Starting /dee2/code/volunteer_pipeline.sh SRR7169607 current disk space = 3055130497024 free memory = 1460666424 SRR7169607 SRAfilesize d2c84daaf9b97600f81794d6015588a3 SRR7169607.sra SRR7169607.sra file validated SRR7169607 is paired end SRR7169607 is conventional basespace SRR7169607 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169607_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.953 34.0 33.0 34.0 33.0 34.0 2 33.3105 34.0 33.0 34.0 33.0 34.0 3 33.45225 34.0 34.0 34.0 33.0 34.0 4 33.42725 34.0 34.0 34.0 33.0 34.0 5 33.44425 34.0 34.0 34.0 33.0 34.0 6 37.0705 38.0 37.0 38.0 36.0 38.0 7 37.34575 38.0 38.0 38.0 37.0 38.0 8 37.47075 38.0 38.0 38.0 37.0 38.0 9 37.49025 38.0 38.0 38.0 37.0 38.0 10-14 37.492000000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.4174 38.0 38.0 38.0 37.0 38.0 20-24 37.3922 38.0 38.0 38.0 37.0 38.0 25-29 37.386900000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.38505 38.0 38.0 38.0 37.0 38.0 35-39 37.33185 38.0 38.0 38.0 37.0 38.0 40-44 37.22205 38.0 38.0 38.0 36.8 38.0 45-49 37.1721 38.0 38.0 38.0 36.2 38.0 50-54 37.087149999999994 38.0 38.0 38.0 36.0 38.0 55-59 37.08855 38.0 38.0 38.0 36.0 38.0 60-64 37.0726 38.0 38.0 38.0 36.0 38.0 65-69 36.97355 38.0 38.0 38.0 36.0 38.0 70-74 36.94845 38.0 38.0 38.0 36.0 38.0 75-79 36.8581 38.0 38.0 38.0 35.8 38.0 80-84 36.826249999999995 38.0 38.0 38.0 35.0 38.0 85-89 36.7466 38.0 38.0 38.0 34.8 38.0 90-94 36.628550000000004 38.0 38.0 38.0 34.6 38.0 95-99 36.546749999999996 38.0 38.0 38.0 34.0 38.0 100-104 36.3848 38.0 38.0 38.0 34.0 38.0 105-109 36.3097 38.0 38.0 38.0 34.0 38.0 110-114 36.113350000000004 38.0 37.4 38.0 33.0 38.0 115-119 35.9585 38.0 37.0 38.0 33.0 38.0 120-124 35.7671 38.0 36.6 38.0 32.0 38.0 125-129 35.61545 38.0 36.6 38.0 31.0 38.0 130-134 35.39125 38.0 36.0 38.0 30.6 38.0 135-139 35.0274 38.0 36.0 38.0 28.0 38.0 140-144 34.7779 38.0 35.2 38.0 28.2 38.0 145-149 34.21305 38.0 35.0 38.0 25.0 38.0 150-151 31.373625 36.5 31.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 2.0 10 1.0 11 0.0 12 0.0 13 1.0 14 1.0 15 1.0 16 1.0 17 4.0 18 6.0 19 2.0 20 2.0 21 6.0 22 7.0 23 5.0 24 10.0 25 15.0 26 18.0 27 19.0 28 25.0 29 47.0 30 40.0 31 43.0 32 72.0 33 78.0 34 127.0 35 228.0 36 623.0 37 2616.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.46403242147923 12.76595744680851 8.865248226950355 36.904761904761905 2 23.400000000000002 14.95 31.7 29.95 3 21.075 17.549999999999997 26.8 34.575 4 22.975 25.674999999999997 23.75 27.6 5 24.7 30.825000000000003 23.200000000000003 21.275 6 20.8 33.225 25.55 20.424999999999997 7 14.85 27.950000000000003 39.975 17.224999999999998 8 17.575 26.25 30.95 25.224999999999998 9 18.325 25.874999999999996 32.800000000000004 23.0 10-14 20.155 29.425 27.265 23.155 15-19 20.2970297029703 28.16281628162816 28.027802780278027 23.512351235123514 20-24 19.735 28.634999999999998 27.560000000000002 24.07 25-29 19.935 28.54 27.644999999999996 23.880000000000003 30-34 20.405 27.689999999999998 27.965 23.94 35-39 19.869999999999997 28.865000000000002 27.655 23.61 40-44 20.125 28.865000000000002 27.279999999999998 23.73 45-49 20.43 28.325 27.279999999999998 23.965 50-54 20.29 28.544999999999998 27.02 24.145 55-59 20.655 28.53 26.534999999999997 24.279999999999998 60-64 20.53 28.470000000000002 27.42 23.580000000000002 65-69 20.07 28.355000000000004 27.800000000000004 23.775 70-74 20.49 28.28 27.54 23.69 75-79 20.630000000000003 28.565 27.339999999999996 23.465 80-84 20.200000000000003 27.750000000000004 27.905 24.145 85-89 19.755 28.575 27.794999999999998 23.875 90-94 20.82 28.89 26.905 23.385 95-99 20.455000000000002 27.955000000000002 27.425 24.165 100-104 21.029999999999998 28.084999999999997 27.0 23.885 105-109 20.775 28.92 26.875 23.43 110-114 20.692069206920692 27.997799779978 27.382738273827385 23.927392739273927 115-119 20.724999999999998 28.325 27.139999999999997 23.810000000000002 120-124 20.625 28.315 27.029999999999998 24.03 125-129 20.57 28.275 27.334999999999997 23.82 130-134 21.19 27.54 27.73 23.54 135-139 20.424999999999997 27.900000000000002 27.565 24.11 140-144 21.19 27.77 27.134999999999998 23.905 145-149 21.01 28.15 26.91 23.93 150-151 21.099999999999998 27.950000000000003 27.125 23.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 1.0 19 1.5 20 0.5 21 0.5 22 1.5 23 1.0 24 3.0 25 4.0 26 2.5 27 6.0 28 8.5 29 11.0 30 20.5 31 23.5 32 23.5 33 37.5 34 43.5 35 51.0 36 68.0 37 87.5 38 115.0 39 142.0 40 187.5 41 219.0 42 246.0 43 254.0 44 258.5 45 285.0 46 277.5 47 260.0 48 256.0 49 243.5 50 188.5 51 141.0 52 118.5 53 92.5 54 75.5 55 63.0 56 55.5 57 39.5 58 19.5 59 15.0 60 12.0 61 7.0 62 7.0 63 7.0 64 4.0 65 3.5 66 2.5 67 0.5 68 1.0 69 1.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.01 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.01 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.30000000000000004 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.55 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.7625 0.0 0.0 0.0 0.0 108-109 0.95 0.0 0.0 0.0 0.0 110-111 1.125 0.0 0.0 0.0 0.0 112-113 1.275 0.0 0.0 0.0 0.0 114-115 1.5625 0.0 0.0 0.0 0.0 116-117 1.675 0.0 0.0 0.0 0.0 118-119 1.9 0.0 0.0 0.0 0.0 120-121 2.0875 0.0 0.0 0.0 0.0 122-123 2.2875 0.0 0.0 0.0 0.0 124-125 2.5250000000000004 0.0 0.0 0.0 0.0 126-127 2.85 0.0 0.0 0.0 0.0 128-129 3.1875 0.0 0.0 0.0 0.0 130-131 3.5250000000000004 0.0 0.0 0.0 0.0 132-133 3.6875 0.0 0.0 0.0 0.0 134-135 4.025 0.0 0.0 0.0 0.0 136-137 4.4125 0.0 0.0 0.0 0.0 138-139 4.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTGATT 10 0.0068573058 144.8125 2 CATGCTA 10 0.0068573058 144.8125 9 >>END_MODULE SRR7169607 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169607_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.83125 33.0 33.0 34.0 32.0 34.0 2 32.90175 33.0 33.0 34.0 32.0 34.0 3 32.89 34.0 33.0 34.0 32.0 34.0 4 32.84325 34.0 33.0 34.0 32.0 34.0 5 32.86825 34.0 33.0 34.0 32.0 34.0 6 36.96125 38.0 38.0 38.0 37.0 38.0 7 37.07025 38.0 38.0 38.0 37.0 38.0 8 37.06575 38.0 38.0 38.0 37.0 38.0 9 37.0115 38.0 38.0 38.0 37.0 38.0 10-14 36.98945 38.0 38.0 38.0 37.0 38.0 15-19 36.93015 38.0 38.0 38.0 37.0 38.0 20-24 36.8773 38.0 38.0 38.0 36.6 38.0 25-29 36.8752 38.0 38.0 38.0 36.4 38.0 30-34 36.80335 38.0 38.0 38.0 36.2 38.0 35-39 36.83485 38.0 38.0 38.0 36.4 38.0 40-44 36.82289999999999 38.0 38.0 38.0 36.8 38.0 45-49 36.8006 38.0 38.0 38.0 36.0 38.0 50-54 36.762649999999994 38.0 38.0 38.0 36.0 38.0 55-59 36.75735 38.0 38.0 38.0 36.0 38.0 60-64 36.665800000000004 38.0 38.0 38.0 36.0 38.0 65-69 36.6154 38.0 38.0 38.0 36.0 38.0 70-74 36.4843 38.0 38.0 38.0 35.4 38.0 75-79 36.47494999999999 38.0 38.0 38.0 35.2 38.0 80-84 36.36445 38.0 38.0 38.0 34.6 38.0 85-89 36.2595 38.0 38.0 38.0 34.2 38.0 90-94 36.310900000000004 38.0 38.0 38.0 34.6 38.0 95-99 36.1372 38.0 38.0 38.0 34.0 38.0 100-104 36.04165 38.0 38.0 38.0 34.0 38.0 105-109 35.84845 38.0 38.0 38.0 33.0 38.0 110-114 35.786699999999996 38.0 38.0 38.0 33.0 38.0 115-119 35.5624 38.0 37.8 38.0 31.6 38.0 120-124 35.30905 38.0 37.2 38.0 30.6 38.0 125-129 35.1329 38.0 36.6 38.0 30.0 38.0 130-134 34.89755 38.0 36.0 38.0 28.0 38.0 135-139 34.63485 38.0 36.0 38.0 27.8 38.0 140-144 34.2004 38.0 35.6 38.0 23.4 38.0 145-149 33.6394 38.0 34.6 38.0 20.4 38.0 150-151 30.464999999999996 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 5.0 4 5.0 5 3.0 6 6.0 7 2.0 8 1.0 9 1.0 10 2.0 11 5.0 12 2.0 13 3.0 14 7.0 15 5.0 16 7.0 17 7.0 18 5.0 19 6.0 20 9.0 21 8.0 22 7.0 23 15.0 24 12.0 25 18.0 26 15.0 27 18.0 28 30.0 29 37.0 30 40.0 31 49.0 32 59.0 33 68.0 34 110.0 35 183.0 36 456.0 37 2778.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.47971957936905 23.034551827741613 14.646970455683524 25.838758137205808 2 30.02754820936639 25.79514149762084 26.62158777861257 17.555722514400202 3 21.067134268537075 28.1563126252505 31.2875751503006 19.488977955911825 4 22.865013774104685 33.70899073378412 23.491109441522664 19.93488605058853 5 23.115452041071876 36.08815426997245 22.26396193338342 18.53243175557225 6 20.490981963927858 37.62525050100201 24.02304609218437 17.860721442885772 7 19.98997995991984 22.870741482965933 36.92384769539078 20.215430861723448 8 21.68795391935888 27.598297019784624 26.22088655146506 24.492862509391436 9 22.03856749311295 25.068870523415974 28.92561983471074 23.96694214876033 10-14 23.546205860255448 28.144252441773105 26.561482594540447 21.748059103431004 15-19 23.556223390934132 27.723516153268218 27.598297019784624 21.121963436013022 20-24 23.197916144868007 27.806441917547463 27.32555227170265 21.670089665881882 25-29 23.143973549744516 28.5191864542631 27.77777777777778 20.559062218214606 30-34 22.699724517906336 29.06586526421237 27.042324067117455 21.192086150763835 35-39 23.402123822881187 28.481266279302748 27.399318773792825 20.71729112402324 40-44 23.26571500125219 27.70348109191084 27.698472326571498 21.332331580265464 45-49 23.57625845229151 27.743551214625594 27.67342849987478 21.006761833208117 50-54 23.2556974705735 28.049085900325572 27.738542449286253 20.956674179814673 55-59 23.56123215627348 27.718507387928877 27.9839719509141 20.736288504883547 60-64 23.83671424993739 27.693463561232157 27.823691460055095 20.646130728775358 65-69 23.422159887798035 27.569625325586056 27.63474253656582 21.373472250050092 70-74 24.009417422231127 27.78139558182638 27.631117567499874 20.578069428442618 75-79 23.71769184532158 27.168904027249045 28.28090563013424 20.83249849729513 80-84 24.449008214786616 27.274093368062513 27.95031055900621 20.32658785814466 85-89 23.72270086155079 27.384291725105193 27.885193348026448 21.00781406531757 90-94 23.872971348427168 28.190743338008417 27.11881386495692 20.817471448607495 95-99 23.285750062609566 27.793638868019034 27.92887553218132 20.99173553719008 100-104 23.545026545126717 27.802263848542523 27.466693378743866 21.186016227586897 105-109 23.99198597545705 27.518156774355123 27.693463561232157 20.79639368895567 110-114 23.726521412471826 27.75356874530428 27.197595792637113 21.322314049586776 115-119 24.391343552750225 28.013225127742714 27.356978258691512 20.23845306081555 120-124 24.288719695451814 27.689841715087155 27.3893007413344 20.63213784812663 125-129 23.834093072183542 28.157090617642638 27.270450333116266 20.73836597705756 130-134 24.745728743925046 28.107620622275665 26.609549576632098 20.53710105716719 135-139 24.336238853822262 27.82787295862138 27.241759342751227 20.59412884480513 140-144 24.288719695451814 28.21578841915448 27.093768783810862 20.40172310158285 145-149 24.893563736538944 27.773603806661658 27.092411720510896 20.240420736288506 150-151 24.92804404955575 27.73119759729696 27.455887873858092 19.8848704792892 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 6.0 1 3.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.5 18 1.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 2.0 26 2.0 27 3.5 28 6.5 29 5.0 30 6.0 31 12.5 32 17.5 33 22.5 34 30.5 35 50.0 36 71.0 37 91.5 38 125.5 39 170.0 40 199.0 41 223.5 42 253.0 43 277.5 44 292.5 45 284.5 46 280.0 47 287.0 48 251.0 49 201.0 50 175.0 51 150.0 52 120.5 53 98.0 54 84.0 55 59.5 56 35.0 57 21.0 58 21.0 59 19.0 60 13.0 61 6.5 62 5.5 63 7.0 64 3.0 65 1.5 66 1.0 67 0.5 68 1.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.17500000000000002 3 0.2 4 0.17500000000000002 5 0.17500000000000002 6 0.2 7 0.2 8 0.17500000000000002 9 0.17500000000000002 10-14 0.17500000000000002 15-19 0.17500000000000002 20-24 0.185 25-29 0.19 30-34 0.17500000000000002 35-39 0.18 40-44 0.17500000000000002 45-49 0.17500000000000002 50-54 0.17500000000000002 55-59 0.17500000000000002 60-64 0.17500000000000002 65-69 0.18 70-74 0.185 75-79 0.18 80-84 0.18 85-89 0.18 90-94 0.18 95-99 0.17500000000000002 100-104 0.16999999999999998 105-109 0.17500000000000002 110-114 0.17500000000000002 115-119 0.19 120-124 0.18 125-129 0.185 130-134 0.20500000000000002 135-139 0.19 140-144 0.18 145-149 0.17500000000000002 150-151 0.11249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5727569741141 99.05000000000001 2 0.4021110831867303 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.025131942699170642 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.30000000000000004 0.0 0.0 0.0 0.0 98-99 0.3625 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.525 0.0 0.0 0.0 0.0 104-105 0.6000000000000001 0.0 0.0 0.0 0.0 106-107 0.7375 0.0 0.0 0.0 0.0 108-109 0.9624999999999999 0.0 0.0 0.0 0.0 110-111 1.125 0.0 0.0 0.0 0.0 112-113 1.2875 0.0 0.0 0.0 0.0 114-115 1.5875 0.0 0.0 0.0 0.0 116-117 1.7 0.0 0.0 0.0 0.0 118-119 1.9249999999999998 0.0 0.0 0.0 0.0 120-121 2.1125 0.0 0.0 0.0 0.0 122-123 2.325 0.0 0.0 0.0 0.0 124-125 2.575 0.0 0.0 0.0 0.0 126-127 2.9 0.0 0.0 0.0 0.0 128-129 3.2375 0.0 0.0 0.0 0.0 130-131 3.55 0.0 0.0 0.0 0.0 132-133 3.7 0.0 0.0 0.0 0.0 134-135 4.0 0.0 0.0 0.0 0.0 136-137 4.387499999999999 0.0 0.0 0.0 0.0 138-139 4.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGCTAC 10 0.006824188 145.0 8 TTTTTTT 35 0.0035334555 20.714287 45-49 AGAGAGA 35 0.0035334555 20.714287 10-14 AAAAAAA 40 0.0076482818 18.125 100-104 >>END_MODULE Read 841169 spots for SRR7169607.sra Written 841169 spots for SRR7169607.sra Read 841169 spots for SRR7169607.sra Written 841169 spots for SRR7169607.sra Read 841169 spots for SRR7169607.sra Written 841169 spots for SRR7169607.sra Read 841169 spots for SRR7169607.sra Written 841169 spots for SRR7169607.sra Read 841169 spots for SRR7169607.sra Written 841169 spots for SRR7169607.sra Read 841169 spots for SRR7169607.sra Written 841169 spots for SRR7169607.sra Read 841169 spots for SRR7169607.sra Written 841169 spots for SRR7169607.sra Read 841169 spots for SRR7169607.sra Written 841169 spots for SRR7169607.sra Read 841169 spots for SRR7169607.sra Written 841169 spots for SRR7169607.sra Read 841178 spots for SRR7169607.sra Written 841178 spots for SRR7169607.sra Read 841169 spots for SRR7169607.sra Written 841169 spots for SRR7169607.sra Read 841169 spots for SRR7169607.sra Written 841169 spots for SRR7169607.sra Read 841169 spots for SRR7169607.sra Written 841169 spots for SRR7169607.sra Read 841169 spots for SRR7169607.sra Written 841169 spots for SRR7169607.sra Read 841169 spots for SRR7169607.sra Written 841169 spots for SRR7169607.sra Read 841169 spots for SRR7169607.sra Written 841169 spots for SRR7169607.sra Read 841169 spots for SRR7169607.sra Written 841169 spots for SRR7169607.sra Read 841169 spots for SRR7169607.sra Written 841169 spots for SRR7169607.sra Read 841169 spots for SRR7169607.sra Written 841169 spots for SRR7169607.sra Read 841169 spots for SRR7169607.sra Written 841169 spots for SRR7169607.sra SRR ids: ['SRR7169607.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lij3btgw SRR7169607.sra spots: 16823389 blocks: [[1, 841169], [841170, 1682338], [1682339, 2523507], [2523508, 3364676], [3364677, 4205845], [4205846, 5047014], [5047015, 5888183], [5888184, 6729352], [6729353, 7570521], [7570522, 8411690], [8411691, 9252859], [9252860, 10094028], [10094029, 10935197], [10935198, 11776366], [11776367, 12617535], [12617536, 13458704], [13458705, 14299873], [14299874, 15141042], [15141043, 15982211], [15982212, 16823389]] SRR7169607 file size 5679194 SRR7169607 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169607 SRR7169607_1.fastq SRR7169607_2.fastq Input file: SRR7169607_1.fastq Paired file: SRR7169607_2.fastq trimmed: SRR7169607-trimmed-pair1.fastq, SRR7169607-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:19:11 2025 >> started Tue Feb 11 09:19:35 2025 >> done (24.725s) 16823389 read pairs processed; of these: 26596 ( 0.16%) short read pairs filtered out after trimming by size control 68539 ( 0.41%) empty read pairs filtered out after trimming by size control 16728254 (99.43%) read pairs available; of these: 7100307 (42.44%) trimmed read pairs available after processing 9627947 (57.56%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 4 0.00% 21 6 0.00% 22 8 0.00% 23 6 0.00% 24 7 0.00% 25 6 0.00% 26 8 0.00% 27 12 0.00% 28 7 0.00% 29 8 0.00% 30 7 0.00% 31 5 0.00% 32 8 0.00% 33 12 0.00% 34 10 0.00% 35 14 0.00% 36 17 0.00% 37 13 0.00% 38 16 0.00% 39 16 0.00% 40 15 0.00% 41 22 0.00% 42 39 0.00% 43 18 0.00% 44 23 0.00% 45 33 0.00% 46 45 0.00% 47 51 0.00% 48 46 0.00% 49 65 0.00% 50 66 0.00% 51 69 0.00% 52 67 0.00% 53 72 0.00% 54 93 0.00% 55 84 0.00% 56 109 0.00% 57 126 0.00% 58 124 0.00% 59 163 0.00% 60 154 0.00% 61 192 0.00% 62 205 0.00% 63 253 0.00% 64 307 0.00% 65 350 0.00% 66 433 0.00% 67 564 0.00% 68 893 0.01% 69 1930 0.01% 70 1685 0.01% 71 914 0.01% 72 798 0.00% 73 894 0.01% 74 992 0.01% 75 1073 0.01% 76 1243 0.01% 77 1329 0.01% 78 1429 0.01% 79 1694 0.01% 80 1803 0.01% 81 2122 0.01% 82 2413 0.01% 83 2773 0.02% 84 4104 0.02% 85 5067 0.03% 86 5225 0.03% 87 5574 0.03% 88 5988 0.04% 89 6168 0.04% 90 6453 0.04% 91 6987 0.04% 92 7332 0.04% 93 7909 0.05% 94 8302 0.05% 95 8910 0.05% 96 9755 0.06% 97 9968 0.06% 98 10213 0.06% 99 10872 0.06% 100 11805 0.07% 101 12075 0.07% 102 13078 0.08% 103 13863 0.08% 104 14619 0.09% 105 15679 0.09% 106 16491 0.10% 107 17031 0.10% 108 17236 0.10% 109 18096 0.11% 110 18664 0.11% 111 19708 0.12% 112 20967 0.13% 113 22280 0.13% 114 23393 0.14% 115 24444 0.15% 116 25846 0.15% 117 26569 0.16% 118 27018 0.16% 119 28089 0.17% 120 28851 0.17% 121 30043 0.18% 122 31346 0.19% 123 33004 0.20% 124 35207 0.21% 125 36284 0.22% 126 38299 0.23% 127 39952 0.24% 128 40847 0.24% 129 42448 0.25% 130 45035 0.27% 131 46497 0.28% 132 49146 0.29% 133 52194 0.31% 134 55287 0.33% 135 58268 0.35% 136 62147 0.37% 137 65805 0.39% 138 69367 0.41% 139 74495 0.45% 140 79379 0.47% 141 85029 0.51% 142 93789 0.56% 143 104502 0.62% 144 119659 0.72% 145 140583 0.84% 146 171995 1.03% 147 229068 1.37% 148 343013 2.05% 149 683225 4.08% 150 3581796 21.41% 151 9627947 57.56% 16728254 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=3.52 fanout-score-rank=33 prefix-density=0.20 prefix-fanout=2.9 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=343.67 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=19.2 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCAGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTAACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.61 fanout-score-rank=36 prefix-density=0.25 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=26 fanout-score=49.07 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=11.3 sequence=TCAAGGAAGCTTTCAG SRR7169607 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:20:20 Started mapping on | Feb 11 09:20:20 Finished on | Feb 11 09:22:08 Mapping speed, Million of reads per hour | 557.61 Number of input reads | 16728254 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 15830896 Uniquely mapped reads % | 94.64% Average mapped length | 294.91 Number of splices: Total | 14666708 Number of splices: Annotated (sjdb) | 14412023 Number of splices: GT/AG | 14448811 Number of splices: GC/AG | 173403 Number of splices: AT/AC | 12911 Number of splices: Non-canonical | 31583 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 280968 % of reads mapped to multiple loci | 1.68% Number of reads mapped to too many loci | 27781 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.48% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 639385 639385 639385 N_multimapping 280968 280968 280968 N_noFeature 368683 15633371 462625 N_ambiguous 173009 1089 68579 UnstrandedReadsAssigned:15289204 PositiveStrandReadsAssigned:196436 NegativeStrandReadsAssigned:15299692 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169607 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169607-trimmed-pair1.fastq SRR7169607-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,728,254 reads, 15,217,568 reads pseudoaligned [quant] estimated average fragment length: 250.53 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,259 rounds 52401 SRR7169607.ke.tsv 34699 SRR7169607.se.tsv 87100 total ==> SRR7169607.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1768.47 281 10.2566 Potri.005G024800.1.v4.1 1035 785.47 33 2.71194 Potri.004G059700.1.v4.1 961 711.506 1 0.0907231 Potri.007G009000.2.v4.1 1416 1166.47 0 0 Potri.003G141000.2.v4.1 2943 2693.47 227.032 5.44089 Potri.016G087400.1.v4.1 270 77.7039 1382 1148.05 Potri.015G069301.1.v4.1 564 320.459 0 0 Potri.010G195200.1.v4.1 1773 1523.47 38 1.61007 Potri.012G127500.1.v4.1 977 727.482 8238 730.963 ==> SRR7169607.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2112 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 359 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 18 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR7169607 completed mapping pipeline successfully