Starting /dee2/code/volunteer_pipeline.sh SRR7169610 current disk space = 3055112065024 free memory = 1412599660 SRR7169610 SRAfilesize 537748adddb17ea9bde6b24829a24244 SRR7169610.sra SRR7169610.sra file validated SRR7169610 is paired end SRR7169610 is conventional basespace SRR7169610 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169610_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0255 34.0 33.0 34.0 33.0 34.0 2 33.386 34.0 34.0 34.0 33.0 34.0 3 33.41675 34.0 34.0 34.0 33.0 34.0 4 33.4545 34.0 34.0 34.0 33.0 34.0 5 33.4945 34.0 34.0 34.0 33.0 34.0 6 37.08075 38.0 37.0 38.0 36.0 38.0 7 37.29625 38.0 38.0 38.0 37.0 38.0 8 37.04875 38.0 38.0 38.0 36.0 38.0 9 37.42325 38.0 38.0 38.0 37.0 38.0 10-14 37.4639 38.0 38.0 38.0 37.2 38.0 15-19 37.459199999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.47355 38.0 38.0 38.0 37.6 38.0 25-29 37.42765000000001 38.0 38.0 38.0 37.0 38.0 30-34 37.45694999999999 38.0 38.0 38.0 37.4 38.0 35-39 37.314 38.0 38.0 38.0 36.8 38.0 40-44 37.219550000000005 38.0 38.0 38.0 36.6 38.0 45-49 37.19905 38.0 38.0 38.0 37.0 38.0 50-54 37.234199999999994 38.0 38.0 38.0 36.8 38.0 55-59 37.169650000000004 38.0 38.0 38.0 36.6 38.0 60-64 37.13695 38.0 38.0 38.0 36.2 38.0 65-69 37.07285 38.0 38.0 38.0 36.0 38.0 70-74 36.9677 38.0 38.0 38.0 36.0 38.0 75-79 36.71355 38.0 38.0 38.0 35.6 38.0 80-84 36.665749999999996 38.0 38.0 38.0 35.2 38.0 85-89 36.599849999999996 38.0 38.0 38.0 35.0 38.0 90-94 36.5011 38.0 38.0 38.0 34.4 38.0 95-99 36.37915 38.0 38.0 38.0 34.0 38.0 100-104 36.3102 38.0 38.0 38.0 34.0 38.0 105-109 36.0955 38.0 38.0 38.0 33.8 38.0 110-114 36.0001 38.0 38.0 38.0 33.6 38.0 115-119 35.862649999999995 38.0 37.6 38.0 33.0 38.0 120-124 35.61685000000001 38.0 37.2 38.0 31.4 38.0 125-129 35.558899999999994 38.0 36.8 38.0 31.4 38.0 130-134 35.24405 38.0 36.0 38.0 30.6 38.0 135-139 34.978750000000005 38.0 36.0 38.0 29.6 38.0 140-144 34.443799999999996 38.0 35.2 38.0 26.6 38.0 145-149 33.830650000000006 38.0 35.0 38.0 22.6 38.0 150-151 30.363125 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 2.0 12 0.0 13 2.0 14 3.0 15 2.0 16 0.0 17 7.0 18 14.0 19 15.0 20 5.0 21 8.0 22 7.0 23 6.0 24 8.0 25 8.0 26 18.0 27 26.0 28 20.0 29 22.0 30 34.0 31 55.0 32 74.0 33 88.0 34 145.0 35 208.0 36 528.0 37 2694.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.58151345860843 13.255459624174708 8.024377856780092 33.13864906043677 2 24.55 13.850000000000001 30.95 30.65 3 20.775 17.2 25.474999999999998 36.55 4 22.0 24.15 23.3 30.55 5 24.275 28.549999999999997 23.45 23.724999999999998 6 21.725 32.375 24.65 21.25 7 15.525 28.000000000000004 39.2 17.275 8 18.525 27.725 29.65 24.099999999999998 9 17.675 25.8 33.2 23.325000000000003 10-14 19.96 30.345 26.484999999999996 23.21 15-19 19.945 28.255000000000003 27.474999999999998 24.325 20-24 20.215 28.294999999999998 27.355 24.135 25-29 20.19 28.64 27.015 24.154999999999998 30-34 19.52 28.444999999999997 27.839999999999996 24.195 35-39 20.415 27.83 27.425 24.33 40-44 19.86 29.01 27.189999999999998 23.94 45-49 20.93 27.47 27.235 24.365000000000002 50-54 20.57 28.185 27.105 24.14 55-59 20.349999999999998 28.65 26.810000000000002 24.19 60-64 20.335 28.860000000000003 26.955000000000002 23.849999999999998 65-69 20.19 28.53 27.345000000000002 23.935000000000002 70-74 19.895 29.134999999999998 26.924999999999997 24.044999999999998 75-79 20.715 28.335 26.63 24.32 80-84 20.65 28.285 27.315 23.75 85-89 20.51 28.74 26.61 24.14 90-94 20.195 28.255000000000003 26.715 24.834999999999997 95-99 20.76 28.28 26.419999999999998 24.54 100-104 20.255000000000003 28.444999999999997 26.93 24.37 105-109 20.766038301915096 28.021401070053503 27.04135206760338 24.17120856042802 110-114 20.275000000000002 27.839999999999996 27.175 24.709999999999997 115-119 20.585 28.02 27.155 24.240000000000002 120-124 20.84 28.405 26.41 24.345 125-129 21.07 28.37 26.72 23.84 130-134 21.245 27.405 26.68 24.67 135-139 21.07 27.694999999999997 26.715 24.52 140-144 20.585 27.875 26.38 25.16 145-149 20.335 27.894999999999996 26.419999999999998 25.35 150-151 21.2375 27.325 26.137500000000003 25.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 4.5 25 4.5 26 3.5 27 5.0 28 6.5 29 11.0 30 18.5 31 24.0 32 30.0 33 38.0 34 46.5 35 57.5 36 63.0 37 83.5 38 119.0 39 141.0 40 148.5 41 180.5 42 234.0 43 262.5 44 264.5 45 260.0 46 261.5 47 255.0 48 249.5 49 222.5 50 192.0 51 168.5 52 143.0 53 123.5 54 98.5 55 73.0 56 53.5 57 45.0 58 31.0 59 19.5 60 13.5 61 10.0 62 9.5 63 7.5 64 4.5 65 4.0 66 2.5 67 1.0 68 0.5 69 1.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.55 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.005 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.41772151898735 98.175 2 0.5316455696202532 1.05 3 0.025316455696202535 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025316455696202535 0.7000000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCTCCAATCTCGTATGC 28 0.7000000000000001 TruSeq Adapter, Index 9 (97% over 37bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.07500000000000001 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.675 0.0 0.0 0.0 0.0 94-95 0.8875 0.0 0.0 0.0 0.0 96-97 1.1 0.0 0.0 0.0 0.0 98-99 1.2625 0.0 0.0 0.0 0.0 100-101 1.5 0.0 0.0 0.0 0.0 102-103 1.75 0.0 0.0 0.0 0.0 104-105 1.9625 0.0 0.0 0.0 0.0 106-107 2.3 0.0 0.0 0.0 0.0 108-109 2.45 0.0 0.0 0.0 0.0 110-111 2.7750000000000004 0.0 0.0 0.0 0.0 112-113 3.2375 0.0 0.0 0.0 0.0 114-115 3.6375 0.0 0.0 0.0 0.0 116-117 4.1875 0.0 0.0 0.0 0.0 118-119 4.550000000000001 0.0 0.0 0.0 0.0 120-121 5.025 0.0 0.0 0.0 0.0 122-123 5.35 0.0 0.0 0.0 0.0 124-125 5.6375 0.0 0.0 0.0 0.0 126-127 6.074999999999999 0.0 0.0 0.0 0.0 128-129 6.575 0.0 0.0 0.0 0.0 130-131 7.0875 0.0 0.0 0.0 0.0 132-133 7.6 0.0 0.0 0.0 0.0 134-135 8.05 0.0 0.0 0.0 0.0 136-137 8.475 0.0 0.0 0.0 0.0 138-139 9.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169610 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169610_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.835 33.0 33.0 34.0 32.0 34.0 2 32.97225 34.0 33.0 34.0 32.0 34.0 3 32.99425 34.0 33.0 34.0 32.0 34.0 4 33.04575 34.0 33.0 34.0 32.0 34.0 5 33.023 34.0 33.0 34.0 33.0 34.0 6 37.139 38.0 38.0 38.0 37.0 38.0 7 37.22575 38.0 38.0 38.0 37.0 38.0 8 37.19825 38.0 38.0 38.0 37.0 38.0 9 37.10175 38.0 38.0 38.0 37.0 38.0 10-14 37.071799999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.0747 38.0 38.0 38.0 37.0 38.0 20-24 37.021049999999995 38.0 38.0 38.0 37.0 38.0 25-29 36.8715 38.0 38.0 38.0 36.4 38.0 30-34 36.868649999999995 38.0 38.0 38.0 36.0 38.0 35-39 36.8727 38.0 38.0 38.0 36.0 38.0 40-44 36.96085 38.0 38.0 38.0 36.6 38.0 45-49 36.961349999999996 38.0 38.0 38.0 36.2 38.0 50-54 36.916700000000006 38.0 38.0 38.0 36.2 38.0 55-59 36.85875 38.0 38.0 38.0 36.2 38.0 60-64 36.88525 38.0 38.0 38.0 36.0 38.0 65-69 36.73315 38.0 38.0 38.0 36.0 38.0 70-74 36.514799999999994 38.0 38.0 38.0 35.6 38.0 75-79 36.3424 38.0 38.0 38.0 34.8 38.0 80-84 36.286249999999995 38.0 38.0 38.0 34.4 38.0 85-89 36.17115 38.0 38.0 38.0 34.0 38.0 90-94 36.14905 38.0 38.0 38.0 34.0 38.0 95-99 36.108999999999995 38.0 38.0 38.0 34.0 38.0 100-104 35.964349999999996 38.0 38.0 38.0 33.4 38.0 105-109 35.90755 38.0 38.0 38.0 33.6 38.0 110-114 35.64085000000001 38.0 37.4 38.0 32.2 38.0 115-119 35.52195 38.0 37.2 38.0 31.8 38.0 120-124 35.255199999999995 38.0 37.0 38.0 30.6 38.0 125-129 34.94845 38.0 36.0 38.0 28.0 38.0 130-134 34.672850000000004 38.0 36.0 38.0 27.6 38.0 135-139 34.286899999999996 38.0 35.2 38.0 24.4 38.0 140-144 33.52835 38.0 33.8 38.0 21.0 38.0 145-149 32.69575 38.0 33.0 38.0 10.8 38.0 150-151 27.968875 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 4.0 4 1.0 5 2.0 6 2.0 7 1.0 8 1.0 9 3.0 10 3.0 11 1.0 12 1.0 13 1.0 14 1.0 15 5.0 16 9.0 17 21.0 18 7.0 19 6.0 20 4.0 21 5.0 22 12.0 23 7.0 24 8.0 25 19.0 26 18.0 27 33.0 28 31.0 29 26.0 30 54.0 31 62.0 32 78.0 33 109.0 34 126.0 35 235.0 36 551.0 37 2540.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.18377566349524 23.510265398097147 11.392088132198296 25.913870806209317 2 26.84026039058588 28.16725087631447 27.766649974962444 17.225838758137204 3 22.088655146506387 27.773603806661658 30.202854996243428 19.93488605058853 4 23.39093413473579 35.21162033558728 22.96518908089156 18.432256448785374 5 25.363044566850274 34.852278417626444 22.483725588382576 17.300951427140713 6 22.539444027047335 36.63911845730027 23.165539694465316 17.65589782118708 7 20.63611319809667 22.814926120711245 37.34034560480842 19.208615076383673 8 22.383575363044567 26.489734601902853 26.53980971457186 24.586880320480724 9 21.457185778668002 24.912368552829246 29.44416624937406 24.18627941912869 10-14 24.03085244916358 28.573575077631975 25.663628167885406 21.731944305319043 15-19 24.291295201843134 27.7822297906441 26.735450265451266 21.191024742061504 20-24 24.701993388760894 27.737153160372635 26.94580787338475 20.61504557748172 25-29 24.032872319102026 27.70595309681299 27.099619162156745 21.16155542192824 30-34 23.95311560809457 27.825085153275896 27.038669605289524 21.183129633340013 35-39 24.182319058352117 27.833708990733786 26.751815677435513 21.232156273478587 40-44 24.480288533787505 27.2804688674047 27.480839553173368 20.758403045634424 45-49 24.045877992587396 27.576880697185214 27.071020735249924 21.30622057497746 50-54 24.32621981765354 27.291854523594832 27.1816451257389 21.200280533012723 55-59 24.194760306567147 27.53093222461554 27.42072834744277 20.853579121374544 60-64 23.479915856956826 28.67374536712411 27.196233597115093 20.65010517880397 65-69 24.040677286845007 28.133453561767357 27.236749824666866 20.58911932672077 70-74 24.467712038475025 27.51365162066029 27.333299934873 20.685336405991684 75-79 24.222389181066866 27.427998998246935 27.573253193087904 20.776358627598295 80-84 24.299954916595702 28.006812603316135 27.2203576616741 20.472874818414066 85-89 25.04384426517012 27.579295485293382 27.243573683419353 20.13328656611715 90-94 24.583020285499625 27.342849987478086 27.553218131730528 20.52091159529176 95-99 24.33488651736059 27.852096798436794 27.451275113983662 20.36174157021895 100-104 24.0686961746445 28.009212898057278 26.74744642499499 21.174644502303224 105-109 24.30781555099384 28.002803785109897 27.02648575577029 20.66289490812597 110-114 24.39891805249449 28.255860548988178 27.098777800040075 20.24644359847726 115-119 25.202844836221576 28.398277071020733 26.344786136431935 20.054091956325752 120-124 24.331229335737902 27.968139464983473 27.38202584911332 20.318605350165313 125-129 24.847148441415253 27.608499548962612 27.142427583441915 20.401924426180216 130-134 25.17790919113962 27.257692693194347 27.227623534128497 20.336774581537536 135-139 25.5550543777878 27.970731218363156 26.437127249035232 20.03708715481381 140-144 25.42075736325386 27.629733520336607 26.983570426768182 19.965938689641355 145-149 25.679939894815927 27.528174305033808 26.982218883045327 19.809666917104934 150-151 26.229508196721312 27.330747090476788 26.379677136778877 20.060067576023023 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 6.0 1 3.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.5 25 1.5 26 3.0 27 4.0 28 3.0 29 5.0 30 7.0 31 9.0 32 13.0 33 18.0 34 22.5 35 36.0 36 51.0 37 77.5 38 123.0 39 151.5 40 170.5 41 199.5 42 237.5 43 275.0 44 291.5 45 303.0 46 304.5 47 273.5 48 243.0 49 219.0 50 203.0 51 180.0 52 140.0 53 106.5 54 78.5 55 58.0 56 48.0 57 36.5 58 25.5 59 21.5 60 15.5 61 10.0 62 5.0 63 4.0 64 4.0 65 2.5 66 2.5 67 2.5 68 2.0 69 0.5 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.15 3 0.17500000000000002 4 0.17500000000000002 5 0.15 6 0.17500000000000002 7 0.17500000000000002 8 0.15 9 0.15 10-14 0.16999999999999998 15-19 0.16999999999999998 20-24 0.16999999999999998 25-29 0.22 30-34 0.18 35-39 0.17500000000000002 40-44 0.185 45-49 0.16999999999999998 50-54 0.19 55-59 0.185 60-64 0.16999999999999998 65-69 0.19 70-74 0.19499999999999998 75-79 0.17500000000000002 80-84 0.185 85-89 0.215 90-94 0.17500000000000002 95-99 0.20500000000000002 100-104 0.13999999999999999 105-109 0.135 110-114 0.18 115-119 0.16999999999999998 120-124 0.19 125-129 0.22999999999999998 130-134 0.22999999999999998 135-139 0.23500000000000001 140-144 0.18 145-149 0.17500000000000002 150-151 0.11249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.46768060836501 98.1 2 0.4055766793409379 0.8 3 0.050697084917617236 0.15 4 0.025348542458808618 0.1 5 0.0 0.0 6 0.025348542458808618 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025348542458808618 0.7000000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 28 0.7000000000000001 Illumina Single End PCR Primer 1 (100% over 50bp) NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.07500000000000001 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.675 0.0 0.0 0.0 0.0 94-95 0.8875 0.0 0.0 0.0 0.0 96-97 1.0875 0.0 0.0 0.0 0.0 98-99 1.275 0.0 0.0 0.0 0.0 100-101 1.5375 0.0 0.0 0.0 0.0 102-103 1.7875 0.0 0.0 0.0 0.0 104-105 1.9875 0.0 0.0 0.0 0.0 106-107 2.3125 0.0 0.0 0.0 0.0 108-109 2.45 0.0 0.0 0.0 0.0 110-111 2.7750000000000004 0.0 0.0 0.0 0.0 112-113 3.2375 0.0 0.0 0.0 0.0 114-115 3.6375 0.0 0.0 0.0 0.0 116-117 4.1625 0.0 0.0 0.0 0.0 118-119 4.512499999999999 0.0 0.0 0.0 0.0 120-121 5.012499999999999 0.0 0.0 0.0 0.0 122-123 5.3375 0.0 0.0 0.0 0.0 124-125 5.6125 0.0 0.0 0.0 0.0 126-127 6.025 0.0 0.0 0.0 0.0 128-129 6.5375 0.0 0.0 0.0 0.0 130-131 7.0375 0.0 0.0 0.0 0.0 132-133 7.6 0.0 0.0 0.0 0.0 134-135 8.0375 0.0 0.0 0.0 0.0 136-137 8.475 0.0 0.0 0.0 0.0 138-139 9.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGAGCC 10 0.006830828 145.0 7 >>END_MODULE Read 1323881 spots for SRR7169610.sra Written 1323881 spots for SRR7169610.sra Read 1323881 spots for SRR7169610.sra Written 1323881 spots for SRR7169610.sra Read 1323881 spots for SRR7169610.sra Written 1323881 spots for SRR7169610.sra Read 1323881 spots for SRR7169610.sra Written 1323881 spots for SRR7169610.sra Read 1323881 spots for SRR7169610.sra Written 1323881 spots for SRR7169610.sra Read 1323881 spots for SRR7169610.sra Written 1323881 spots for SRR7169610.sra Read 1323881 spots for SRR7169610.sra Written 1323881 spots for SRR7169610.sra Read 1323881 spots for SRR7169610.sra Written 1323881 spots for SRR7169610.sra Read 1323881 spots for SRR7169610.sra Written 1323881 spots for SRR7169610.sra Read 1323881 spots for SRR7169610.sra Written 1323881 spots for SRR7169610.sra Read 1323897 spots for SRR7169610.sra Written 1323897 spots for SRR7169610.sra Read 1323881 spots for SRR7169610.sra Written 1323881 spots for SRR7169610.sra Read 1323881 spots for SRR7169610.sra Written 1323881 spots for SRR7169610.sra Read 1323881 spots for SRR7169610.sra Written 1323881 spots for SRR7169610.sra Read 1323881 spots for SRR7169610.sra Written 1323881 spots for SRR7169610.sra Read 1323881 spots for SRR7169610.sra Written 1323881 spots for SRR7169610.sra Read 1323881 spots for SRR7169610.sra Written 1323881 spots for SRR7169610.sra Read 1323881 spots for SRR7169610.sra Written 1323881 spots for SRR7169610.sra Read 1323881 spots for SRR7169610.sra Written 1323881 spots for SRR7169610.sra Read 1323881 spots for SRR7169610.sra Written 1323881 spots for SRR7169610.sra SRR ids: ['SRR7169610.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_raxe_p9j SRR7169610.sra spots: 26477636 blocks: [[1, 1323881], [1323882, 2647762], [2647763, 3971643], [3971644, 5295524], [5295525, 6619405], [6619406, 7943286], [7943287, 9267167], [9267168, 10591048], [10591049, 11914929], [11914930, 13238810], [13238811, 14562691], [14562692, 15886572], [15886573, 17210453], [17210454, 18534334], [18534335, 19858215], [19858216, 21182096], [21182097, 22505977], [22505978, 23829858], [23829859, 25153739], [25153740, 26477636]] SRR7169610 file size 8950701 SRR7169610 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169610 SRR7169610_1.fastq SRR7169610_2.fastq Input file: SRR7169610_1.fastq Paired file: SRR7169610_2.fastq trimmed: SRR7169610-trimmed-pair1.fastq, SRR7169610-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:21:58 2025 >> started Tue Feb 11 09:22:43 2025 >> done (45.345s) 26477636 read pairs processed; of these: 37331 ( 0.14%) short read pairs filtered out after trimming by size control 239258 ( 0.90%) empty read pairs filtered out after trimming by size control 26201047 (98.96%) read pairs available; of these: 13063319 (49.86%) trimmed read pairs available after processing 13137728 (50.14%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 21 0.00% 19 50 0.00% 20 27 0.00% 21 28 0.00% 22 38 0.00% 23 21 0.00% 24 373 0.00% 25 40 0.00% 26 33 0.00% 27 36 0.00% 28 55 0.00% 29 39 0.00% 30 45 0.00% 31 58 0.00% 32 49 0.00% 33 49 0.00% 34 65 0.00% 35 58 0.00% 36 48 0.00% 37 78 0.00% 38 76 0.00% 39 102 0.00% 40 105 0.00% 41 124 0.00% 42 115 0.00% 43 124 0.00% 44 170 0.00% 45 382 0.00% 46 214 0.00% 47 228 0.00% 48 234 0.00% 49 310 0.00% 50 396 0.00% 51 414 0.00% 52 450 0.00% 53 450 0.00% 54 487 0.00% 55 580 0.00% 56 625 0.00% 57 653 0.00% 58 864 0.00% 59 945 0.00% 60 1057 0.00% 61 1109 0.00% 62 1180 0.00% 63 1330 0.01% 64 1605 0.01% 65 1822 0.01% 66 2230 0.01% 67 3399 0.01% 68 6676 0.03% 69 13819 0.05% 70 9879 0.04% 71 5037 0.02% 72 4023 0.02% 73 4281 0.02% 74 4460 0.02% 75 4855 0.02% 76 5034 0.02% 77 5544 0.02% 78 6000 0.02% 79 6577 0.03% 80 7356 0.03% 81 8242 0.03% 82 9364 0.04% 83 10539 0.04% 84 12695 0.05% 85 14499 0.06% 86 15226 0.06% 87 16454 0.06% 88 17327 0.07% 89 18374 0.07% 90 19314 0.07% 91 20753 0.08% 92 21558 0.08% 93 23273 0.09% 94 24905 0.10% 95 27304 0.10% 96 28448 0.11% 97 29680 0.11% 98 30481 0.12% 99 30895 0.12% 100 32961 0.13% 101 34122 0.13% 102 36181 0.14% 103 37986 0.14% 104 39331 0.15% 105 42670 0.16% 106 44013 0.17% 107 44803 0.17% 108 45753 0.17% 109 47726 0.18% 110 48888 0.19% 111 50289 0.19% 112 51884 0.20% 113 55535 0.21% 114 56844 0.22% 115 59400 0.23% 116 61358 0.23% 117 63625 0.24% 118 64248 0.25% 119 65193 0.25% 120 67197 0.26% 121 68725 0.26% 122 70753 0.27% 123 73981 0.28% 124 77611 0.30% 125 80210 0.31% 126 83623 0.32% 127 86751 0.33% 128 89364 0.34% 129 92223 0.35% 130 95090 0.36% 131 98755 0.38% 132 103145 0.39% 133 108357 0.41% 134 113535 0.43% 135 120104 0.46% 136 126157 0.48% 137 133166 0.51% 138 140947 0.54% 139 150060 0.57% 140 157660 0.60% 141 170743 0.65% 142 184673 0.70% 143 202445 0.77% 144 231901 0.89% 145 267558 1.02% 146 320558 1.22% 147 422127 1.61% 148 626084 2.39% 149 1258929 4.80% 150 5772214 22.03% 151 13137728 50.14% 26201047 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=40 prefix-density=0.25 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=228.68 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=14.5 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGCTTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=43 prefix-density=0.27 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.15 sequence-density-rank=16 fanout-score=37.39 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=10.4 sequence=TGTTGGTGGTGGGACTGGAGCTGTCGTTAACACCATCGTCTCTAAATACCCTTCAATTAAGGGCATTAACTTTGATCTGCCCCACGTCATTGAGGATGCCCCATCTTATCCCGGTGTGGAGCATGTTGGTGGGGACATGTTTGTTAGCGTGCCCAAAGCAGATGCCGTTTTCATGAAGTGGATATGCCATGATTGGAGCGACGCACACTGCTTAAAATTCTTGAAGAATTGCTATGACGCCTTGCCGGAAAACGGCAAGGTGATACTTGTTGAGTGCATTCTTCCCGTGGCTCCTGACACAAGCCTTGCCACCAAGGGAGTCGTGCACATTGATGTTATCATGCTGGCGCACAACCCCGGTGGGAAAGAGAGGACCGAAAAGGAATTTGAGGGCTTAGCAAAGGGAGCTGGCTTTCAAGGTTTTGAAGTAATGTGCTGTGCATTCAACACACATGTCATTGAATTCCGCAAGAACTAAAGCTCAAGTCCAAGCTCCAAGTGACTTGGGGTT SRR7169610 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:23:37 Started mapping on | Feb 11 09:23:38 Finished on | Feb 11 09:27:23 Mapping speed, Million of reads per hour | 419.22 Number of input reads | 26201047 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 24886726 Uniquely mapped reads % | 94.98% Average mapped length | 291.80 Number of splices: Total | 22248977 Number of splices: Annotated (sjdb) | 21854882 Number of splices: GT/AG | 21937115 Number of splices: GC/AG | 246554 Number of splices: AT/AC | 19471 Number of splices: Non-canonical | 45837 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.02% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 436954 % of reads mapped to multiple loci | 1.67% Number of reads mapped to too many loci | 27894 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.20% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 902741 902741 902741 N_multimapping 436954 436954 436954 N_noFeature 520986 24521128 687882 N_ambiguous 300959 1885 100829 UnstrandedReadsAssigned:24064781 PositiveStrandReadsAssigned:363713 NegativeStrandReadsAssigned:24098015 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169610 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169610-trimmed-pair1.fastq SRR7169610-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,201,047 reads, 23,962,450 reads pseudoaligned [quant] estimated average fragment length: 227.589 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,135 rounds 52401 SRR7169610.ke.tsv 34699 SRR7169610.se.tsv 87100 total ==> SRR7169610.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.41 458 10.0347 Potri.005G024800.1.v4.1 1035 808.411 30 1.45654 Potri.004G059700.1.v4.1 961 734.443 4 0.213764 Potri.007G009000.2.v4.1 1416 1189.41 0 0 Potri.003G141000.2.v4.1 2943 2716.41 365.031 5.27432 Potri.016G087400.1.v4.1 270 85.2349 2705 1245.61 Potri.015G069301.1.v4.1 564 340.449 0 0 Potri.010G195200.1.v4.1 1773 1546.41 34 0.862951 Potri.012G127500.1.v4.1 977 750.43 8565 447.97 ==> SRR7169610.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2136 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 394 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 28 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 10 SRR7169610 completed mapping pipeline successfully