Starting /dee2/code/volunteer_pipeline.sh SRR7169606 current disk space = 3055397974016 free memory = 1126881888 SRR7169606 SRAfilesize aef97afce5e2114933761e1848ff6dba SRR7169606.sra SRR7169606.sra file validated SRR7169606 is paired end SRR7169606 is conventional basespace SRR7169606 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169606_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.299 34.0 33.0 34.0 32.0 34.0 2 33.19675 34.0 33.0 34.0 32.0 34.0 3 33.19825 34.0 33.0 34.0 31.0 34.0 4 33.36625 34.0 33.0 34.0 33.0 34.0 5 33.269 34.0 33.0 34.0 33.0 34.0 6 36.71275 38.0 37.0 38.0 35.0 38.0 7 37.04125 38.0 38.0 38.0 36.0 38.0 8 37.248 38.0 38.0 38.0 37.0 38.0 9 37.265 38.0 38.0 38.0 37.0 38.0 10-14 37.34305 38.0 38.0 38.0 37.0 38.0 15-19 37.35105 38.0 38.0 38.0 37.0 38.0 20-24 37.316 38.0 38.0 38.0 37.0 38.0 25-29 37.26255 38.0 38.0 38.0 36.8 38.0 30-34 37.24014999999999 38.0 38.0 38.0 36.6 38.0 35-39 37.075599999999994 38.0 38.0 38.0 36.2 38.0 40-44 36.8719 38.0 38.0 38.0 35.6 38.0 45-49 36.72725 38.0 38.0 38.0 34.8 38.0 50-54 36.59609999999999 38.0 38.0 38.0 34.0 38.0 55-59 36.510850000000005 38.0 37.8 38.0 34.0 38.0 60-64 36.31575 38.0 37.6 38.0 33.6 38.0 65-69 36.31805 38.0 37.4 38.0 33.6 38.0 70-74 36.21415 38.0 37.2 38.0 33.2 38.0 75-79 36.0645 38.0 37.0 38.0 32.6 38.0 80-84 36.06060000000001 38.0 37.0 38.0 32.6 38.0 85-89 35.71475 38.0 37.0 38.0 30.8 38.0 90-94 35.5356 38.0 36.8 38.0 29.2 38.0 95-99 35.408249999999995 38.0 36.6 38.0 29.4 38.0 100-104 34.9653 38.0 36.0 38.0 28.0 38.0 105-109 34.8604 38.0 36.0 38.0 27.4 38.0 110-114 34.4581 38.0 35.0 38.0 25.2 38.0 115-119 34.171299999999995 38.0 34.8 38.0 23.6 38.0 120-124 33.9276 38.0 34.2 38.0 23.0 38.0 125-129 33.551100000000005 38.0 34.0 38.0 17.8 38.0 130-134 33.28305 38.0 34.0 38.0 15.0 38.0 135-139 32.92375 38.0 33.6 38.0 15.0 38.0 140-144 32.2676 37.2 33.0 38.0 14.4 38.0 145-149 30.870950000000004 36.0 31.0 38.0 8.6 38.0 150-151 27.126375000000003 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 0.0 11 3.0 12 0.0 13 2.0 14 3.0 15 10.0 16 3.0 17 10.0 18 6.0 19 14.0 20 11.0 21 16.0 22 11.0 23 20.0 24 20.0 25 33.0 26 24.0 27 29.0 28 43.0 29 53.0 30 79.0 31 72.0 32 112.0 33 165.0 34 241.0 35 408.0 36 941.0 37 1669.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.82941328508659 12.406306539157406 10.907211165675886 36.857069010080124 2 24.65 14.799999999999999 30.85 29.7 3 21.15 17.9 24.7 36.25 4 23.875 25.15 22.7 28.275 5 23.474999999999998 31.525 22.35 22.650000000000002 6 20.599999999999998 32.425 24.975 22.0 7 13.900000000000002 27.175 42.525 16.400000000000002 8 18.375 26.25 29.849999999999998 25.525 9 16.950000000000003 25.4 33.900000000000006 23.75 10-14 19.925 29.69 27.775 22.61 15-19 19.61 27.87 29.060000000000002 23.46 20-24 20.25 28.77 27.185 23.794999999999998 25-29 19.8 28.835 27.6 23.765 30-34 19.67 29.23 27.189999999999998 23.91 35-39 19.875 28.925 27.439999999999998 23.76 40-44 20.21 29.049999999999997 27.025 23.715 45-49 19.7 28.51 27.43 24.36 50-54 20.205000000000002 28.155 27.860000000000003 23.78 55-59 20.135 28.53 27.534999999999997 23.799999999999997 60-64 20.145 28.825 27.51 23.52 65-69 19.814999999999998 28.655 27.705000000000002 23.825 70-74 19.84 28.58 27.685 23.895 75-79 19.905 28.904999999999998 27.295 23.895 80-84 20.025000000000002 28.525 27.6 23.849999999999998 85-89 20.31 28.349999999999998 27.700000000000003 23.64 90-94 20.035 29.104999999999997 26.834999999999997 24.025 95-99 20.0 28.189999999999998 28.044999999999998 23.765 100-104 20.385288966725042 28.811608706529896 27.090317738303725 23.71278458844133 105-109 20.665 27.779999999999998 27.905 23.65 110-114 20.523733226517123 28.34968956539155 26.962747846985778 24.16382936110555 115-119 21.01891702532279 28.49064157741968 27.06435792212992 23.426083475127616 120-124 20.5564451561249 28.78302642113691 26.671337069655728 23.989191353082465 125-129 20.528079211881785 28.374256138420762 27.03905585837876 24.058608791318697 130-134 20.79 29.054999999999996 26.375 23.78 135-139 20.880000000000003 27.805000000000003 27.084999999999997 24.23 140-144 21.15 28.249999999999996 27.139999999999997 23.46 145-149 20.925 28.87 26.255 23.95 150-151 20.549999999999997 28.4375 27.6875 23.325000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 1.0 23 1.5 24 3.5 25 4.5 26 4.5 27 4.5 28 6.0 29 11.5 30 18.0 31 23.0 32 28.5 33 43.0 34 60.5 35 76.5 36 93.0 37 106.0 38 127.5 39 150.0 40 179.5 41 223.0 42 240.5 43 247.5 44 271.5 45 280.0 46 268.0 47 253.0 48 228.0 49 203.5 50 174.0 51 145.0 52 119.0 53 93.0 54 78.0 55 61.5 56 46.5 57 30.5 58 18.0 59 16.5 60 16.0 61 11.5 62 7.0 63 4.5 64 3.0 65 3.5 66 4.0 67 2.5 68 2.0 69 2.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.2750000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.075 105-109 0.0 110-114 0.13999999999999999 115-119 0.09 120-124 0.08 125-129 0.015 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.4875 0.0 0.0 0.0 0.0 106-107 0.5625 0.0 0.0 0.0 0.0 108-109 0.675 0.0 0.0 0.0 0.0 110-111 0.875 0.0 0.0 0.0 0.0 112-113 1.0875 0.0 0.0 0.0 0.0 114-115 1.1875 0.0 0.0 0.0 0.0 116-117 1.3 0.0 0.0 0.0 0.0 118-119 1.4874999999999998 0.0 0.0 0.0 0.0 120-121 1.675 0.0 0.0 0.0 0.0 122-123 1.8625 0.0 0.0 0.0 0.0 124-125 2.2125 0.0 0.0 0.0 0.0 126-127 2.425 0.0 0.0 0.0 0.0 128-129 2.65 0.0 0.0 0.0 0.0 130-131 2.9125 0.0 0.0 0.0 0.0 132-133 3.2625 0.0 0.0 0.0 0.0 134-135 3.5375 0.0 0.0 0.0 0.0 136-137 3.825 0.0 0.0 0.0 0.0 138-139 4.137499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAATCC 10 0.006832588 144.9875 3 TAAATAT 10 0.006832588 144.9875 9 GTAAATA 10 0.006832588 144.9875 8 >>END_MODULE SRR7169606 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169606_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.37925 33.0 33.0 34.0 32.0 34.0 2 32.80175 33.0 33.0 34.0 32.0 34.0 3 32.80175 34.0 33.0 34.0 32.0 34.0 4 32.73 34.0 33.0 34.0 32.0 34.0 5 32.7655 34.0 33.0 34.0 32.0 34.0 6 36.96 38.0 38.0 38.0 36.0 38.0 7 37.0765 38.0 38.0 38.0 37.0 38.0 8 36.943 38.0 38.0 38.0 36.0 38.0 9 36.877 38.0 38.0 38.0 36.0 38.0 10-14 36.84375 38.0 38.0 38.0 36.0 38.0 15-19 36.8498 38.0 38.0 38.0 36.0 38.0 20-24 36.8404 38.0 38.0 38.0 36.0 38.0 25-29 36.87825 38.0 38.0 38.0 36.4 38.0 30-34 36.76755 38.0 38.0 38.0 36.0 38.0 35-39 36.747299999999996 38.0 38.0 38.0 35.8 38.0 40-44 36.69625 38.0 38.0 38.0 35.6 38.0 45-49 36.63875 38.0 38.0 38.0 35.2 38.0 50-54 36.4176 38.0 38.0 38.0 35.2 38.0 55-59 36.05005 38.0 38.0 38.0 34.0 38.0 60-64 35.71985 38.0 38.0 38.0 33.6 38.0 65-69 35.5539 38.0 38.0 38.0 33.0 38.0 70-74 35.42569999999999 38.0 38.0 38.0 31.4 38.0 75-79 35.336 38.0 38.0 38.0 31.0 38.0 80-84 35.442099999999996 38.0 38.0 38.0 31.4 38.0 85-89 35.48085 38.0 38.0 38.0 31.4 38.0 90-94 35.415549999999996 38.0 38.0 38.0 31.0 38.0 95-99 35.272000000000006 38.0 37.6 38.0 30.2 38.0 100-104 35.051550000000006 38.0 37.0 38.0 28.8 38.0 105-109 34.893 38.0 37.0 38.0 28.2 38.0 110-114 34.800599999999996 38.0 37.0 38.0 27.8 38.0 115-119 34.63459999999999 38.0 36.8 38.0 26.8 38.0 120-124 34.32115 38.0 36.0 38.0 25.0 38.0 125-129 34.02815 38.0 35.8 38.0 22.6 38.0 130-134 33.7158 38.0 35.0 38.0 19.0 38.0 135-139 33.226099999999995 38.0 35.0 38.0 14.6 38.0 140-144 32.795500000000004 38.0 34.6 38.0 13.6 38.0 145-149 31.95215 38.0 33.6 38.0 6.4 38.0 150-151 27.9685 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 7.0 4 1.0 5 2.0 6 3.0 7 1.0 8 1.0 9 3.0 10 3.0 11 10.0 12 9.0 13 25.0 14 30.0 15 9.0 16 7.0 17 8.0 18 7.0 19 10.0 20 13.0 21 8.0 22 13.0 23 19.0 24 26.0 25 17.0 26 48.0 27 34.0 28 31.0 29 39.0 30 50.0 31 62.0 32 78.0 33 103.0 34 142.0 35 231.0 36 529.0 37 2409.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.09081735620585 21.8970736629667 15.817356205852672 27.194752774974774 2 28.225 26.075 28.1 17.599999999999998 3 21.5 29.675 29.375 19.45 4 22.775000000000002 33.15 25.525 18.55 5 24.675 35.425000000000004 21.5 18.4 6 21.75 36.575 22.925 18.75 7 20.724999999999998 20.95 38.95 19.375 8 23.175 26.0 26.125 24.7 9 22.325 25.5 29.425 22.75 10-14 23.051135795056542 28.404883418392874 26.883818673071147 21.660162113479437 15-19 23.0 28.115000000000002 27.505000000000003 21.38 20-24 23.155 28.084999999999997 27.1 21.66 25-29 23.080000000000002 27.775 27.800000000000004 21.345 30-34 22.905 28.53 27.61 20.955 35-39 23.549999999999997 27.49 27.644999999999996 21.315 40-44 23.645 28.249999999999996 27.105 21.0 45-49 23.155 28.395 27.42 21.029999999999998 50-54 23.6522877132934 27.97100719786581 27.67403231489405 20.702672773946745 55-59 23.930624078124204 28.16743807537765 27.47062712985097 20.431310716647168 60-64 23.257839721254356 28.19737651158024 27.531256405001024 21.01352736216438 65-69 23.712082262210796 27.979434447300772 27.295629820051413 21.01285347043702 70-74 23.98353062274833 27.64282038085435 27.77148739063304 20.602161605764284 75-79 23.625128733264674 27.67250257466529 27.80638516992791 20.89598352214212 80-84 23.589112717207442 28.063970475165306 27.807678507355583 20.53923830027167 85-89 23.80539105574842 27.55768838064121 27.889524198488868 20.747396365121503 90-94 23.360634888334943 27.67461972834105 28.030726967492498 20.93401841583151 95-99 24.361123812426968 27.643143829700755 27.55677488187776 20.438957475994513 100-104 24.05114674243962 27.557337121980925 27.379744266287805 21.01177186929166 105-109 23.75760649087221 27.560851926977687 27.581135902636916 21.100405679513184 110-114 24.10040993977428 27.430537982691433 27.75950199908902 20.709550078445265 115-119 24.74836882302362 27.97025947094229 27.12053006929341 20.16084163674068 120-124 23.820814205720627 27.801039196892496 27.720324875145035 20.657821722241838 125-129 23.860984271943174 27.91983764586504 27.666159309994924 20.553018772196854 130-134 25.13881106413326 27.22734450613825 27.752024858641946 19.88181957108655 135-139 24.13598894065844 27.689314423224616 27.228508524909117 20.94618811120782 140-144 25.31126710047651 27.734795306655734 27.089204283445202 19.864733309422554 145-149 25.006431695394905 27.939284795472087 27.3424234628248 19.711860046308207 150-151 24.90282456594973 27.37755895309666 27.96061155739829 19.759004923555327 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 1.5 16 2.0 17 1.0 18 1.0 19 3.5 20 6.0 21 8.5 22 9.0 23 9.0 24 7.5 25 7.0 26 7.5 27 6.0 28 8.5 29 10.5 30 11.0 31 13.0 32 20.0 33 26.5 34 35.0 35 44.5 36 63.0 37 97.0 38 129.5 39 158.5 40 184.0 41 217.5 42 268.5 43 285.0 44 285.5 45 289.5 46 279.0 47 277.5 48 251.5 49 210.0 50 177.0 51 143.5 52 112.5 53 83.0 54 61.5 55 50.5 56 40.0 57 28.0 58 21.5 59 15.5 60 7.0 61 4.0 62 4.0 63 2.5 64 2.5 65 2.5 66 1.5 67 0.5 68 0.5 69 1.5 70 2.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8999999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.06999999999999999 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.6649999999999999 55-59 1.695 60-64 2.42 65-69 2.75 70-74 2.85 75-79 2.9000000000000004 80-84 2.455 85-89 2.06 90-94 1.7149999999999999 95-99 1.585 100-104 1.46 105-109 1.4000000000000001 110-114 1.205 115-119 1.145 120-124 0.885 125-129 1.4500000000000002 130-134 1.8450000000000002 135-139 2.3449999999999998 140-144 2.415 145-149 2.825 150-151 3.5249999999999995 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.4875 0.0 0.0 0.0 0.0 106-107 0.5625 0.0 0.0 0.0 0.0 108-109 0.6875 0.0 0.0 0.0 0.0 110-111 0.8875 0.0 0.0 0.0 0.0 112-113 1.0625 0.0 0.0 0.0 0.0 114-115 1.15 0.0 0.0 0.0 0.0 116-117 1.25 0.0 0.0 0.0 0.0 118-119 1.4375 0.0 0.0 0.0 0.0 120-121 1.625 0.0 0.0 0.0 0.0 122-123 1.7999999999999998 0.0 0.0 0.0 0.0 124-125 2.1625 0.0 0.0 0.0 0.0 126-127 2.3625 0.0 0.0 0.0 0.0 128-129 2.575 0.0 0.0 0.0 0.0 130-131 2.8 0.0 0.0 0.0 0.0 132-133 3.1375 0.0 0.0 0.0 0.0 134-135 3.4125 0.0 0.0 0.0 0.0 136-137 3.625 0.0 0.0 0.0 0.0 138-139 3.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1051641 spots for SRR7169606.sra Written 1051641 spots for SRR7169606.sra Read 1051641 spots for SRR7169606.sra Written 1051641 spots for SRR7169606.sra Read 1051641 spots for SRR7169606.sra Written 1051641 spots for SRR7169606.sra Read 1051641 spots for SRR7169606.sra Written 1051641 spots for SRR7169606.sra Read 1051641 spots for SRR7169606.sra Written 1051641 spots for SRR7169606.sra Read 1051641 spots for SRR7169606.sra Written 1051641 spots for SRR7169606.sra Read 1051641 spots for SRR7169606.sra Written 1051641 spots for SRR7169606.sra Read 1051641 spots for SRR7169606.sra Written 1051641 spots for SRR7169606.sra Read 1051641 spots for SRR7169606.sra Written 1051641 spots for SRR7169606.sra Read 1051641 spots for SRR7169606.sra Written 1051641 spots for SRR7169606.sra Read 1051641 spots for SRR7169606.sra Written 1051641 spots for SRR7169606.sra Read 1051641 spots for SRR7169606.sra Written 1051641 spots for SRR7169606.sra Read 1051650 spots for SRR7169606.sra Written 1051650 spots for SRR7169606.sra Read 1051641 spots for SRR7169606.sra Written 1051641 spots for SRR7169606.sra Read 1051641 spots for SRR7169606.sra Written 1051641 spots for SRR7169606.sra Read 1051641 spots for SRR7169606.sra Written 1051641 spots for SRR7169606.sra Read 1051641 spots for SRR7169606.sra Written 1051641 spots for SRR7169606.sra Read 1051641 spots for SRR7169606.sra Written 1051641 spots for SRR7169606.sra Read 1051641 spots for SRR7169606.sra Written 1051641 spots for SRR7169606.sra Read 1051641 spots for SRR7169606.sra Written 1051641 spots for SRR7169606.sra SRR ids: ['SRR7169606.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nd6gt12q SRR7169606.sra spots: 21032829 blocks: [[1, 1051641], [1051642, 2103282], [2103283, 3154923], [3154924, 4206564], [4206565, 5258205], [5258206, 6309846], [6309847, 7361487], [7361488, 8413128], [8413129, 9464769], [9464770, 10516410], [10516411, 11568051], [11568052, 12619692], [12619693, 13671333], [13671334, 14722974], [14722975, 15774615], [15774616, 16826256], [16826257, 17877897], [17877898, 18929538], [18929539, 19981179], [19981180, 21032829]] SRR7169606 file size 7105635 SRR7169606 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169606 SRR7169606_1.fastq SRR7169606_2.fastq Input file: SRR7169606_1.fastq Paired file: SRR7169606_2.fastq trimmed: SRR7169606-trimmed-pair1.fastq, SRR7169606-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:12:20 2025 >> started Tue Feb 11 09:12:45 2025 >> done (25.397s) 21032829 read pairs processed; of these: 25250 ( 0.12%) short read pairs filtered out after trimming by size control 21798 ( 0.10%) empty read pairs filtered out after trimming by size control 20985781 (99.78%) read pairs available; of these: 10777530 (51.36%) trimmed read pairs available after processing 10208251 (48.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 3 0.00% 21 4 0.00% 22 3 0.00% 23 5 0.00% 24 8 0.00% 25 7 0.00% 26 8 0.00% 27 14 0.00% 28 6 0.00% 29 7 0.00% 30 18 0.00% 31 9 0.00% 32 17 0.00% 33 19 0.00% 34 18 0.00% 35 22 0.00% 36 19 0.00% 37 27 0.00% 38 21 0.00% 39 21 0.00% 40 36 0.00% 41 36 0.00% 42 39 0.00% 43 41 0.00% 44 59 0.00% 45 58 0.00% 46 74 0.00% 47 75 0.00% 48 64 0.00% 49 73 0.00% 50 97 0.00% 51 101 0.00% 52 139 0.00% 53 158 0.00% 54 151 0.00% 55 149 0.00% 56 170 0.00% 57 176 0.00% 58 230 0.00% 59 228 0.00% 60 297 0.00% 61 299 0.00% 62 372 0.00% 63 404 0.00% 64 447 0.00% 65 491 0.00% 66 619 0.00% 67 731 0.00% 68 916 0.00% 69 1419 0.01% 70 1757 0.01% 71 1428 0.01% 72 1404 0.01% 73 1586 0.01% 74 1891 0.01% 75 2365 0.01% 76 2079 0.01% 77 1567 0.01% 78 2155 0.01% 79 3870 0.02% 80 6535 0.03% 81 2356 0.01% 82 2794 0.01% 83 3136 0.01% 84 4542 0.02% 85 5389 0.03% 86 5940 0.03% 87 6289 0.03% 88 6176 0.03% 89 6748 0.03% 90 7272 0.03% 91 7673 0.04% 92 8323 0.04% 93 9245 0.04% 94 9931 0.05% 95 10793 0.05% 96 11727 0.06% 97 13360 0.06% 98 15161 0.07% 99 20028 0.10% 100 24269 0.12% 101 17997 0.09% 102 15446 0.07% 103 15695 0.07% 104 16421 0.08% 105 17647 0.08% 106 18616 0.09% 107 19469 0.09% 108 20420 0.10% 109 21416 0.10% 110 22428 0.11% 111 23628 0.11% 112 25018 0.12% 113 26431 0.13% 114 27623 0.13% 115 29781 0.14% 116 30722 0.15% 117 32653 0.16% 118 33957 0.16% 119 34842 0.17% 120 36230 0.17% 121 37845 0.18% 122 40185 0.19% 123 42183 0.20% 124 44893 0.21% 125 47342 0.23% 126 50022 0.24% 127 52700 0.25% 128 55347 0.26% 129 58101 0.28% 130 61805 0.29% 131 64974 0.31% 132 68778 0.33% 133 73822 0.35% 134 78871 0.38% 135 85004 0.41% 136 91365 0.44% 137 98346 0.47% 138 108160 0.52% 139 119367 0.57% 140 130334 0.62% 141 143340 0.68% 142 160668 0.77% 143 181246 0.86% 144 213000 1.01% 145 259620 1.24% 146 322586 1.54% 147 441004 2.10% 148 667967 3.18% 149 1251420 5.96% 150 5024596 23.94% 151 10208251 48.64% 20985781 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=3.53 fanout-score-rank=33 prefix-density=0.16 prefix-fanout=2.9 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=45 fanout-score=282.83 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=17.5 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.63 fanout-score-rank=37 prefix-density=0.23 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=61.54 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=8.7 sequence=AAGCAATTTCTTCATCCTCTTCTGTGATAATCACTCCTACCTTTTTGCTTCTTACAGTTTTCTTTTGTATCCCAGCTGTGCTTTATTTTCCTTCTAGTTCCAATGGCCACTGTTGAGGTTG SRR7169606 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:13:29 Started mapping on | Feb 11 09:13:29 Finished on | Feb 11 09:15:28 Mapping speed, Million of reads per hour | 634.86 Number of input reads | 20985781 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 19876047 Uniquely mapped reads % | 94.71% Average mapped length | 294.17 Number of splices: Total | 18800928 Number of splices: Annotated (sjdb) | 18465109 Number of splices: GT/AG | 18520225 Number of splices: GC/AG | 216706 Number of splices: AT/AC | 16041 Number of splices: Non-canonical | 47956 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 365509 % of reads mapped to multiple loci | 1.74% Number of reads mapped to too many loci | 17978 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.43% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 769958 769958 769958 N_multimapping 365509 365509 365509 N_noFeature 445558 19650401 542331 N_ambiguous 209092 1046 79684 UnstrandedReadsAssigned:19221397 PositiveStrandReadsAssigned:224600 NegativeStrandReadsAssigned:19254032 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169606 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169606-trimmed-pair1.fastq SRR7169606-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,985,781 reads, 19,171,383 reads pseudoaligned [quant] estimated average fragment length: 256.714 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,040 rounds 52401 SRR7169606.ke.tsv 34699 SRR7169606.se.tsv 87100 total ==> SRR7169606.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1762.29 338 9.76033 Potri.005G024800.1.v4.1 1035 779.286 53 3.46101 Potri.004G059700.1.v4.1 961 705.33 3 0.216448 Potri.007G009000.2.v4.1 1416 1160.29 0 0 Potri.003G141000.2.v4.1 2943 2687.29 366.2 6.93471 Potri.016G087400.1.v4.1 270 74.1187 1355.55 930.706 Potri.015G069301.1.v4.1 564 314.237 0 0 Potri.010G195200.1.v4.1 1773 1517.29 53 1.77759 Potri.012G127500.1.v4.1 977 721.308 4880 344.289 ==> SRR7169606.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2876 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 448 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 24 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169606 completed mapping pipeline successfully