 34.0 6 36.95525 38.0 37.0 38.0 36.0 38.0 7 37.28325 38.0 38.0 38.0 36.0 38.0 8 37.30575 38.0 38.0 38.0 37.0 38.0 9 37.458 38.0 38.0 38.0 37.0 38.0 10-14 37.44605 38.0 38.0 38.0 37.0 38.0 15-19 37.40145 38.0 38.0 38.0 37.0 38.0 20-24 37.339600000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.3414 38.0 38.0 38.0 37.0 38.0 30-34 37.28905 38.0 38.0 38.0 36.8 38.0 35-39 37.1977 38.0 38.0 38.0 36.4 38.0 40-44 37.040350000000004 38.0 38.0 38.0 36.0 38.0 45-49 36.96385 38.0 38.0 38.0 35.8 38.0 50-54 36.77385 38.0 38.0 38.0 35.0 38.0 55-59 36.7687 38.0 38.0 38.0 34.8 38.0 60-64 36.6983 38.0 38.0 38.0 34.8 38.0 65-69 36.56315 38.0 38.0 38.0 34.0 38.0 70-74 36.59525000000001 38.0 38.0 38.0 34.0 38.0 75-79 36.441500000000005 38.0 38.0 38.0 34.0 38.0 80-84 36.314 38.0 37.6 38.0 33.8 38.0 85-89 36.13765 38.0 37.2 38.0 33.2 38.0 90-94 36.01695 38.0 37.0 38.0 33.0 38.0 95-99 35.96435 38.0 37.0 38.0 33.0 38.0 100-104 35.5604 38.0 36.6 38.0 30.4 38.0 105-109 35.38775 38.0 36.0 38.0 29.4 38.0 110-114 35.14945 38.0 36.0 38.0 28.6 38.0 115-119 34.8891 38.0 35.8 38.0 27.6 38.0 120-124 34.6408 38.0 35.0 38.0 26.8 38.0 125-129 34.32885 38.0 35.0 38.0 24.8 38.0 130-134 33.910849999999996 38.0 34.2 38.0 22.6 38.0 135-139 33.62595 38.0 34.0 38.0 21.0 38.0 140-144 33.03535000000001 38.0 34.0 38.0 14.8 38.0 145-149 32.17045 38.0 33.0 38.0 11.6 38.0 150-151 28.32275 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 4.0 14 2.0 15 6.0 16 3.0 17 7.0 18 5.0 19 6.0 20 6.0 21 6.0 22 20.0 23 11.0 24 14.0 25 17.0 26 32.0 27 30.0 28 34.0 29 35.0 30 57.0 31 81.0 32 90.0 33 138.0 34 198.0 35 362.0 36 841.0 37 1993.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.23018098394086 12.413968901351007 10.604129492735153 37.75172062197298 2 24.575 13.725000000000001 32.225 29.475 3 19.950000000000003 18.025 25.575 36.449999999999996 4 22.325 27.200000000000003 23.724999999999998 26.75 5 22.675 31.4 24.4 21.525 6 20.7 34.949999999999996 24.325 20.025000000000002 7 15.15 27.3 40.425 17.125 8 18.75 26.875 29.725 24.65 9 17.5 24.925 33.25 24.325 10-14 19.855 29.845 27.33 22.97 15-19 19.93 28.54 27.650000000000002 23.880000000000003 20-24 20.044999999999998 29.220000000000002 26.924999999999997 23.810000000000002 25-29 19.74 28.825 27.224999999999998 24.21 30-34 20.474999999999998 28.23 27.375 23.919999999999998 35-39 19.785 28.505000000000003 27.71 24.0 40-44 20.145 28.89 27.74 23.225 45-49 20.419999999999998 28.115000000000002 27.43 24.035 50-54 19.830000000000002 28.225 27.565 24.38 55-59 20.095 28.485 27.279999999999998 24.14 60-64 20.115 27.900000000000002 27.98 24.005000000000003 65-69 20.44 28.525 27.229999999999997 23.805 70-74 20.335 28.51 27.22 23.935000000000002 75-79 20.525 28.075 27.22 24.18 80-84 20.11 28.305000000000003 27.87 23.715 85-89 20.97 27.755000000000003 27.685 23.59 90-94 20.02 28.315 27.644999999999996 24.02 95-99 20.27 27.865000000000002 27.810000000000002 24.055 100-104 20.455227613806905 28.174087043521762 27.593796898449224 23.77688844422211 105-109 20.39 28.084999999999997 27.544999999999998 23.98 110-114 20.61355219697728 28.470623561205084 27.094384946451804 23.821439295365828 115-119 20.328131252501 28.431372549019606 27.110844337735095 24.129651860744296 120-124 20.94047023511756 28.194097048524263 27.01350675337669 23.85192596298149 125-129 20.62 27.87 27.744999999999997 23.765 130-134 20.76434395477965 28.662898304236904 26.702015907158223 23.87074183382522 135-139 21.044999999999998 28.43 27.034999999999997 23.49 140-144 20.905 28.060000000000002 27.425 23.61 145-149 20.46 28.34 27.310000000000002 23.89 150-151 19.9875 27.525 27.8125 24.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 1.0 19 1.0 20 0.0 21 0.5 22 1.0 23 0.5 24 1.5 25 3.5 26 3.5 27 4.0 28 7.0 29 9.0 30 11.0 31 20.5 32 31.5 33 33.5 34 38.5 35 53.5 36 76.0 37 86.5 38 112.5 39 163.0 40 187.0 41 210.0 42 237.0 43 258.5 44 281.5 45 300.0 46 296.5 47 292.0 48 251.0 49 196.0 50 179.0 51 150.5 52 128.5 53 98.0 54 65.0 55 51.0 56 40.0 57 29.0 58 22.5 59 19.5 60 14.0 61 8.0 62 5.0 63 5.5 64 4.5 65 2.0 66 1.0 67 1.0 68 1.5 69 2.5 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.925 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.05 105-109 0.0 110-114 0.09 115-119 0.04 120-124 0.05 125-129 0.0 130-134 0.045 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.325 0.0 0.0 0.0 0.0 104-105 0.425 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.5375 0.0 0.0 0.0 0.0 110-111 0.65 0.0 0.0 0.0 0.0 112-113 0.8125 0.0 0.0 0.0 0.0 114-115 0.9125 0.0 0.0 0.0 0.0 116-117 1.075 0.0 0.0 0.0 0.0 118-119 1.2875 0.0 0.0 0.0 0.0 120-121 1.5125000000000002 0.0 0.0 0.0 0.0 122-123 1.6875 0.0 0.0 0.0 0.0 124-125 1.9625 0.0 0.0 0.0 0.0 126-127 2.075 0.0 0.0 0.0 0.0 128-129 2.225 0.0 0.0 0.0 0.0 130-131 2.4375 0.0 0.0 0.0 0.0 132-133 2.725 0.0 0.0 0.0 0.0 134-135 2.9875 0.0 0.0 0.0 0.0 136-137 3.2 0.0 0.0 0.0 0.0 138-139 3.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTCGAT 10 0.006832588 144.9875 8 CTCGATG 10 0.006832588 144.9875 9 >>END_MODULE SRR7169604 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169604_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4605 33.0 33.0 34.0 32.0 34.0 2 32.79825 33.0 33.0 34.0 32.0 34.0 3 32.8245 34.0 33.0 34.0 32.0 34.0 4 32.89375 34.0 33.0 34.0 32.0 34.0 5 32.79275 34.0 33.0 34.0 32.0 34.0 6 37.00875 38.0 38.0 38.0 36.0 38.0 7 37.01925 38.0 38.0 38.0 36.0 38.0 8 37.0135 38.0 38.0 38.0 36.0 38.0 9 36.9725 38.0 38.0 38.0 36.0 38.0 10-14 36.871750000000006 38.0 38.0 38.0 36.0 38.0 15-19 36.9525 38.0 38.0 38.0 36.0 38.0 20-24 36.9194 38.0 38.0 38.0 36.0 38.0 25-29 36.9529 38.0 38.0 38.0 36.2 38.0 30-34 36.935500000000005 38.0 38.0 38.0 36.0 38.0 35-39 36.89495000000001 38.0 38.0 38.0 36.0 38.0 40-44 36.8769 38.0 38.0 38.0 36.0 38.0 45-49 36.82725000000001 38.0 38.0 38.0 36.0 38.0 50-54 36.58785 38.0 38.0 38.0 35.6 38.0 55-59 36.24545 38.0 38.0 38.0 34.8 38.0 60-64 36.070550000000004 38.0 38.0 38.0 34.6 38.0 65-69 35.91815 38.0 38.0 38.0 34.0 38.0 70-74 35.74005 38.0 38.0 38.0 33.2 38.0 75-79 35.5951 38.0 38.0 38.0 33.0 38.0 80-84 35.6839 38.0 38.0 38.0 32.6 38.0 85-89 35.836 38.0 38.0 38.0 33.4 38.0 90-94 35.79775 38.0 38.0 38.0 33.0 38.0 95-99 35.6769 38.0 38.0 38.0 32.4 38.0 100-104 35.62965 38.0 38.0 38.0 32.2 38.0 105-109 35.50765 38.0 38.0 38.0 31.4 38.0 110-114 35.33069999999999 38.0 37.4 38.0 30.6 38.0 115-119 35.0594 38.0 37.0 38.0 28.0 38.0 120-124 34.900800000000004 38.0 36.6 38.0 27.8 38.0 125-129 34.72485 38.0 36.0 38.0 27.4 38.0 130-134 34.2896 38.0 35.8 38.0 23.6 38.0 135-139 33.82835000000001 38.0 35.4 38.0 20.2 38.0 140-144 33.379400000000004 38.0 35.0 38.0 14.8 38.0 145-149 32.603449999999995 38.0 34.2 38.0 9.0 38.0 150-151 28.903875 36.0 18.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 5.0 4 2.0 5 2.0 6 1.0 7 2.0 8 1.0 9 3.0 10 2.0 11 6.0 12 11.0 13 27.0 14 20.0 15 1.0 16 2.0 17 5.0 18 7.0 19 4.0 20 4.0 21 13.0 22 17.0 23 15.0 24 18.0 25 33.0 26 30.0 27 32.0 28 39.0 29 54.0 30 47.0 31 65.0 32 79.0 33 87.0 34 125.0 35 225.0 36 470.0 37 2544.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.79159325446766 21.142713314875408 16.20941354140448 26.856279889252455 2 28.549999999999997 27.175 27.675 16.6 3 21.25 29.349999999999998 29.125 20.275000000000002 4 23.275000000000002 34.050000000000004 23.775 18.9 5 23.75 35.85 21.9 18.5 6 21.55 36.8 23.549999999999997 18.099999999999998 7 19.375 22.400000000000002 38.175 20.05 8 22.875 25.974999999999998 26.700000000000003 24.45 9 21.275 26.025 29.975 22.725 10-14 22.619881870057064 28.45630193212534 27.14485934527981 21.778956852537792 15-19 22.899043996196006 28.029430902447572 27.79418389308774 21.277341208268684 20-24 22.955000000000002 28.125 27.54 21.38 25-29 22.955000000000002 28.000000000000004 27.68 21.365000000000002 30-34 22.85 28.349999999999998 27.834999999999997 20.965 35-39 23.0 28.1 27.92 20.979999999999997 40-44 23.419999999999998 27.589999999999996 28.044999999999998 20.945 45-49 22.985 27.889999999999997 27.944999999999997 21.18 50-54 23.29916591297357 27.886644558335842 28.107727866546078 20.706461662144505 55-59 22.990663689872136 28.145930586563832 28.095189770651512 20.768215952912524 60-64 23.136954858454477 28.252996684519253 27.987758224942617 20.62229023208365 65-69 23.901141073530162 27.749066161797064 27.549506217059815 20.800286547612956 70-74 23.886328725038403 27.741935483870968 27.639528929851508 20.73220686123912 75-79 24.18039094966908 27.900056436303935 27.268995946847262 20.650556667179725 80-84 23.972427878478427 27.597651263722234 27.398519274955323 21.031401582844016 85-89 23.935791933353652 27.664329980696944 28.070710149344713 20.329167936604694 90-94 23.53269133299544 27.7749619868221 27.69893563101875 20.99341104916371 95-99 23.518696554166876 28.062541112179325 27.67292415119162 20.745838182462176 100-104 24.21329555802894 27.79520388545988 27.54730345036932 20.44419710614186 105-109 23.931407759623653 27.214325459052052 27.775810612575242 21.078456168749053 110-114 23.880068763272323 27.495196683183337 27.581150773586817 21.04358377995753 115-119 24.031321040666835 28.850719878757264 26.61278100530437 20.505178075271534 120-124 24.335791494090312 28.22002222446712 26.765329831296093 20.67885645014648 125-129 23.99108815636235 28.67486961365132 27.064661501848196 20.269380728138135 130-134 24.456079707198047 27.811102074013828 27.41968279788532 20.313135420902807 135-139 25.356067180560522 27.41334422379907 27.59712083312063 19.633467762519782 140-144 24.31865828092243 27.499105179731043 27.69852226824155 20.483714271104976 145-149 24.526072437708706 28.158232725404574 27.166709478551244 20.148985358335477 150-151 25.183942171163032 27.3912482251194 27.365431780043885 20.059377823673678 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 1.5 16 4.0 17 3.5 18 2.5 19 3.5 20 4.5 21 6.0 22 6.5 23 6.0 24 8.0 25 5.5 26 3.5 27 6.5 28 8.0 29 12.0 30 14.0 31 13.5 32 17.5 33 32.0 34 46.0 35 54.5 36 63.5 37 92.5 38 128.5 39 160.0 40 204.5 41 232.0 42 260.5 43 286.0 44 304.5 45 300.0 46 271.0 47 252.0 48 232.5 49 194.5 50 162.5 51 140.5 52 110.0 53 86.0 54 64.0 55 49.5 56 38.5 57 31.5 58 25.0 59 17.0 60 8.0 61 6.0 62 6.5 63 3.0 64 3.0 65 2.0 66 0.5 67 0.5 68 1.0 69 1.0 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.675 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.11 15-19 0.105 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.49 55-59 1.46 60-64 1.975 65-69 2.2849999999999997 70-74 2.35 75-79 2.545 80-84 2.075 85-89 1.5699999999999998 90-94 1.35 95-99 1.185 100-104 1.17 105-109 1.155 110-114 1.11 115-119 1.0250000000000001 120-124 1.01 125-129 1.2550000000000001 130-134 1.6400000000000001 135-139 2.0549999999999997 140-144 2.215 145-149 2.675 150-151 3.1625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8246492985972 99.625 2 0.15030060120240482 0.3 3 0.0250501002004008 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.45 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.5875 0.0 0.0 0.0 0.0 110-111 0.7125 0.0 0.0 0.0 0.0 112-113 0.8875 0.0 0.0 0.0 0.0 114-115 0.9874999999999999 0.0 0.0 0.0 0.0 116-117 1.15 0.0 0.0 0.0 0.0 118-119 1.3624999999999998 0.0 0.0 0.0 0.0 120-121 1.5875 0.0 0.0 0.0 0.0 122-123 1.7625000000000002 0.0 0.0 0.0 0.0 124-125 2.0375 0.0 0.0 0.0 0.0 126-127 2.175 0.0 0.0 0.0 0.0 128-129 2.3375 0.0 0.0 0.0 0.0 130-131 2.5375 0.0 0.0 0.0 0.0 132-133 2.8375000000000004 0.0 0.0 0.0 0.0 134-135 3.0999999999999996 0.0 0.0 0.0 0.0 136-137 3.3125 0.0 0.0 0.0 0.0 138-139 3.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGTTCC 10 0.006960991 144.0875 4 AGCAAAC 10 0.006960991 144.0875 1 TAGGTTC 10 0.006960991 144.0875 3 >>END_MODULE Read 872122 spots for SRR7169604.sra Written 872122 spots for SRR7169604.sra Read 872122 spots for SRR7169604.sra Written 872122 spots for SRR7169604.sra Read 872122 spots for SRR7169604.sra Written 872122 spots for SRR7169604.sra Read 872122 spots for SRR7169604.sra Written 872122 spots for SRR7169604.sra Read 872122 spots for SRR7169604.sra Written 872122 spots for SRR7169604.sra Read 872122 spots for SRR7169604.sra Written 872122 spots for SRR7169604.sra Read 872122 spots for SRR7169604.sra Written 872122 spots for SRR7169604.sra Read 872122 spots for SRR7169604.sra Written 872122 spots for SRR7169604.sra Read 872122 spots for SRR7169604.sra Written 872122 spots for SRR7169604.sra Read 872122 spots for SRR7169604.sra Written 872122 spots for SRR7169604.sra Read 872122 spots for SRR7169604.sra Written 872122 spots for SRR7169604.sra Read 872122 spots for SRR7169604.sra Written 872122 spots for SRR7169604.sra Read 872122 spots for SRR7169604.sra Written 872122 spots for SRR7169604.sra Read 872122 spots for SRR7169604.sra Written 872122 spots for SRR7169604.sra Read 872122 spots for SRR7169604.sra Written 872122 spots for SRR7169604.sra Read 872122 spots for SRR7169604.sra Written 872122 spots for SRR7169604.sra Read 872122 spots for SRR7169604.sra Written 872122 spots for SRR7169604.sra Read 872122 spots for SRR7169604.sra Written 872122 spots for SRR7169604.sra Read 872122 spots for SRR7169604.sra Written 872122 spots for SRR7169604.sra Read 872122 spots for SRR7169604.sra Written 872122 spots for SRR7169604.sra SRR ids: ['SRR7169604.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f9fncbjs SRR7169604.sra spots: 17442440 blocks: [[1, 872122], [872123, 1744244], [1744245, 2616366], [2616367, 3488488], [3488489, 4360610], [4360611, 5232732], [5232733, 6104854], [6104855, 6976976], [6976977, 7849098], [7849099, 8721220], [8721221, 9593342], [9593343, 10465464], [10465465, 11337586], [11337587, 12209708], [12209709, 13081830], [13081831, 13953952], [13953953, 14826074], [14826075, 15698196], [15698197, 16570318], [16570319, 17442440]] SRR7169604 file size 5888970 SRR7169604 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169604 SRR7169604_1.fastq SRR7169604_2.fastq Input file: SRR7169604_1.fastq Paired file: SRR7169604_2.fastq trimmed: SRR7169604-trimmed-pair1.fastq, SRR7169604-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:43:44 2025 >> started Tue Feb 11 09:44:02 2025 >> done (17.962s) 17442440 read pairs processed; of these: 18652 ( 0.11%) short read pairs filtered out after trimming by size control 17306 ( 0.10%) empty read pairs filtered out after trimming by size control 17406482 (99.79%) read pairs available; of these: 9839671 (56.53%) trimmed read pairs available after processing 7566811 (43.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 8 0.00% 20 6 0.00% 21 5 0.00% 22 9 0.00% 23 4 0.00% 24 7 0.00% 25 4 0.00% 26 5 0.00% 27 17 0.00% 28 15 0.00% 29 7 0.00% 30 13 0.00% 31 16 0.00% 32 7 0.00% 33 15 0.00% 34 19 0.00% 35 13 0.00% 36 17 0.00% 37 20 0.00% 38 24 0.00% 39 31 0.00% 40 34 0.00% 41 31 0.00% 42 29 0.00% 43 37 0.00% 44 36 0.00% 45 57 0.00% 46 42 0.00% 47 64 0.00% 48 73 0.00% 49 67 0.00% 50 80 0.00% 51 80 0.00% 52 116 0.00% 53 113 0.00% 54 121 0.00% 55 123 0.00% 56 137 0.00% 57 134 0.00% 58 168 0.00% 59 217 0.00% 60 237 0.00% 61 268 0.00% 62 294 0.00% 63 335 0.00% 64 369 0.00% 65 430 0.00% 66 501 0.00% 67 528 0.00% 68 607 0.00% 69 833 0.00% 70 1104 0.01% 71 1065 0.01% 72 1108 0.01% 73 1230 0.01% 74 1453 0.01% 75 1813 0.01% 76 1605 0.01% 77 1387 0.01% 78 1743 0.01% 79 2763 0.02% 80 4281 0.02% 81 2155 0.01% 82 2489 0.01% 83 2740 0.02% 84 3780 0.02% 85 4592 0.03% 86 5154 0.03% 87 5499 0.03% 88 5328 0.03% 89 5768 0.03% 90 6024 0.03% 91 6465 0.04% 92 7054 0.04% 93 7664 0.04% 94 8201 0.05% 95 9092 0.05% 96 9873 0.06% 97 10642 0.06% 98 11788 0.07% 99 14584 0.08% 100 17873 0.10% 101 15114 0.09% 102 13058 0.08% 103 13117 0.08% 104 14266 0.08% 105 15102 0.09% 106 15824 0.09% 107 16758 0.10% 108 17456 0.10% 109 18277 0.11% 110 19138 0.11% 111 20390 0.12% 112 21250 0.12% 113 22348 0.13% 114 23657 0.14% 115 25309 0.15% 116 26859 0.15% 117 28058 0.16% 118 29237 0.17% 119 30064 0.17% 120 32083 0.18% 121 33871 0.19% 122 35523 0.20% 123 37718 0.22% 124 39968 0.23% 125 41958 0.24% 126 44652 0.26% 127 46795 0.27% 128 49259 0.28% 129 52260 0.30% 130 55404 0.32% 131 57765 0.33% 132 61559 0.35% 133 67246 0.39% 134 72344 0.42% 135 77753 0.45% 136 84217 0.48% 137 91791 0.53% 138 99962 0.57% 139 112208 0.64% 140 121827 0.70% 141 133177 0.77% 142 149837 0.86% 143 172289 0.99% 144 204969 1.18% 145 248500 1.43% 146 317447 1.82% 147 434079 2.49% 148 660301 3.79% 149 1264006 7.26% 150 4380877 25.17% 151 7566811 43.47% 17406482 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=41 prefix-density=0.14 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.09 sequence-density-rank=16 fanout-score=268.03 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=29.5 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.41 fanout-score-rank=40 prefix-density=0.31 prefix-fanout=2.2 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=22 fanout-score=295.80 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=30.5 sequence=AAGAAGAAGAAA SRR7169604 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:44:46 Started mapping on | Feb 11 09:44:47 Finished on | Feb 11 09:46:35 Mapping speed, Million of reads per hour | 580.22 Number of input reads | 17406482 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 16452196 Uniquely mapped reads % | 94.52% Average mapped length | 293.69 Number of splices: Total | 15821301 Number of splices: Annotated (sjdb) | 15536430 Number of splices: GT/AG | 15578095 Number of splices: GC/AG | 191681 Number of splices: AT/AC | 14251 Number of splices: Non-canonical | 37274 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 295131 % of reads mapped to multiple loci | 1.70% Number of reads mapped to too many loci | 17980 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.64% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 679688 679688 679688 N_multimapping 295131 295131 295131 N_noFeature 398888 16279948 488477 N_ambiguous 151601 997 68262 UnstrandedReadsAssigned:15901707 PositiveStrandReadsAssigned:171251 NegativeStrandReadsAssigned:15895457 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169604 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169604-trimmed-pair1.fastq SRR7169604-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,406,482 reads, 15,804,412 reads pseudoaligned [quant] estimated average fragment length: 264.523 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,172 rounds 52401 SRR7169604.ke.tsv 34699 SRR7169604.se.tsv 87100 total ==> SRR7169604.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1754.48 334 12.3707 Potri.005G024800.1.v4.1 1035 771.477 71 5.98039 Potri.004G059700.1.v4.1 961 697.544 4 0.372634 Potri.007G009000.2.v4.1 1416 1152.48 0 0 Potri.003G141000.2.v4.1 2943 2679.48 310.038 7.51898 Potri.016G087400.1.v4.1 270 72.8117 1185.55 1058.07 Potri.015G069301.1.v4.1 564 308.162 0 0 Potri.010G195200.1.v4.1 1773 1509.48 82 3.53006 Potri.012G127500.1.v4.1 977 713.522 8282 754.262 ==> SRR7169604.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2165 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 337 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7169604 completed mapping pipeline successfully