Starting /dee2/code/volunteer_pipeline.sh SRR7169608 current disk space = 3054293639168 free memory = 1490272148 SRR7169608 SRAfilesize 0992c16065e9d810a4fb88d5f07bb376 SRR7169608.sra SRR7169608.sra file validated SRR7169608 is paired end SRR7169608 is conventional basespace SRR7169608 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169608_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8945 34.0 33.0 34.0 33.0 34.0 2 33.4375 34.0 34.0 34.0 33.0 34.0 3 33.45375 34.0 34.0 34.0 33.0 34.0 4 33.524 34.0 34.0 34.0 33.0 34.0 5 33.537 34.0 34.0 34.0 33.0 34.0 6 37.05075 38.0 37.0 38.0 35.0 38.0 7 37.36225 38.0 38.0 38.0 37.0 38.0 8 37.43925 38.0 38.0 38.0 37.0 38.0 9 37.475 38.0 38.0 38.0 37.0 38.0 10-14 37.5129 38.0 38.0 38.0 37.2 38.0 15-19 37.48635 38.0 38.0 38.0 37.2 38.0 20-24 37.4639 38.0 38.0 38.0 37.4 38.0 25-29 37.4068 38.0 38.0 38.0 37.0 38.0 30-34 37.44349999999999 38.0 38.0 38.0 37.0 38.0 35-39 37.212 38.0 38.0 38.0 36.4 38.0 40-44 37.2339 38.0 38.0 38.0 36.6 38.0 45-49 37.149950000000004 38.0 38.0 38.0 36.0 38.0 50-54 37.1644 38.0 38.0 38.0 36.0 38.0 55-59 37.04995 38.0 38.0 38.0 36.0 38.0 60-64 37.0866 38.0 38.0 38.0 36.0 38.0 65-69 36.98434999999999 38.0 38.0 38.0 36.0 38.0 70-74 36.91635 38.0 38.0 38.0 35.4 38.0 75-79 36.897149999999996 38.0 38.0 38.0 35.4 38.0 80-84 36.825050000000005 38.0 38.0 38.0 35.0 38.0 85-89 36.74535000000001 38.0 38.0 38.0 34.8 38.0 90-94 36.64175 38.0 38.0 38.0 34.4 38.0 95-99 36.570499999999996 38.0 38.0 38.0 34.0 38.0 100-104 36.42674999999999 38.0 37.6 38.0 34.0 38.0 105-109 36.2829 38.0 37.4 38.0 33.8 38.0 110-114 36.10185 38.0 37.0 38.0 33.2 38.0 115-119 35.9135 38.0 37.0 38.0 31.8 38.0 120-124 35.7618 38.0 36.8 38.0 31.0 38.0 125-129 35.51545 38.0 36.0 38.0 31.0 38.0 130-134 35.3199 38.0 36.0 38.0 30.4 38.0 135-139 35.033 38.0 35.8 38.0 28.4 38.0 140-144 34.5865 38.0 35.0 38.0 27.4 38.0 145-149 33.760749999999994 38.0 35.0 38.0 22.2 38.0 150-151 30.729625000000002 36.5 30.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 1.0 8 0.0 9 1.0 10 1.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 2.0 18 2.0 19 6.0 20 2.0 21 5.0 22 3.0 23 7.0 24 4.0 25 9.0 26 13.0 27 23.0 28 33.0 29 46.0 30 44.0 31 49.0 32 70.0 33 94.0 34 124.0 35 288.0 36 673.0 37 2498.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.20672954371654 11.776701503951058 9.151159826663267 35.86540912566913 2 22.675 13.950000000000001 33.175 30.2 3 19.825 20.3 24.725 35.15 4 22.075 26.900000000000002 23.925 27.1 5 22.625 30.175 24.675 22.525000000000002 6 19.525000000000002 34.4 24.325 21.75 7 15.0 26.174999999999997 40.725 18.099999999999998 8 17.675 27.0 29.975 25.35 9 16.875 24.875 34.075 24.175 10-14 20.22 29.330000000000002 27.175 23.275000000000002 15-19 19.72 28.560000000000002 27.860000000000003 23.86 20-24 19.96 29.104999999999997 27.24 23.695 25-29 20.025000000000002 28.285 27.54 24.15 30-34 19.805 28.475 27.905 23.815 35-39 19.765929778933682 28.328498549564866 27.983395018505554 23.9221766529959 40-44 20.385 28.275 27.560000000000002 23.78 45-49 20.515 27.855 27.72 23.91 50-54 20.62 27.815 27.650000000000002 23.915 55-59 20.185 27.834999999999997 27.96 24.02 60-64 20.195 28.194999999999997 27.395000000000003 24.215 65-69 20.265 28.655 27.215 23.865 70-74 20.36 28.51 27.139999999999997 23.990000000000002 75-79 20.49 28.249999999999996 27.075 24.185000000000002 80-84 20.445 28.544999999999998 27.13 23.880000000000003 85-89 20.73 28.425 27.474999999999998 23.369999999999997 90-94 20.635 28.360000000000003 26.979999999999997 24.025 95-99 20.724999999999998 27.515 27.83 23.93 100-104 20.47 28.38 27.18 23.97 105-109 21.310000000000002 28.59 27.115000000000002 22.985 110-114 20.93 28.43 26.924999999999997 23.715 115-119 20.616030801540077 28.25141257062853 27.12635631781589 24.0062003100155 120-124 20.54 28.535 26.91 24.015 125-129 20.46 28.470000000000002 27.345000000000002 23.724999999999998 130-134 20.810000000000002 27.61 27.474999999999998 24.104999999999997 135-139 20.9 28.155 26.935 24.01 140-144 20.225 27.665 27.235 24.875 145-149 20.825 27.715 27.575 23.885 150-151 20.8875 27.712500000000002 27.775 23.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 0.5 25 2.0 26 4.0 27 6.0 28 6.5 29 8.0 30 10.5 31 18.5 32 32.0 33 42.0 34 46.0 35 60.5 36 76.5 37 92.5 38 126.5 39 150.5 40 172.0 41 211.0 42 242.0 43 267.0 44 280.5 45 262.5 46 257.0 47 261.5 48 243.5 49 219.5 50 182.0 51 154.5 52 140.5 53 105.5 54 81.0 55 62.0 56 45.0 57 38.5 58 24.0 59 15.0 60 14.5 61 11.0 62 5.5 63 4.5 64 4.0 65 2.5 66 1.5 67 1.5 68 1.5 69 1.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.925 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.03 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.4875 0.0 0.0 0.0 0.0 102-103 0.625 0.0 0.0 0.0 0.0 104-105 0.875 0.0 0.0 0.0 0.0 106-107 0.95 0.0 0.0 0.0 0.0 108-109 1.125 0.0 0.0 0.0 0.0 110-111 1.2999999999999998 0.0 0.0 0.0 0.0 112-113 1.425 0.0 0.0 0.0 0.0 114-115 1.6 0.0 0.0 0.0 0.0 116-117 1.8375 0.0 0.0 0.0125 0.0 118-119 2.1125 0.0 0.0 0.025 0.0 120-121 2.35 0.0 0.0 0.025 0.0 122-123 2.5999999999999996 0.0 0.0 0.025 0.0 124-125 2.9 0.0 0.0 0.025 0.0 126-127 3.2625 0.0 0.0 0.025 0.0 128-129 3.5999999999999996 0.0 0.0 0.025 0.0 130-131 3.9375 0.0 0.0 0.025 0.0 132-133 4.362500000000001 0.0 0.0 0.025 0.0 134-135 4.7 0.0 0.0 0.025 0.0 136-137 4.987500000000001 0.0 0.0 0.025 0.0 138-139 5.324999999999999 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTCTTG 10 0.006846698 144.88751 3 CCCTCTT 10 0.006846698 144.88751 2 TTTGCGA 10 0.006846698 144.88751 7 >>END_MODULE SRR7169608 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169608_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.005 33.0 33.0 34.0 32.0 34.0 2 33.09025 34.0 33.0 34.0 32.0 34.0 3 33.15575 34.0 33.0 34.0 33.0 34.0 4 33.13875 34.0 33.0 34.0 33.0 34.0 5 33.16025 34.0 33.0 34.0 33.0 34.0 6 37.2055 38.0 38.0 38.0 37.0 38.0 7 37.2425 38.0 38.0 38.0 37.0 38.0 8 37.21425 38.0 38.0 38.0 37.0 38.0 9 37.22625 38.0 38.0 38.0 37.0 38.0 10-14 37.1793 38.0 38.0 38.0 37.0 38.0 15-19 37.15985 38.0 38.0 38.0 37.0 38.0 20-24 37.1027 38.0 38.0 38.0 37.0 38.0 25-29 37.111000000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.01035 38.0 38.0 38.0 37.0 38.0 35-39 36.9872 38.0 38.0 38.0 37.0 38.0 40-44 37.02635 38.0 38.0 38.0 37.0 38.0 45-49 37.00695 38.0 38.0 38.0 36.8 38.0 50-54 36.9939 38.0 38.0 38.0 37.0 38.0 55-59 36.77945 38.0 38.0 38.0 36.0 38.0 60-64 36.9222 38.0 38.0 38.0 36.2 38.0 65-69 36.869899999999994 38.0 38.0 38.0 36.2 38.0 70-74 36.7506 38.0 38.0 38.0 36.0 38.0 75-79 36.753750000000004 38.0 38.0 38.0 36.0 38.0 80-84 36.6251 38.0 38.0 38.0 35.4 38.0 85-89 36.49395 38.0 38.0 38.0 35.0 38.0 90-94 36.402499999999996 38.0 38.0 38.0 34.2 38.0 95-99 36.38695 38.0 38.0 38.0 34.4 38.0 100-104 36.32695 38.0 38.0 38.0 34.0 38.0 105-109 36.245850000000004 38.0 38.0 38.0 34.0 38.0 110-114 36.0997 38.0 38.0 38.0 34.0 38.0 115-119 35.95085 38.0 38.0 38.0 33.6 38.0 120-124 35.733000000000004 38.0 37.6 38.0 33.0 38.0 125-129 35.42555 38.0 37.0 38.0 31.0 38.0 130-134 35.1698 38.0 36.2 38.0 29.4 38.0 135-139 34.91995 38.0 36.0 38.0 28.6 38.0 140-144 34.455499999999994 38.0 35.2 38.0 27.4 38.0 145-149 33.7957 38.0 35.0 38.0 21.6 38.0 150-151 30.176625 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 16.0 4 2.0 5 2.0 6 2.0 7 1.0 8 1.0 9 1.0 10 1.0 11 0.0 12 1.0 13 4.0 14 1.0 15 2.0 16 1.0 17 4.0 18 2.0 19 6.0 20 7.0 21 4.0 22 7.0 23 11.0 24 14.0 25 14.0 26 12.0 27 27.0 28 19.0 29 27.0 30 50.0 31 44.0 32 70.0 33 83.0 34 107.0 35 185.0 36 476.0 37 2789.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.15 22.325 13.900000000000002 26.625 2 28.449999999999996 26.924999999999997 29.2 15.425 3 21.125 29.4 30.9 18.575 4 22.900000000000002 36.175000000000004 22.650000000000002 18.275 5 24.65 36.375 21.95 17.025000000000002 6 20.476787954830613 37.31493099121707 23.161856963613552 19.04642409033877 7 21.279799247176914 23.789209535759095 36.235884567126725 18.695106649937266 8 21.982434127979925 26.800501882057716 25.06900878293601 26.14805520702635 9 20.85319949811794 27.00125470514429 28.908406524466752 23.237139272271015 10-14 23.493099121706397 28.973651191969886 26.70012547051443 20.833124215809285 15-19 22.705144291091596 27.583437892095358 28.075282308657467 21.636135508155583 20-24 22.29861982434128 28.100376411543287 28.005018820577167 21.59598494353827 25-29 23.508155583437894 27.723964868255962 27.196988707653702 21.570890840652446 30-34 23.228267416181488 27.956233688014454 28.031519775145554 20.7839791206585 35-39 23.57458341698454 27.203372816703475 28.28247339891588 20.939570367396104 40-44 22.734570998494732 27.932764676367285 27.912694430506775 21.419969894631212 45-49 23.615569823434992 27.53812199036918 27.72873194221509 21.117576243980736 50-54 23.20954242469804 27.228988122086907 28.126096326366962 21.43537312684809 55-59 23.75438596491228 27.548872180451127 28.39598997493734 20.30075187969925 60-64 23.098139511559097 27.927385788074822 28.01765207361717 20.95682262674891 65-69 23.736208625877634 27.592778335005015 28.114343029087262 20.55667001003009 70-74 24.101946618502907 27.704194260485654 27.68412602849689 20.509733092514548 75-79 23.67047963074453 27.453341360626126 28.165763596227173 20.710415412402167 80-84 23.59465970688617 28.011443485243927 27.102991367195344 21.290905440674564 85-89 23.224057432602038 27.92308850845926 27.89296651438325 20.95988754455545 90-94 23.7038895859473 27.573400250941027 27.633626097867005 21.089084065244666 95-99 23.255230545381565 28.152124830665798 27.740705433746427 20.851939190206213 100-104 24.31917347911129 27.694468127789758 27.263152615477203 20.723205777621747 105-109 23.955306142900092 28.02886060727528 27.292313859104116 20.72351939072051 110-114 24.162655435218614 27.662454873646208 27.286401925391097 20.88848776574408 115-119 24.057171514543633 28.119358074222667 27.708124373119357 20.115346038114343 120-124 24.18634973170854 27.591394614111632 27.370743693896998 20.851511960282835 125-129 24.19241573033708 27.71368378812199 27.13182182985554 20.962078651685392 130-134 24.267656500802566 28.305577849117174 27.14185393258427 20.284911717495987 135-139 24.530858003010536 27.832413447064724 27.240341194179628 20.39638735574511 140-144 25.529034199177612 27.339283923377796 26.742553404874137 20.38912847257045 145-149 25.529889261913112 27.454026156235905 26.73748559402716 20.27859898782382 150-151 24.996872263230326 27.861879144251223 27.073689478293506 20.06755911422495 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 1.0 2 2.0 3 2.5 4 1.5 5 1.0 6 1.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 0.5 17 0.0 18 0.5 19 1.5 20 1.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.5 26 2.5 27 4.0 28 5.0 29 4.0 30 6.5 31 11.0 32 19.0 33 35.5 34 45.5 35 53.0 36 65.5 37 94.0 38 131.5 39 154.5 40 191.0 41 232.5 42 267.0 43 290.5 44 295.0 45 305.0 46 275.0 47 234.5 48 249.5 49 225.0 50 175.5 51 144.0 52 114.5 53 98.5 54 74.5 55 48.5 56 30.5 57 21.5 58 21.5 59 17.0 60 11.0 61 10.0 62 6.0 63 2.5 64 2.5 65 2.0 66 1.5 67 1.5 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.375 7 0.375 8 0.375 9 0.375 10-14 0.375 15-19 0.375 20-24 0.375 25-29 0.375 30-34 0.38 35-39 0.38 40-44 0.35000000000000003 45-49 0.32 50-54 0.23500000000000001 55-59 0.25 60-64 0.295 65-69 0.3 70-74 0.33999999999999997 75-79 0.33999999999999997 80-84 0.38 85-89 0.40499999999999997 90-94 0.375 95-99 0.345 100-104 0.305 105-109 0.21 110-114 0.27999999999999997 115-119 0.3 120-124 0.295 125-129 0.32 130-134 0.32 135-139 0.35000000000000003 140-144 0.29 145-149 0.215 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.3875 0.0 0.0 0.0 0.0 100-101 0.4625 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.825 0.0 0.0 0.0 0.0 106-107 0.9125000000000001 0.0 0.0 0.0 0.0 108-109 1.075 0.0 0.0 0.0 0.0 110-111 1.25 0.0 0.0 0.0 0.0 112-113 1.375 0.0 0.0 0.0 0.0 114-115 1.5625 0.0 0.0 0.0 0.0 116-117 1.7875 0.0 0.0 0.0 0.0 118-119 2.0625 0.0 0.0 0.0 0.0 120-121 2.3125 0.0 0.0 0.0 0.0 122-123 2.575 0.0 0.0 0.0 0.0 124-125 2.85 0.0 0.0 0.0 0.0 126-127 3.2249999999999996 0.0 0.0 0.0 0.0 128-129 3.5875 0.0 0.0 0.0 0.0 130-131 3.975 0.0 0.0 0.0 0.0 132-133 4.4125 0.0 0.0 0.0 0.0 134-135 4.7375 0.0 0.0 0.0 0.0 136-137 5.0375 0.0 0.0 0.0 0.0 138-139 5.362500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTGGCT 10 0.006830828 145.0 7 CCACTTT 10 0.006830828 145.0 3 >>END_MODULE Read 879736 spots for SRR7169608.sra Written 879736 spots for SRR7169608.sra Read 879736 spots for SRR7169608.sra Written 879736 spots for SRR7169608.sra Read 879736 spots for SRR7169608.sra Written 879736 spots for SRR7169608.sra Read 879736 spots for SRR7169608.sra Written 879736 spots for SRR7169608.sra Read 879736 spots for SRR7169608.sra Written 879736 spots for SRR7169608.sra Read 879736 spots for SRR7169608.sra Written 879736 spots for SRR7169608.sra Read 879736 spots for SRR7169608.sra Written 879736 spots for SRR7169608.sra Read 879736 spots for SRR7169608.sra Written 879736 spots for SRR7169608.sra Read 879736 spots for SRR7169608.sra Written 879736 spots for SRR7169608.sra Read 879736 spots for SRR7169608.sra Written 879736 spots for SRR7169608.sra Read 879736 spots for SRR7169608.sra Written 879736 spots for SRR7169608.sra Read 879736 spots for SRR7169608.sra Written 879736 spots for SRR7169608.sra Read 879736 spots for SRR7169608.sra Written 879736 spots for SRR7169608.sra Read 879736 spots for SRR7169608.sra Written 879736 spots for SRR7169608.sra Read 879736 spots for SRR7169608.sra Written 879736 spots for SRR7169608.sra Read 879736 spots for SRR7169608.sra Written 879736 spots for SRR7169608.sra Read 879736 spots for SRR7169608.sra Written 879736 spots for SRR7169608.sra Read 879736 spots for SRR7169608.sra Written 879736 spots for SRR7169608.sra Read 879738 spots for SRR7169608.sra Written 879738 spots for SRR7169608.sra Read 879736 spots for SRR7169608.sra Written 879736 spots for SRR7169608.sra SRR ids: ['SRR7169608.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jdf2qwdh SRR7169608.sra spots: 17594722 blocks: [[1, 879736], [879737, 1759472], [1759473, 2639208], [2639209, 3518944], [3518945, 4398680], [4398681, 5278416], [5278417, 6158152], [6158153, 7037888], [7037889, 7917624], [7917625, 8797360], [8797361, 9677096], [9677097, 10556832], [10556833, 11436568], [11436569, 12316304], [12316305, 13196040], [13196041, 14075776], [14075777, 14955512], [14955513, 15835248], [15835249, 16714984], [16714985, 17594722]] SRR7169608 file size 5940573 SRR7169608 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169608 SRR7169608_1.fastq SRR7169608_2.fastq Input file: SRR7169608_1.fastq Paired file: SRR7169608_2.fastq trimmed: SRR7169608-trimmed-pair1.fastq, SRR7169608-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:52:50 2025 >> started Tue Feb 11 09:53:11 2025 >> done (21.025s) 17594722 read pairs processed; of these: 36821 ( 0.21%) short read pairs filtered out after trimming by size control 35931 ( 0.20%) empty read pairs filtered out after trimming by size control 17521970 (99.59%) read pairs available; of these: 8206121 (46.83%) trimmed read pairs available after processing 9315849 (53.17%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 6 0.00% 20 2 0.00% 21 1 0.00% 22 5 0.00% 23 3 0.00% 24 4 0.00% 25 6 0.00% 26 4 0.00% 27 3 0.00% 28 7 0.00% 29 5 0.00% 30 11 0.00% 31 11 0.00% 32 5 0.00% 33 14 0.00% 34 6 0.00% 35 13 0.00% 36 9 0.00% 37 13 0.00% 38 21 0.00% 39 14 0.00% 40 13 0.00% 41 20 0.00% 42 20 0.00% 43 16 0.00% 44 22 0.00% 45 21 0.00% 46 33 0.00% 47 34 0.00% 48 45 0.00% 49 39 0.00% 50 40 0.00% 51 64 0.00% 52 79 0.00% 53 76 0.00% 54 86 0.00% 55 83 0.00% 56 95 0.00% 57 87 0.00% 58 130 0.00% 59 163 0.00% 60 162 0.00% 61 172 0.00% 62 203 0.00% 63 258 0.00% 64 274 0.00% 65 305 0.00% 66 354 0.00% 67 451 0.00% 68 709 0.00% 69 1361 0.01% 70 1100 0.01% 71 796 0.00% 72 750 0.00% 73 843 0.00% 74 964 0.01% 75 994 0.01% 76 1144 0.01% 77 1223 0.01% 78 1470 0.01% 79 1588 0.01% 80 1734 0.01% 81 2051 0.01% 82 2358 0.01% 83 2902 0.02% 84 3944 0.02% 85 4501 0.03% 86 4872 0.03% 87 5056 0.03% 88 5495 0.03% 89 5649 0.03% 90 5822 0.03% 91 6760 0.04% 92 7258 0.04% 93 7570 0.04% 94 8455 0.05% 95 8875 0.05% 96 9452 0.05% 97 9839 0.06% 98 10338 0.06% 99 10798 0.06% 100 11623 0.07% 101 12175 0.07% 102 13258 0.08% 103 13898 0.08% 104 14781 0.08% 105 15730 0.09% 106 16724 0.10% 107 17205 0.10% 108 17972 0.10% 109 18721 0.11% 110 19501 0.11% 111 20532 0.12% 112 21532 0.12% 113 22867 0.13% 114 24504 0.14% 115 25588 0.15% 116 26447 0.15% 117 27778 0.16% 118 28624 0.16% 119 29343 0.17% 120 30311 0.17% 121 31966 0.18% 122 33276 0.19% 123 35257 0.20% 124 37401 0.21% 125 39182 0.22% 126 41294 0.24% 127 43226 0.25% 128 44692 0.26% 129 46344 0.26% 130 48997 0.28% 131 51012 0.29% 132 54188 0.31% 133 57295 0.33% 134 60556 0.35% 135 65857 0.38% 136 69835 0.40% 137 74751 0.43% 138 79712 0.45% 139 85201 0.49% 140 91163 0.52% 141 100135 0.57% 142 110636 0.63% 143 124185 0.71% 144 143522 0.82% 145 170112 0.97% 146 209656 1.20% 147 286272 1.63% 148 442279 2.52% 149 887805 5.07% 150 4071013 23.23% 151 9315849 53.17% 17521970 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=39 prefix-density=0.19 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAAC criterion=fanout-score sequence-density=0.10 sequence-density-rank=20 fanout-score=251.34 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=28.5 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=38 prefix-density=0.36 prefix-fanout=2.2 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.02 sequence-density-rank=39 fanout-score=138.46 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=8.2 sequence=CTCTTCCTCTTCACAATTAGCAAACAGTAAGTTTGAACACACTCAAGATTTGAAATATCCTACAACGATGAGAAAGCAACTCCTCTCCCCATTCGTTCCTTTCTTGATGTTCTTCCTCTACAGCTCCACCACTTTTGCTCAAACC SRR7169608 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:53:56 Started mapping on | Feb 11 09:53:56 Finished on | Feb 11 09:55:50 Mapping speed, Million of reads per hour | 553.33 Number of input reads | 17521970 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 16774438 Uniquely mapped reads % | 95.73% Average mapped length | 294.76 Number of splices: Total | 16342454 Number of splices: Annotated (sjdb) | 16076801 Number of splices: GT/AG | 16107794 Number of splices: GC/AG | 190886 Number of splices: AT/AC | 13904 Number of splices: Non-canonical | 29870 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 300958 % of reads mapped to multiple loci | 1.72% Number of reads mapped to too many loci | 85483 % of reads mapped to too many loci | 0.49% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.97% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 464462 464462 464462 N_multimapping 300958 300958 300958 N_noFeature 350045 16591279 440581 N_ambiguous 160033 777 66989 UnstrandedReadsAssigned:16264360 PositiveStrandReadsAssigned:182382 NegativeStrandReadsAssigned:16266868 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169608 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169608-trimmed-pair1.fastq SRR7169608-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,521,970 reads, 16,204,579 reads pseudoaligned [quant] estimated average fragment length: 250.126 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,082 rounds 52401 SRR7169608.ke.tsv 34699 SRR7169608.se.tsv 87100 total ==> SRR7169608.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1768.87 312 10.6874 Potri.005G024800.1.v4.1 1035 785.874 33 2.54435 Potri.004G059700.1.v4.1 961 711.916 1 0.0851112 Potri.007G009000.2.v4.1 1416 1166.87 0 0 Potri.003G141000.2.v4.1 2943 2693.87 325.036 7.31089 Potri.016G087400.1.v4.1 270 77.5562 1342 1048.46 Potri.015G069301.1.v4.1 564 321.437 0 0 Potri.010G195200.1.v4.1 1773 1523.87 22 0.874761 Potri.012G127500.1.v4.1 977 727.904 6825 568.125 ==> SRR7169608.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1270 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 294 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7169608 completed mapping pipeline successfully