Starting /dee2/code/volunteer_pipeline.sh SRR7169609 current disk space = 3053557006336 free memory = 1579035124 SRR7169609 SRAfilesize 889d407fcac01ffda9dfa1b3e3eec2c8 SRR7169609.sra SRR7169609.sra file validated SRR7169609 is paired end SRR7169609 is conventional basespace SRR7169609 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169609_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.72175 34.0 33.0 34.0 25.0 34.0 2 32.8535 34.0 33.0 34.0 28.0 34.0 3 33.0165 34.0 33.0 34.0 30.0 34.0 4 33.3605 34.0 33.0 34.0 33.0 34.0 5 33.3305 34.0 33.0 34.0 33.0 34.0 6 36.85275 38.0 37.0 38.0 35.0 38.0 7 37.30675 38.0 38.0 38.0 37.0 38.0 8 37.40875 38.0 38.0 38.0 37.0 38.0 9 37.5225 38.0 38.0 38.0 37.0 38.0 10-14 37.54635 38.0 38.0 38.0 38.0 38.0 15-19 37.5035 38.0 38.0 38.0 38.0 38.0 20-24 37.45745 38.0 38.0 38.0 37.4 38.0 25-29 37.42245 38.0 38.0 38.0 37.4 38.0 30-34 37.33669999999999 38.0 38.0 38.0 37.0 38.0 35-39 37.2745 38.0 38.0 38.0 36.8 38.0 40-44 36.962599999999995 38.0 38.0 38.0 36.0 38.0 45-49 36.886300000000006 38.0 38.0 38.0 35.4 38.0 50-54 36.7624 38.0 38.0 38.0 34.8 38.0 55-59 36.7302 38.0 38.0 38.0 34.6 38.0 60-64 36.5582 38.0 38.0 38.0 34.0 38.0 65-69 36.4875 38.0 38.0 38.0 34.0 38.0 70-74 36.32295 38.0 37.8 38.0 34.0 38.0 75-79 36.16635 38.0 38.0 38.0 33.6 38.0 80-84 36.03585 38.0 37.4 38.0 33.0 38.0 85-89 35.993700000000004 38.0 37.0 38.0 32.4 38.0 90-94 35.72154999999999 38.0 37.0 38.0 31.0 38.0 95-99 35.3707 38.0 36.6 38.0 29.8 38.0 100-104 35.09705 38.0 36.0 38.0 28.8 38.0 105-109 34.79494999999999 38.0 35.6 38.0 27.0 38.0 110-114 34.4885 38.0 35.0 38.0 25.8 38.0 115-119 34.22545 38.0 34.8 38.0 24.0 38.0 120-124 33.55175 38.0 34.0 38.0 18.2 38.0 125-129 33.2957 38.0 34.0 38.0 16.2 38.0 130-134 33.17535 38.0 34.0 38.0 15.0 38.0 135-139 32.845 38.0 33.4 38.0 14.8 38.0 140-144 32.176249999999996 37.8 32.6 38.0 14.0 38.0 145-149 30.645100000000003 36.2 31.0 38.0 6.4 38.0 150-151 26.2395 33.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 1.0 11 1.0 12 0.0 13 3.0 14 2.0 15 8.0 16 14.0 17 8.0 18 15.0 19 9.0 20 13.0 21 23.0 22 18.0 23 10.0 24 17.0 25 15.0 26 27.0 27 37.0 28 36.0 29 48.0 30 68.0 31 70.0 32 105.0 33 138.0 34 212.0 35 421.0 36 1024.0 37 1655.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.02239213544511 13.95412342981977 10.349535772801747 36.67394866193337 2 23.200000000000003 15.1 30.4 31.3 3 20.775 16.975 24.725 37.525 4 21.349999999999998 24.275 22.900000000000002 31.474999999999998 5 22.775000000000002 28.925 23.474999999999998 24.825 6 20.325 32.550000000000004 24.825 22.3 7 13.65 29.75 39.775 16.825000000000003 8 18.05 28.225 31.7 22.025 9 16.325 27.05 32.800000000000004 23.825 10-14 18.279999999999998 31.230000000000004 28.1 22.39 15-19 18.715 30.04 27.334999999999997 23.91 20-24 18.965 30.005 27.400000000000002 23.630000000000003 25-29 19.205 30.545 26.41 23.84 30-34 18.360000000000003 29.970000000000002 27.68 23.990000000000002 35-39 18.475 30.11 27.27 24.145 40-44 19.215 29.68 27.48 23.625 45-49 19.475 29.244999999999997 27.455000000000002 23.825 50-54 19.46 29.565 26.935 24.04 55-59 19.384999999999998 29.244999999999997 27.060000000000002 24.310000000000002 60-64 19.685 28.93 27.245 24.14 65-69 19.259999999999998 29.215000000000003 27.43 24.095 70-74 18.975 29.609999999999996 26.650000000000002 24.765 75-79 19.384999999999998 29.509999999999998 27.284999999999997 23.82 80-84 19.950000000000003 29.26 27.224999999999998 23.565 85-89 20.13 29.465000000000003 26.650000000000002 23.755000000000003 90-94 20.455000000000002 28.715000000000003 26.5 24.33 95-99 19.509999999999998 28.455000000000002 27.565 24.47 100-104 19.57 28.849999999999998 26.8 24.779999999999998 105-109 19.96 28.555000000000003 26.825 24.66 110-114 20.169999999999998 29.044999999999998 26.69 24.095 115-119 19.875 28.98 26.51 24.635 120-124 20.200000000000003 28.665000000000003 26.700000000000003 24.435000000000002 125-129 20.13 28.849999999999998 26.195 24.825 130-134 20.495 28.235 26.505000000000003 24.765 135-139 19.345000000000002 28.705000000000002 27.034999999999997 24.915000000000003 140-144 20.455000000000002 28.32 26.790000000000003 24.435000000000002 145-149 20.669999999999998 28.52 25.94 24.87 150-151 20.1 28.487499999999997 27.0625 24.349999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 0.5 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 1.0 19 2.0 20 2.0 21 1.5 22 3.0 23 4.0 24 3.5 25 6.5 26 11.0 27 14.5 28 13.5 29 21.0 30 30.5 31 40.0 32 58.5 33 67.0 34 74.0 35 90.0 36 108.0 37 128.0 38 148.0 39 161.5 40 176.5 41 200.5 42 236.0 43 235.5 44 215.0 45 224.0 46 213.0 47 211.0 48 208.0 49 183.5 50 161.0 51 131.5 52 116.0 53 108.0 54 92.5 55 72.0 56 55.5 57 41.5 58 32.0 59 26.0 60 15.0 61 10.0 62 12.5 63 11.0 64 5.5 65 4.5 66 4.0 67 1.5 68 2.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.450000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21399594320486 97.82499999999999 2 0.6338742393509128 1.25 3 0.07606490872210953 0.22499999999999998 4 0.05070993914807302 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02535496957403651 0.5 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC 20 0.5 TruSeq Adapter, Index 7 (100% over 50bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.4875 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.9125000000000001 0.0 0.0 0.0 0.0 98-99 1.1625 0.0 0.0 0.0 0.0 100-101 1.3624999999999998 0.0 0.0 0.0 0.0 102-103 1.7 0.0 0.0 0.0 0.0 104-105 1.925 0.0 0.0 0.0 0.0 106-107 2.2249999999999996 0.0 0.0 0.0 0.0 108-109 2.5625 0.0 0.0 0.0 0.0 110-111 2.95 0.0 0.0 0.0 0.0 112-113 3.3375000000000004 0.0 0.0 0.0 0.0 114-115 3.7 0.0 0.0 0.0 0.0 116-117 4.1625 0.0 0.0 0.0 0.0 118-119 4.550000000000001 0.0 0.0 0.0 0.0 120-121 4.975 0.0 0.0 0.0 0.0 122-123 5.4625 0.0 0.0 0.0 0.0 124-125 5.8875 0.0 0.0 0.0 0.0 126-127 6.425 0.0 0.0 0.0 0.0 128-129 7.0375 0.0 0.0 0.0 0.0 130-131 7.512499999999999 0.0 0.0 0.0 0.0 132-133 8.1125 0.0 0.0 0.0 0.0 134-135 8.625 0.0 0.0 0.0 0.0 136-137 9.2625 0.0 0.0 0.0 0.0 138-139 10.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169609 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169609_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.69075 33.0 33.0 34.0 32.0 34.0 2 32.68775 34.0 33.0 34.0 32.0 34.0 3 32.87475 34.0 33.0 34.0 32.0 34.0 4 32.87025 34.0 33.0 34.0 32.0 34.0 5 32.89775 34.0 33.0 34.0 33.0 34.0 6 37.068 38.0 38.0 38.0 37.0 38.0 7 36.9155 38.0 38.0 38.0 37.0 38.0 8 37.0255 38.0 38.0 38.0 37.0 38.0 9 37.0655 38.0 38.0 38.0 37.0 38.0 10-14 37.080999999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.02065 38.0 38.0 38.0 37.0 38.0 20-24 36.944100000000006 38.0 38.0 38.0 37.0 38.0 25-29 36.916650000000004 38.0 38.0 38.0 37.0 38.0 30-34 36.7792 38.0 38.0 38.0 36.8 38.0 35-39 36.8521 38.0 38.0 38.0 37.0 38.0 40-44 36.853500000000004 38.0 38.0 38.0 37.0 38.0 45-49 36.63265 38.0 38.0 38.0 35.8 38.0 50-54 36.71275000000001 38.0 38.0 38.0 36.2 38.0 55-59 36.65265 38.0 38.0 38.0 36.0 38.0 60-64 36.5998 38.0 38.0 38.0 36.0 38.0 65-69 36.470600000000005 38.0 38.0 38.0 35.6 38.0 70-74 36.2702 38.0 38.0 38.0 34.8 38.0 75-79 36.3221 38.0 38.0 38.0 35.0 38.0 80-84 36.286950000000004 38.0 38.0 38.0 35.0 38.0 85-89 36.20094999999999 38.0 38.0 38.0 34.6 38.0 90-94 35.987649999999995 38.0 38.0 38.0 33.6 38.0 95-99 35.8627 38.0 38.0 38.0 33.8 38.0 100-104 35.75725 38.0 38.0 38.0 33.4 38.0 105-109 35.60195 38.0 38.0 38.0 32.4 38.0 110-114 35.36025 38.0 38.0 38.0 30.4 38.0 115-119 35.16009999999999 38.0 37.2 38.0 29.8 38.0 120-124 34.96640000000001 38.0 36.8 38.0 28.6 38.0 125-129 34.5561 38.0 36.0 38.0 26.6 38.0 130-134 34.240649999999995 38.0 35.4 38.0 24.0 38.0 135-139 33.795100000000005 38.0 35.0 38.0 20.2 38.0 140-144 33.596999999999994 38.0 34.4 38.0 21.0 38.0 145-149 32.8225 38.0 33.0 38.0 10.8 38.0 150-151 28.453625000000002 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 21.0 3 5.0 4 5.0 5 1.0 6 2.0 7 3.0 8 1.0 9 5.0 10 3.0 11 2.0 12 2.0 13 8.0 14 4.0 15 4.0 16 13.0 17 20.0 18 2.0 19 10.0 20 10.0 21 8.0 22 15.0 23 9.0 24 18.0 25 20.0 26 30.0 27 25.0 28 33.0 29 28.0 30 44.0 31 44.0 32 73.0 33 77.0 34 106.0 35 198.0 36 442.0 37 2709.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.65461847389558 22.01305220883534 14.809236947791165 24.52309236947791 2 28.528453246427677 27.726247179744295 27.92679869641514 15.818500877412886 3 23.6518685728618 28.392274893403563 29.044394281414597 18.911462252320042 4 25.871145650538985 33.46703434444723 22.286287290047632 18.375532714966155 5 26.536242789064456 34.93855028843742 20.91798344620015 17.607223476297968 6 23.352543222250063 38.71210223001754 21.623653219744423 16.311701327987972 7 21.77399148083187 23.552994237033325 35.75544976196442 18.917564520170384 8 23.527937860185418 26.033575544976195 26.785266850413432 23.653219744424955 9 23.177148584314708 27.48684540215485 27.461789025306942 21.874216988223502 10-14 24.906038586820344 28.659483838636934 25.442245051365575 20.992232523177147 15-19 24.961154829331864 28.21412460528294 26.45982657510902 20.364893990276176 20-24 24.335839598997495 28.25563909774436 26.85213032581454 20.55639097744361 25-29 24.9461071840377 27.959091592720707 26.86619541785732 20.228605805384266 30-34 25.003758833258154 28.44183832005212 26.532351024908536 20.022051821781186 35-39 24.476190476190478 27.884711779448622 26.882205513784463 20.75689223057644 40-44 25.467488845440418 27.598135057903445 26.61051787236176 20.32385822429438 45-49 25.448801524420823 27.66021462240498 26.34640457326246 20.544579279911744 50-54 24.19047619047619 27.95488721804511 26.726817042606516 21.127819548872182 55-59 24.502381549260466 27.706192028077215 27.435447480571572 20.35597894209075 60-64 24.166123288358328 28.259015900085267 27.306013943923357 20.268846867633044 65-69 25.003761849826954 27.647088328233938 27.245824346692082 20.10332547524703 70-74 25.226987710057685 28.141459744168547 26.997742663656886 19.63380988211688 75-79 24.33910208176574 27.62979683972912 27.68497617256082 20.34612490594432 80-84 24.635063957863053 28.096313017306247 27.098068723350888 20.17055430147981 85-89 24.270091301294272 27.79672920638106 27.455603491522023 20.47757600080265 90-94 24.68516381516231 27.3543725854197 27.971501680798756 19.988961918619236 95-99 24.540893125940794 27.13998996487707 28.42950326141495 19.889613647767185 100-104 25.634594160730412 27.68134844988462 27.244908197050265 19.439149192334703 105-109 24.831945419885624 27.977325173071133 28.047556937895052 19.14317246914819 110-114 25.25085289985952 28.642384105960268 27.092113184828413 19.0146498093518 115-119 25.196929406452263 27.158697506397072 27.896242035020823 19.748131052129846 120-124 25.4904912439159 27.82879221235386 27.76356064027297 18.91715590345727 125-129 25.545687189522802 27.42234934015756 27.4574740328165 19.574489437503136 130-134 25.20451693851945 28.155583437892094 27.473023839397744 19.166875784190715 135-139 26.465274989963874 27.759935768767562 27.112605379365718 18.66218386190285 140-144 26.348808030112924 27.83437892095358 27.212045169385195 18.604767879548305 145-149 26.097867001254706 28.180677540777914 26.956085319949814 18.765370138017566 150-151 26.637445209768316 27.62680025046963 26.24921728240451 19.486537257357543 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 8.0 1 4.5 2 0.5 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 2.0 22 2.5 23 1.5 24 1.0 25 2.0 26 3.0 27 3.0 28 4.0 29 7.5 30 11.5 31 14.5 32 17.0 33 21.0 34 39.0 35 60.5 36 70.0 37 87.0 38 112.5 39 134.5 40 177.0 41 205.5 42 229.0 43 247.0 44 260.0 45 272.0 46 274.5 47 266.0 48 238.0 49 214.0 50 187.0 51 167.0 52 140.5 53 117.0 54 96.0 55 74.0 56 56.5 57 44.0 58 35.5 59 25.5 60 17.0 61 14.0 62 15.5 63 10.0 64 3.0 65 2.0 66 1.5 67 1.5 68 1.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.27499999999999997 3 0.325 4 0.27499999999999997 5 0.325 6 0.22499999999999998 7 0.22499999999999998 8 0.22499999999999998 9 0.22499999999999998 10-14 0.22499999999999998 15-19 0.245 20-24 0.25 25-29 0.265 30-34 0.23500000000000001 35-39 0.25 40-44 0.265 45-49 0.29 50-54 0.25 55-59 0.27499999999999997 60-64 0.315 65-69 0.315 70-74 0.325 75-79 0.325 80-84 0.325 85-89 0.33 90-94 0.345 95-99 0.35000000000000003 100-104 0.33 105-109 0.33 110-114 0.33999999999999997 115-119 0.345 120-124 0.35500000000000004 125-129 0.35500000000000004 130-134 0.375 135-139 0.36 140-144 0.375 145-149 0.375 150-151 0.1875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.05900305188199 97.375 2 0.7375381485249237 1.4500000000000002 3 0.10172939979654119 0.3 4 0.050864699898270596 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025432349949135298 0.2 9 0.0 0.0 >10 0.025432349949135298 0.475 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 19 0.475 Illumina Single End PCR Primer 1 (100% over 50bp) NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 8 0.2 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.2125 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.4875 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.95 0.0 0.0 0.0 0.0 98-99 1.1875 0.0 0.0 0.0 0.0 100-101 1.3624999999999998 0.0 0.0 0.0 0.0 102-103 1.7125 0.0 0.0 0.0 0.0 104-105 2.025 0.0 0.0 0.0 0.0 106-107 2.3499999999999996 0.0 0.0 0.0 0.0 108-109 2.7 0.0 0.0 0.0 0.0 110-111 3.0875 0.0 0.0 0.0 0.0 112-113 3.5 0.0 0.0 0.0 0.0 114-115 3.925 0.0 0.0 0.0 0.0 116-117 4.4125 0.0 0.0 0.0 0.0 118-119 4.824999999999999 0.0 0.0 0.0 0.0 120-121 5.2125 0.0 0.0 0.0 0.0 122-123 5.6625 0.0 0.0 0.0 0.0 124-125 6.1125 0.0 0.0 0.0 0.0 126-127 6.6625 0.0 0.0 0.0 0.0 128-129 7.262499999999999 0.0 0.0 0.0 0.0 130-131 7.762499999999999 0.0 0.0 0.0 0.0 132-133 8.3875 0.0 0.0 0.0 0.0 134-135 8.962499999999999 0.0 0.0 0.0 0.0 136-137 9.6375 0.0 0.0 0.0 0.0 138-139 10.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 40 0.0076550315 18.125 60-64 >>END_MODULE Read 838143 spots for SRR7169609.sra Written 838143 spots for SRR7169609.sra Read 838143 spots for SRR7169609.sra Written 838143 spots for SRR7169609.sra Read 838143 spots for SRR7169609.sra Written 838143 spots for SRR7169609.sra Read 838143 spots for SRR7169609.sra Written 838143 spots for SRR7169609.sra Read 838143 spots for SRR7169609.sra Written 838143 spots for SRR7169609.sra Read 838143 spots for SRR7169609.sra Written 838143 spots for SRR7169609.sra Read 838143 spots for SRR7169609.sra Written 838143 spots for SRR7169609.sra Read 838143 spots for SRR7169609.sra Written 838143 spots for SRR7169609.sra Read 838143 spots for SRR7169609.sra Written 838143 spots for SRR7169609.sra Read 838155 spots for SRR7169609.sra Written 838155 spots for SRR7169609.sra Read 838143 spots for SRR7169609.sra Written 838143 spots for SRR7169609.sra Read 838143 spots for SRR7169609.sra Written 838143 spots for SRR7169609.sra Read 838143 spots for SRR7169609.sra Written 838143 spots for SRR7169609.sra Read 838143 spots for SRR7169609.sra Written 838143 spots for SRR7169609.sra Read 838143 spots for SRR7169609.sra Written 838143 spots for SRR7169609.sra Read 838143 spots for SRR7169609.sra Written 838143 spots for SRR7169609.sra Read 838143 spots for SRR7169609.sra Written 838143 spots for SRR7169609.sra Read 838143 spots for SRR7169609.sra Written 838143 spots for SRR7169609.sra Read 838143 spots for SRR7169609.sra Written 838143 spots for SRR7169609.sra Read 838143 spots for SRR7169609.sra Written 838143 spots for SRR7169609.sra SRR ids: ['SRR7169609.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g0o4qeva SRR7169609.sra spots: 16762872 blocks: [[1, 838143], [838144, 1676286], [1676287, 2514429], [2514430, 3352572], [3352573, 4190715], [4190716, 5028858], [5028859, 5867001], [5867002, 6705144], [6705145, 7543287], [7543288, 8381430], [8381431, 9219573], [9219574, 10057716], [10057717, 10895859], [10895860, 11734002], [11734003, 12572145], [12572146, 13410288], [13410289, 14248431], [14248432, 15086574], [15086575, 15924717], [15924718, 16762872]] SRR7169609 file size 5658686 SRR7169609 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169609 SRR7169609_1.fastq SRR7169609_2.fastq Input file: SRR7169609_1.fastq Paired file: SRR7169609_2.fastq trimmed: SRR7169609-trimmed-pair1.fastq, SRR7169609-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:14:07 2025 >> started Tue Feb 11 10:14:26 2025 >> done (19.552s) 16762872 read pairs processed; of these: 39985 ( 0.24%) short read pairs filtered out after trimming by size control 180947 ( 1.08%) empty read pairs filtered out after trimming by size control 16541940 (98.68%) read pairs available; of these: 9043080 (54.67%) trimmed read pairs available after processing 7498860 (45.33%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 7 0.00% 20 7 0.00% 21 11 0.00% 22 16 0.00% 23 10 0.00% 24 7 0.00% 25 16 0.00% 26 13 0.00% 27 20 0.00% 28 18 0.00% 29 20 0.00% 30 20 0.00% 31 23 0.00% 32 29 0.00% 33 28 0.00% 34 23 0.00% 35 33 0.00% 36 32 0.00% 37 38 0.00% 38 41 0.00% 39 43 0.00% 40 50 0.00% 41 59 0.00% 42 73 0.00% 43 70 0.00% 44 78 0.00% 45 115 0.00% 46 115 0.00% 47 121 0.00% 48 153 0.00% 49 184 0.00% 50 266 0.00% 51 303 0.00% 52 334 0.00% 53 336 0.00% 54 293 0.00% 55 340 0.00% 56 373 0.00% 57 435 0.00% 58 466 0.00% 59 455 0.00% 60 508 0.00% 61 528 0.00% 62 692 0.00% 63 777 0.00% 64 863 0.01% 65 1044 0.01% 66 1715 0.01% 67 2561 0.02% 68 2728 0.02% 69 4646 0.03% 70 9961 0.06% 71 6102 0.04% 72 4051 0.02% 73 3258 0.02% 74 3069 0.02% 75 3253 0.02% 76 3374 0.02% 77 3590 0.02% 78 4036 0.02% 79 4208 0.03% 80 4702 0.03% 81 5458 0.03% 82 6125 0.04% 83 6992 0.04% 84 8988 0.05% 85 10669 0.06% 86 11517 0.07% 87 12352 0.07% 88 13988 0.08% 89 15076 0.09% 90 15780 0.10% 91 15892 0.10% 92 16752 0.10% 93 18099 0.11% 94 19028 0.12% 95 21006 0.13% 96 22045 0.13% 97 23172 0.14% 98 23502 0.14% 99 23503 0.14% 100 25775 0.16% 101 26460 0.16% 102 28178 0.17% 103 29863 0.18% 104 30942 0.19% 105 33122 0.20% 106 34234 0.21% 107 35157 0.21% 108 36005 0.22% 109 37600 0.23% 110 39037 0.24% 111 40335 0.24% 112 42220 0.26% 113 45186 0.27% 114 45890 0.28% 115 48647 0.29% 116 50507 0.31% 117 51686 0.31% 118 52192 0.32% 119 52893 0.32% 120 54473 0.33% 121 55338 0.33% 122 57203 0.35% 123 60644 0.37% 124 62604 0.38% 125 64478 0.39% 126 66340 0.40% 127 68913 0.42% 128 70912 0.43% 129 72282 0.44% 130 75416 0.46% 131 76504 0.46% 132 79562 0.48% 133 82752 0.50% 134 87105 0.53% 135 92295 0.56% 136 95073 0.57% 137 100355 0.61% 138 105120 0.64% 139 109810 0.66% 140 115481 0.70% 141 122721 0.74% 142 133578 0.81% 143 147635 0.89% 144 163320 0.99% 145 187618 1.13% 146 225922 1.37% 147 298746 1.81% 148 439598 2.66% 149 855011 5.17% 150 3669651 22.18% 151 7498860 45.33% 16541940 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=34 prefix-density=0.16 prefix-fanout=2.2 sequence=CTCTAAGAGAGTTGACCACAGTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=14 fanout-score=275.76 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=28.9 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=3.73 fanout-score-rank=31 prefix-density=0.80 prefix-fanout=2.8 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.09 sequence-density-rank=18 fanout-score=292.79 fanout-score-rank=1 prefix-density=1.04 prefix-fanout=26.4 sequence=AAGAAGAAGAAG SRR7169609 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:15:13 Started mapping on | Feb 11 10:15:14 Finished on | Feb 11 10:18:08 Mapping speed, Million of reads per hour | 342.25 Number of input reads | 16541940 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 14654115 Uniquely mapped reads % | 88.59% Average mapped length | 290.21 Number of splices: Total | 11737243 Number of splices: Annotated (sjdb) | 11454943 Number of splices: GT/AG | 11525702 Number of splices: GC/AG | 163155 Number of splices: AT/AC | 12054 Number of splices: Non-canonical | 36332 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.03% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 297767 % of reads mapped to multiple loci | 1.80% Number of reads mapped to too many loci | 56600 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.14% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1614945 1614945 1614945 N_multimapping 297767 297767 297767 N_noFeature 481338 14449924 591071 N_ambiguous 156149 1267 61327 UnstrandedReadsAssigned:14016628 PositiveStrandReadsAssigned:202924 NegativeStrandReadsAssigned:14001717 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=144 echo kmer=139 SRR7169609 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169609-trimmed-pair1.fastq SRR7169609-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,541,940 reads, 14,034,637 reads pseudoaligned [quant] estimated average fragment length: 217.263 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,165 rounds 52401 SRR7169609.ke.tsv 34699 SRR7169609.se.tsv 87100 total ==> SRR7169609.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1801.74 270 9.00612 Potri.005G024800.1.v4.1 1035 818.737 117 8.58829 Potri.004G059700.1.v4.1 961 744.741 18 1.45255 Potri.007G009000.2.v4.1 1416 1199.74 0 0 Potri.003G141000.2.v4.1 2943 2726.74 228 5.02524 Potri.016G087400.1.v4.1 270 87.8459 1541.46 1054.57 Potri.015G069301.1.v4.1 564 349.648 0 0 Potri.010G195200.1.v4.1 1773 1556.74 71 2.741 Potri.012G127500.1.v4.1 977 760.737 18526 1463.57 ==> SRR7169609.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 318 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 706 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 10 SRR7169609 completed mapping pipeline successfully