Starting /dee2/code/volunteer_pipeline.sh SRR7169605 current disk space = 3054461657088 free memory = 1487282348 SRR7169605 SRAfilesize bfb388e7592b6b04762c5cc5674a199b SRR7169605.sra SRR7169605.sra file validated SRR7169605 is paired end SRR7169605 is conventional basespace SRR7169605 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169605_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.87925 34.0 33.0 34.0 33.0 34.0 2 33.39 34.0 34.0 34.0 33.0 34.0 3 33.42825 34.0 34.0 34.0 33.0 34.0 4 33.51475 34.0 34.0 34.0 33.0 34.0 5 33.5065 34.0 34.0 34.0 33.0 34.0 6 37.1165 38.0 37.0 38.0 36.0 38.0 7 37.39575 38.0 38.0 38.0 37.0 38.0 8 37.466 38.0 38.0 38.0 37.0 38.0 9 37.53 38.0 38.0 38.0 37.0 38.0 10-14 37.545399999999994 38.0 38.0 38.0 38.0 38.0 15-19 37.52415 38.0 38.0 38.0 38.0 38.0 20-24 37.54025 38.0 38.0 38.0 38.0 38.0 25-29 37.524699999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.50509999999999 38.0 38.0 38.0 38.0 38.0 35-39 37.38125 38.0 38.0 38.0 37.0 38.0 40-44 37.35425 38.0 38.0 38.0 37.0 38.0 45-49 37.32705 38.0 38.0 38.0 37.0 38.0 50-54 37.288000000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.20145 38.0 38.0 38.0 36.4 38.0 60-64 37.16685 38.0 38.0 38.0 36.2 38.0 65-69 37.149899999999995 38.0 38.0 38.0 36.0 38.0 70-74 37.02335 38.0 38.0 38.0 36.0 38.0 75-79 36.81205 38.0 38.0 38.0 35.8 38.0 80-84 36.754149999999996 38.0 38.0 38.0 35.6 38.0 85-89 36.6738 38.0 38.0 38.0 35.4 38.0 90-94 36.60125 38.0 38.0 38.0 35.0 38.0 95-99 36.4482 38.0 38.0 38.0 34.4 38.0 100-104 36.4555 38.0 38.0 38.0 34.4 38.0 105-109 36.24455 38.0 38.0 38.0 34.0 38.0 110-114 36.15405 38.0 38.0 38.0 34.0 38.0 115-119 35.96015 38.0 37.8 38.0 33.2 38.0 120-124 35.7548 38.0 37.2 38.0 31.8 38.0 125-129 35.612500000000004 38.0 37.0 38.0 31.2 38.0 130-134 35.51715 38.0 36.6 38.0 31.2 38.0 135-139 35.25435 38.0 36.0 38.0 30.6 38.0 140-144 34.9687 38.0 36.0 38.0 29.4 38.0 145-149 34.333600000000004 38.0 35.2 38.0 26.8 38.0 150-151 31.502375 36.5 31.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 1.0 17 8.0 18 16.0 19 14.0 20 5.0 21 5.0 22 6.0 23 5.0 24 11.0 25 17.0 26 10.0 27 17.0 28 15.0 29 29.0 30 38.0 31 44.0 32 62.0 33 69.0 34 102.0 35 212.0 36 505.0 37 2807.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.73791348600509 11.755725190839694 10.585241730279899 36.921119592875314 2 24.525 14.099999999999998 32.9 28.475 3 19.625 17.974999999999998 24.375 38.025 4 22.775000000000002 25.8 22.75 28.675 5 25.1 29.825000000000003 23.724999999999998 21.349999999999998 6 20.3 34.475 23.9 21.325 7 15.2 28.475 39.35 16.975 8 18.05 27.500000000000004 31.35 23.1 9 17.599999999999998 25.05 33.800000000000004 23.549999999999997 10-14 20.32 29.515 27.655 22.509999999999998 15-19 19.685 28.435 27.655 24.224999999999998 20-24 19.7 28.52 27.775 24.005000000000003 25-29 19.525000000000002 28.46 27.544999999999998 24.47 30-34 19.830000000000002 28.194999999999997 28.044999999999998 23.93 35-39 20.555 28.449999999999996 27.49 23.505000000000003 40-44 19.71 28.720000000000002 28.305000000000003 23.265 45-49 20.145 28.605000000000004 27.72 23.53 50-54 20.19 28.139999999999997 27.625 24.044999999999998 55-59 20.32 28.42 27.765 23.494999999999997 60-64 19.935 28.53 27.325 24.21 65-69 20.075000000000003 28.999999999999996 27.47 23.455000000000002 70-74 20.34 29.04 27.185 23.435 75-79 20.02 29.654999999999998 26.85 23.474999999999998 80-84 19.2 29.104999999999997 27.515 24.18 85-89 19.89 28.705000000000002 27.41 23.995 90-94 20.705000000000002 28.84 26.619999999999997 23.835 95-99 19.885 28.935 27.400000000000002 23.78 100-104 20.215 29.175 27.12 23.49 105-109 20.05 28.87 27.32 23.76 110-114 20.805 28.804999999999996 27.284999999999997 23.105 115-119 20.615 28.994999999999997 26.815 23.575 120-124 20.735 28.375 27.175 23.715 125-129 20.895 28.610000000000003 26.855 23.64 130-134 20.705000000000002 28.904999999999998 26.445 23.945 135-139 20.325 28.51 27.055 24.11 140-144 21.025 28.62 26.745 23.61 145-149 21.085 28.575 26.674999999999997 23.665 150-151 21.4 30.2375 25.1 23.2625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 0.5 22 0.5 23 0.5 24 3.5 25 4.5 26 3.5 27 7.5 28 8.0 29 8.5 30 17.0 31 23.0 32 31.0 33 39.5 34 48.5 35 66.0 36 79.0 37 100.0 38 124.0 39 154.5 40 191.0 41 218.0 42 235.0 43 267.5 44 279.5 45 267.0 46 265.0 47 266.0 48 258.0 49 215.0 50 174.0 51 143.0 52 133.5 53 113.5 54 72.0 55 49.5 56 35.5 57 28.5 58 21.5 59 12.0 60 7.5 61 5.0 62 4.5 63 4.0 64 2.0 65 4.0 66 3.5 67 0.5 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67171717171716 98.675 2 0.30303030303030304 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025252525252525252 0.7250000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGC 29 0.7250000000000001 TruSeq Adapter, Index 9 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.5625 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.725 0.0 0.0 0.0 0.0 106-107 0.8125 0.0 0.0 0.0 0.0 108-109 0.9125 0.0 0.0 0.0 0.0 110-111 1.1 0.0 0.0 0.0 0.0 112-113 1.275 0.0 0.0 0.0 0.0 114-115 1.55 0.0 0.0 0.0 0.0 116-117 1.8250000000000002 0.0 0.0 0.0 0.0 118-119 2.075 0.0 0.0 0.0 0.0 120-121 2.2375 0.0 0.0 0.0 0.0 122-123 2.5250000000000004 0.0 0.0 0.0 0.0 124-125 2.8375 0.0 0.0 0.0 0.0 126-127 3.1500000000000004 0.0 0.0 0.0 0.0 128-129 3.425 0.0 0.0 0.0 0.0 130-131 3.8125 0.0 0.0 0.0 0.0 132-133 4.275 0.0 0.0 0.0 0.0 134-135 4.55 0.0 0.0 0.0 0.0 136-137 5.0875 0.0 0.0 0.0 0.0 138-139 5.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCATCT 10 0.006832588 144.9875 3 CAAAATT 10 0.006832588 144.9875 3 >>END_MODULE SRR7169605 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169605_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.81475 33.0 33.0 34.0 32.0 34.0 2 32.999 34.0 33.0 34.0 32.0 34.0 3 32.98775 34.0 33.0 34.0 32.0 34.0 4 32.9385 34.0 33.0 34.0 32.0 34.0 5 32.97275 34.0 33.0 34.0 33.0 34.0 6 37.0365 38.0 38.0 38.0 37.0 38.0 7 37.1535 38.0 38.0 38.0 37.0 38.0 8 37.1615 38.0 38.0 38.0 37.0 38.0 9 37.1415 38.0 38.0 38.0 37.0 38.0 10-14 37.16945 38.0 38.0 38.0 37.0 38.0 15-19 37.1146 38.0 38.0 38.0 37.0 38.0 20-24 37.075149999999994 38.0 38.0 38.0 37.0 38.0 25-29 37.071549999999995 38.0 38.0 38.0 37.0 38.0 30-34 36.99615 38.0 38.0 38.0 36.8 38.0 35-39 37.00895 38.0 38.0 38.0 37.0 38.0 40-44 36.9668 38.0 38.0 38.0 36.6 38.0 45-49 37.012 38.0 38.0 38.0 37.0 38.0 50-54 36.9674 38.0 38.0 38.0 36.4 38.0 55-59 36.44805 38.0 37.8 38.0 33.6 38.0 60-64 36.8455 38.0 38.0 38.0 36.0 38.0 65-69 36.7325 38.0 38.0 38.0 36.0 38.0 70-74 36.47685 38.0 38.0 38.0 35.6 38.0 75-79 36.373000000000005 38.0 38.0 38.0 35.0 38.0 80-84 36.3275 38.0 38.0 38.0 34.6 38.0 85-89 36.25260000000001 38.0 38.0 38.0 34.4 38.0 90-94 36.1448 38.0 38.0 38.0 34.0 38.0 95-99 36.09205 38.0 38.0 38.0 34.0 38.0 100-104 36.03895 38.0 38.0 38.0 34.0 38.0 105-109 35.91799999999999 38.0 38.0 38.0 33.8 38.0 110-114 35.7562 38.0 38.0 38.0 33.0 38.0 115-119 35.574749999999995 38.0 37.8 38.0 33.0 38.0 120-124 35.37195 38.0 37.0 38.0 31.0 38.0 125-129 34.964 38.0 36.6 38.0 28.2 38.0 130-134 34.769400000000005 38.0 36.0 38.0 28.0 38.0 135-139 34.46265 38.0 36.0 38.0 26.0 38.0 140-144 34.164 38.0 35.4 38.0 24.0 38.0 145-149 33.54005 38.0 35.0 38.0 17.6 38.0 150-151 30.073125 36.5 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 0.0 4 0.0 5 0.0 6 0.0 7 2.0 8 3.0 9 1.0 10 3.0 11 1.0 12 3.0 13 4.0 14 4.0 15 10.0 16 13.0 17 23.0 18 0.0 19 9.0 20 7.0 21 5.0 22 10.0 23 11.0 24 11.0 25 18.0 26 23.0 27 26.0 28 28.0 29 42.0 30 41.0 31 52.0 32 58.0 33 75.0 34 101.0 35 179.0 36 459.0 37 2765.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.896120150187734 21.827284105131415 14.44305381727159 26.83354192740926 2 30.39879608728367 26.235264609982444 27.99097065462754 15.374968648106346 3 20.09533366783743 28.62518815855494 29.97992975413949 21.299548419468138 4 23.27564584900928 32.90694757963381 24.88086280411337 18.936543767243542 5 26.116407425990968 35.19819367787255 21.77621675865529 16.909182137481185 6 22.07759699624531 37.49687108886108 23.454317897371716 16.971214017521902 7 20.0 22.60325406758448 38.57321652065082 18.823529411764707 8 22.872872872872875 27.37737737737738 27.402402402402405 22.347347347347345 9 21.25156445556946 25.556946182728414 30.287859824780977 22.90362953692115 10-14 23.6784140969163 28.83460152182619 26.61193432118542 20.875050060072088 15-19 23.15009512366076 27.776108941624113 27.98137578852508 21.092420146190047 20-24 23.352693771279792 28.239535349489287 27.313238533947526 21.094532345283394 25-29 23.224481618751877 28.238004607833318 27.541821095862968 20.99569267755184 30-34 22.881186135043077 27.92526547786015 28.21578841915448 20.977759967942298 35-39 22.901642628205128 28.06991185897436 28.03485576923077 20.993589743589745 40-44 23.578009212898056 27.668736230723013 27.89405167234128 20.859202884037654 45-49 23.158579940914326 27.830354013319315 28.306043763457012 20.70502228230935 50-54 23.038430744595676 27.892313851080864 27.75220176140913 21.31705364291433 55-59 23.34451173732419 27.719105060313332 28.379798788728166 20.556584413634315 60-64 22.86629624067678 28.522801221404613 28.022225559393306 20.588676978525307 65-69 23.26675677028583 28.412674575762125 27.58171897682335 20.738849677128698 70-74 23.389236545682103 27.939924906132667 27.944931163954944 20.72590738423029 75-79 23.306124492964095 27.903250037558212 28.35895638239271 20.43166908708498 80-84 23.784487506884982 28.16083320815182 27.800310450152722 20.254368834810474 85-89 23.083471032997846 28.140804166040763 28.331080066095836 20.444644734865555 90-94 23.312637692769876 28.309633486881637 28.174444221910676 20.20328459843781 95-99 23.364532759397367 27.8292206817158 28.194604334551276 20.61164222433555 100-104 24.328111706120815 27.325959661678596 27.97157299434463 20.374355637855963 105-109 23.884553821528613 27.67607042817127 27.946178471388556 20.493197278911566 110-114 24.329195034040847 27.763315979175008 27.65818982779335 20.249299158990787 115-119 24.640801001251564 27.989987484355446 27.894868585732162 19.474342928660825 120-124 23.94732889400691 27.427026485755768 27.947729434736896 20.677915185500424 125-129 24.415285220614013 27.405218610707667 27.886011919667453 20.293484249010866 130-134 24.694572401361906 27.59363108351692 27.533546965752052 20.178249549369117 135-139 24.370084656614736 27.751339978961077 27.445774683163854 20.432800681260332 140-144 24.563160266359585 28.243128223101188 27.296850748510487 19.89686076202874 145-149 25.18018018018018 28.048048048048045 26.876876876876878 19.894894894894897 150-151 24.66558319789974 27.678459807475935 27.84098012251531 19.814976872109014 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 0.5 24 1.0 25 2.5 26 4.0 27 4.0 28 5.5 29 10.5 30 12.0 31 14.0 32 23.5 33 32.5 34 42.0 35 59.0 36 76.5 37 106.5 38 146.5 39 178.0 40 209.5 41 241.0 42 267.0 43 277.0 44 276.0 45 279.0 46 268.5 47 248.5 48 230.0 49 206.5 50 181.5 51 149.5 52 121.0 53 92.5 54 64.0 55 48.5 56 37.5 57 23.5 58 14.0 59 12.0 60 8.5 61 5.0 62 5.0 63 4.0 64 1.0 65 1.0 66 1.0 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.325 3 0.35000000000000003 4 0.325 5 0.35000000000000003 6 0.125 7 0.125 8 0.1 9 0.125 10-14 0.12 15-19 0.13 20-24 0.13999999999999999 25-29 0.16999999999999998 30-34 0.18 35-39 0.16 40-44 0.13999999999999999 45-49 0.145 50-54 0.08 55-59 0.105 60-64 0.11499999999999999 65-69 0.11499999999999999 70-74 0.125 75-79 0.155 80-84 0.145 85-89 0.145 90-94 0.13999999999999999 95-99 0.105 100-104 0.095 105-109 0.04 110-114 0.12 115-119 0.125 120-124 0.135 125-129 0.165 130-134 0.13999999999999999 135-139 0.185 140-144 0.135 145-149 0.1 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49431099873578 98.375 2 0.4804045512010114 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025284450063211124 0.675 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 27 0.675 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.6625000000000001 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 0.8374999999999999 0.0 0.0 0.0 0.0 108-109 0.9375 0.0 0.0 0.0 0.0 110-111 1.1124999999999998 0.0 0.0 0.0 0.0 112-113 1.3 0.0 0.0 0.0 0.0 114-115 1.575 0.0 0.0 0.0 0.0 116-117 1.8250000000000002 0.0 0.0 0.0 0.0 118-119 2.075 0.0 0.0 0.0 0.0 120-121 2.2375 0.0 0.0 0.0 0.0 122-123 2.5250000000000004 0.0 0.0 0.0 0.0 124-125 2.8625 0.0 0.0 0.0 0.0 126-127 3.1625 0.0 0.0 0.0 0.0 128-129 3.425 0.0 0.0 0.0 0.0 130-131 3.8125 0.0 0.0 0.0 0.0 132-133 4.275 0.0 0.0 0.0 0.0 134-135 4.55 0.0 0.0 0.0 0.0 136-137 5.074999999999999 0.0 0.0 0.0 0.0 138-139 5.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGTAGA 10 0.006830828 145.0 5 >>END_MODULE Read 850900 spots for SRR7169605.sra Written 850900 spots for SRR7169605.sra Read 850900 spots for SRR7169605.sra Written 850900 spots for SRR7169605.sra Read 850900 spots for SRR7169605.sra Written 850900 spots for SRR7169605.sra Read 850900 spots for SRR7169605.sra Written 850900 spots for SRR7169605.sra Read 850900 spots for SRR7169605.sra Written 850900 spots for SRR7169605.sra Read 850900 spots for SRR7169605.sra Written 850900 spots for SRR7169605.sra Read 850900 spots for SRR7169605.sra Written 850900 spots for SRR7169605.sra Read 850900 spots for SRR7169605.sra Written 850900 spots for SRR7169605.sra Read 850900 spots for SRR7169605.sra Written 850900 spots for SRR7169605.sra Read 850900 spots for SRR7169605.sra Written 850900 spots for SRR7169605.sra Read 850900 spots for SRR7169605.sra Written 850900 spots for SRR7169605.sra Read 850900 spots for SRR7169605.sra Written 850900 spots for SRR7169605.sra Read 850900 spots for SRR7169605.sra Written 850900 spots for SRR7169605.sra Read 850900 spots for SRR7169605.sra Written 850900 spots for SRR7169605.sra Read 850900 spots for SRR7169605.sra Written 850900 spots for SRR7169605.sra Read 850900 spots for SRR7169605.sra Written 850900 spots for SRR7169605.sra Read 850900 spots for SRR7169605.sra Written 850900 spots for SRR7169605.sra Read 850900 spots for SRR7169605.sra Written 850900 spots for SRR7169605.sra Read 850900 spots for SRR7169605.sra Written 850900 spots for SRR7169605.sra Read 850915 spots for SRR7169605.sra Written 850915 spots for SRR7169605.sra SRR ids: ['SRR7169605.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__dpqmpp6 SRR7169605.sra spots: 17018015 blocks: [[1, 850900], [850901, 1701800], [1701801, 2552700], [2552701, 3403600], [3403601, 4254500], [4254501, 5105400], [5105401, 5956300], [5956301, 6807200], [6807201, 7658100], [7658101, 8509000], [8509001, 9359900], [9359901, 10210800], [10210801, 11061700], [11061701, 11912600], [11912601, 12763500], [12763501, 13614400], [13614401, 14465300], [14465301, 15316200], [15316201, 16167100], [16167101, 17018015]] SRR7169605 file size 5745146 SRR7169605 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169605 SRR7169605_1.fastq SRR7169605_2.fastq Input file: SRR7169605_1.fastq Paired file: SRR7169605_2.fastq trimmed: SRR7169605-trimmed-pair1.fastq, SRR7169605-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:42:51 2025 >> started Tue Feb 11 09:43:10 2025 >> done (18.527s) 17018015 read pairs processed; of these: 11343 ( 0.07%) short read pairs filtered out after trimming by size control 146998 ( 0.86%) empty read pairs filtered out after trimming by size control 16859674 (99.07%) read pairs available; of these: 6919741 (41.04%) trimmed read pairs available after processing 9939933 (58.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 6 0.00% 20 1 0.00% 21 5 0.00% 22 3 0.00% 23 2 0.00% 24 4 0.00% 25 7 0.00% 26 6 0.00% 27 4 0.00% 28 9 0.00% 29 4 0.00% 30 12 0.00% 31 7 0.00% 32 9 0.00% 33 7 0.00% 34 13 0.00% 35 6 0.00% 36 14 0.00% 37 21 0.00% 38 13 0.00% 39 20 0.00% 40 17 0.00% 41 18 0.00% 42 22 0.00% 43 34 0.00% 44 37 0.00% 45 45 0.00% 46 57 0.00% 47 58 0.00% 48 70 0.00% 49 70 0.00% 50 77 0.00% 51 95 0.00% 52 87 0.00% 53 100 0.00% 54 96 0.00% 55 136 0.00% 56 126 0.00% 57 162 0.00% 58 154 0.00% 59 206 0.00% 60 212 0.00% 61 239 0.00% 62 294 0.00% 63 267 0.00% 64 341 0.00% 65 387 0.00% 66 425 0.00% 67 492 0.00% 68 599 0.00% 69 958 0.01% 70 1190 0.01% 71 918 0.01% 72 954 0.01% 73 1060 0.01% 74 1149 0.01% 75 1271 0.01% 76 1419 0.01% 77 1512 0.01% 78 1739 0.01% 79 1911 0.01% 80 2154 0.01% 81 2410 0.01% 82 2830 0.02% 83 3177 0.02% 84 4026 0.02% 85 4633 0.03% 86 4927 0.03% 87 5398 0.03% 88 5838 0.03% 89 6457 0.04% 90 6696 0.04% 91 7274 0.04% 92 7841 0.05% 93 8514 0.05% 94 9127 0.05% 95 9841 0.06% 96 10572 0.06% 97 11098 0.07% 98 11702 0.07% 99 12534 0.07% 100 13306 0.08% 101 13746 0.08% 102 14808 0.09% 103 15715 0.09% 104 16711 0.10% 105 17583 0.10% 106 18750 0.11% 107 19334 0.11% 108 19954 0.12% 109 21161 0.13% 110 21808 0.13% 111 22881 0.14% 112 24079 0.14% 113 25365 0.15% 114 26055 0.15% 115 27871 0.17% 116 28560 0.17% 117 30183 0.18% 118 31114 0.18% 119 31822 0.19% 120 33050 0.20% 121 34669 0.21% 122 35794 0.21% 123 36986 0.22% 124 39058 0.23% 125 40323 0.24% 126 42664 0.25% 127 44129 0.26% 128 45925 0.27% 129 47385 0.28% 130 49426 0.29% 131 51646 0.31% 132 53601 0.32% 133 56780 0.34% 134 58817 0.35% 135 62799 0.37% 136 66360 0.39% 137 70246 0.42% 138 75012 0.44% 139 78028 0.46% 140 82807 0.49% 141 88715 0.53% 142 95833 0.57% 143 106888 0.63% 144 120945 0.72% 145 139691 0.83% 146 168794 1.00% 147 223063 1.32% 148 325629 1.93% 149 614069 3.64% 150 3333575 19.77% 151 9939933 58.96% 16859674 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.80 fanout-score-rank=33 prefix-density=0.19 prefix-fanout=2.5 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.10 sequence-density-rank=23 fanout-score=118.52 fanout-score-rank=1 prefix-density=0.70 prefix-fanout=16.7 sequence=CCACCACCATGGGCTCCCCAGCCACC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.80 fanout-score-rank=33 prefix-density=0.30 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.04 sequence-density-rank=39 fanout-score=169.11 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=16.1 sequence=AGAAAGAAATGAGAATTCTCATGGTGGGTCTTGATGCTGCTGGTAAGACCACCATCTTGTACAAGCTCAA SRR7169605 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:43:51 Started mapping on | Feb 11 09:43:51 Finished on | Feb 11 09:45:16 Mapping speed, Million of reads per hour | 714.06 Number of input reads | 16859674 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 16222018 Uniquely mapped reads % | 96.22% Average mapped length | 294.33 Number of splices: Total | 15179985 Number of splices: Annotated (sjdb) | 14927765 Number of splices: GT/AG | 14963253 Number of splices: GC/AG | 172082 Number of splices: AT/AC | 12088 Number of splices: Non-canonical | 32562 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 279450 % of reads mapped to multiple loci | 1.66% Number of reads mapped to too many loci | 19239 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.98% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 369027 369027 369027 N_multimapping 279450 279450 279450 N_noFeature 423169 16019138 529253 N_ambiguous 163506 996 66035 UnstrandedReadsAssigned:15635343 PositiveStrandReadsAssigned:201884 NegativeStrandReadsAssigned:15626730 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169605 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169605-trimmed-pair1.fastq SRR7169605-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,859,674 reads, 15,530,308 reads pseudoaligned [quant] estimated average fragment length: 242.812 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,071 rounds 52401 SRR7169605.ke.tsv 34699 SRR7169605.se.tsv 87100 total ==> SRR7169605.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.19 283 10.7527 Potri.005G024800.1.v4.1 1035 793.188 25 2.12708 Potri.004G059700.1.v4.1 961 719.241 1 0.0938307 Potri.007G009000.2.v4.1 1416 1174.19 0 0 Potri.003G141000.2.v4.1 2943 2701.19 313.034 7.82088 Potri.016G087400.1.v4.1 270 80.5113 951 797.155 Potri.015G069301.1.v4.1 564 327.392 0 0 Potri.010G195200.1.v4.1 1773 1531.19 22 0.969646 Potri.012G127500.1.v4.1 977 735.215 4989 457.95 ==> SRR7169605.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1670 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 231 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169605 completed mapping pipeline successfully