Starting /dee2/code/volunteer_pipeline.sh SRR7169611 current disk space = 3054303354880 free memory = 1133674012 SRR7169611 SRAfilesize 3f13b808c73aee78a375cd7520a66ef7 SRR7169611.sra SRR7169611.sra file validated SRR7169611 is paired end SRR7169611 is conventional basespace SRR7169611 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169611_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.06475 34.0 33.0 34.0 33.0 34.0 2 33.46325 34.0 34.0 34.0 33.0 34.0 3 33.48625 34.0 34.0 34.0 33.0 34.0 4 33.5175 34.0 34.0 34.0 33.0 34.0 5 33.53275 34.0 34.0 34.0 33.0 34.0 6 37.0645 38.0 38.0 38.0 36.0 38.0 7 37.35675 38.0 38.0 38.0 37.0 38.0 8 37.41775 38.0 38.0 38.0 37.0 38.0 9 37.45975 38.0 38.0 38.0 37.0 38.0 10-14 37.5209 38.0 38.0 38.0 37.2 38.0 15-19 37.455949999999994 38.0 38.0 38.0 37.0 38.0 20-24 37.4878 38.0 38.0 38.0 37.2 38.0 25-29 37.447700000000005 38.0 38.0 38.0 37.2 38.0 30-34 37.43595 38.0 38.0 38.0 37.0 38.0 35-39 37.17125 38.0 38.0 38.0 36.4 38.0 40-44 37.2048 38.0 38.0 38.0 36.6 38.0 45-49 37.142399999999995 38.0 38.0 38.0 36.2 38.0 50-54 37.1328 38.0 38.0 38.0 36.0 38.0 55-59 37.063599999999994 38.0 38.0 38.0 36.0 38.0 60-64 37.0538 38.0 38.0 38.0 36.0 38.0 65-69 36.986599999999996 38.0 38.0 38.0 36.0 38.0 70-74 36.9419 38.0 38.0 38.0 36.0 38.0 75-79 36.90695 38.0 38.0 38.0 36.0 38.0 80-84 36.8361 38.0 38.0 38.0 35.2 38.0 85-89 36.7814 38.0 38.0 38.0 35.0 38.0 90-94 36.692150000000005 38.0 38.0 38.0 34.4 38.0 95-99 36.532050000000005 38.0 38.0 38.0 34.2 38.0 100-104 36.365899999999996 38.0 38.0 38.0 34.0 38.0 105-109 36.324149999999996 38.0 38.0 38.0 34.0 38.0 110-114 36.07275 38.0 37.0 38.0 33.0 38.0 115-119 35.9319 38.0 37.0 38.0 32.8 38.0 120-124 35.83005 38.0 37.0 38.0 32.6 38.0 125-129 35.583800000000004 38.0 36.6 38.0 31.0 38.0 130-134 35.387249999999995 38.0 36.0 38.0 30.4 38.0 135-139 35.10945 38.0 36.0 38.0 29.2 38.0 140-144 34.7137 38.0 35.2 38.0 27.8 38.0 145-149 34.1173 38.0 35.0 38.0 25.0 38.0 150-151 31.139875 36.5 31.5 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 1.0 14 1.0 15 0.0 16 2.0 17 6.0 18 4.0 19 6.0 20 1.0 21 5.0 22 7.0 23 12.0 24 8.0 25 14.0 26 14.0 27 19.0 28 22.0 29 34.0 30 46.0 31 48.0 32 54.0 33 86.0 34 127.0 35 246.0 36 626.0 37 2608.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.63845958956169 12.997213073220168 9.779579427413225 36.58474790980492 2 24.425 14.399999999999999 31.4 29.775000000000002 3 20.4 17.675 25.974999999999998 35.949999999999996 4 22.675 25.75 23.05 28.525 5 23.775 29.025000000000002 23.799999999999997 23.400000000000002 6 19.375 34.449999999999996 24.825 21.349999999999998 7 13.975000000000001 28.349999999999998 40.150000000000006 17.525 8 18.05 27.025 29.9 25.025 9 16.375 25.25 33.6 24.775 10-14 19.725 29.785 27.175 23.315 15-19 20.29 27.93 27.839999999999996 23.94 20-24 19.715 29.349999999999998 26.97 23.965 25-29 19.77 28.804999999999996 27.855 23.57 30-34 19.965 28.715000000000003 26.950000000000003 24.37 35-39 20.489097819563913 28.165633126625323 27.030406081216242 24.31486297259452 40-44 19.77 28.67 27.395000000000003 24.165 45-49 20.515 28.37 27.36 23.755000000000003 50-54 19.919999999999998 28.615000000000002 27.500000000000004 23.965 55-59 20.665 28.449999999999996 27.265 23.62 60-64 20.46 28.57 26.840000000000003 24.13 65-69 20.25 28.175 27.37 24.205 70-74 19.68 28.605000000000004 27.79 23.925 75-79 20.575 28.46 26.855 24.11 80-84 20.244999999999997 28.125 26.965 24.665 85-89 20.474999999999998 27.96 27.500000000000004 24.065 90-94 20.365 28.065 27.284999999999997 24.285 95-99 20.28 27.63 27.694999999999997 24.395 100-104 20.64 28.15 27.21 24.0 105-109 20.775 27.85 27.029999999999998 24.345 110-114 20.669999999999998 28.139999999999997 27.18 24.01 115-119 20.38101905095255 28.366418320916047 27.36136806840342 23.891194559727985 120-124 20.57 27.905 27.345000000000002 24.18 125-129 20.875 28.025 27.21 23.89 130-134 20.9 27.500000000000004 27.200000000000003 24.4 135-139 21.015 28.26 26.82 23.905 140-144 21.04 28.335 26.26 24.365000000000002 145-149 20.955 27.860000000000003 27.355 23.830000000000002 150-151 20.875 28.075 26.0375 25.0125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 1.0 22 1.0 23 0.5 24 0.5 25 1.5 26 5.0 27 8.0 28 9.0 29 12.5 30 17.5 31 24.5 32 31.5 33 38.5 34 49.5 35 61.0 36 70.5 37 97.0 38 121.5 39 135.5 40 166.0 41 204.0 42 218.5 43 223.0 44 260.5 45 285.0 46 279.0 47 260.5 48 247.5 49 229.0 50 195.5 51 158.5 52 129.0 53 110.5 54 97.0 55 75.0 56 37.5 57 26.0 58 26.5 59 21.5 60 15.5 61 11.0 62 9.5 63 7.0 64 5.0 65 3.5 66 2.5 67 2.0 68 1.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.02 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52249308871576 99.0 2 0.42724302588590096 0.8500000000000001 3 0.050263885398341285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.025 0.0 0.0 0.0 3 0.0 0.025 0.0 0.0 0.0 4 0.0 0.025 0.0 0.0 0.0 5 0.0 0.025 0.0 0.0 0.0 6 0.0 0.025 0.0 0.0 0.0 7 0.0 0.025 0.0 0.0 0.0 8 0.0 0.025 0.0 0.0 0.0 9 0.0 0.025 0.0 0.0 0.0 10-11 0.0 0.025 0.0 0.0 0.0 12-13 0.0 0.025 0.0 0.0 0.0 14-15 0.0 0.025 0.0 0.0 0.0 16-17 0.0 0.025 0.0 0.0 0.0 18-19 0.0 0.025 0.0 0.0 0.0 20-21 0.0 0.025 0.0 0.0 0.0 22-23 0.0 0.025 0.0 0.0 0.0 24-25 0.0 0.025 0.0 0.0 0.0 26-27 0.0 0.025 0.0 0.0 0.0 28-29 0.0 0.025 0.0 0.0 0.0 30-31 0.0 0.025 0.0 0.0 0.0 32-33 0.0 0.025 0.0 0.0 0.0 34-35 0.0 0.025 0.0 0.0 0.0 36-37 0.0 0.025 0.0 0.0 0.0 38-39 0.0 0.025 0.0 0.0 0.0 40-41 0.0 0.025 0.0 0.0 0.0 42-43 0.0 0.025 0.0 0.0 0.0 44-45 0.0 0.025 0.0 0.0 0.0 46-47 0.0 0.025 0.0 0.0 0.0 48-49 0.0 0.025 0.0 0.0 0.0 50-51 0.0 0.025 0.0 0.0 0.0 52-53 0.0 0.025 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.0 0.025 0.0 0.0 0.0 68-69 0.0 0.025 0.0 0.0 0.0 70-71 0.0 0.025 0.0 0.0 0.0 72-73 0.0 0.025 0.0 0.0 0.0 74-75 0.0 0.025 0.0 0.0 0.0 76-77 0.0 0.025 0.0 0.0 0.0 78-79 0.05 0.025 0.0 0.0 0.0 80-81 0.0625 0.025 0.0 0.0 0.0 82-83 0.075 0.025 0.0 0.0 0.0 84-85 0.075 0.025 0.0 0.0 0.0 86-87 0.075 0.025 0.0 0.0125 0.0 88-89 0.1375 0.025 0.0 0.025 0.0 90-91 0.225 0.025 0.0 0.025 0.0 92-93 0.25 0.025 0.0 0.025 0.0 94-95 0.375 0.025 0.0 0.025 0.0 96-97 0.44999999999999996 0.025 0.0 0.025 0.0 98-99 0.5375 0.025 0.0 0.025 0.0 100-101 0.7125 0.025 0.0 0.025 0.0 102-103 0.8875 0.025 0.0 0.025 0.0 104-105 1.025 0.025 0.0 0.025 0.0 106-107 1.1625 0.025 0.0 0.025 0.0 108-109 1.3250000000000002 0.025 0.0 0.025 0.0 110-111 1.3875000000000002 0.025 0.0 0.025 0.0 112-113 1.725 0.025 0.0 0.025 0.0 114-115 1.8875000000000002 0.025 0.0 0.025 0.0 116-117 2.0375 0.025 0.0 0.025 0.0 118-119 2.2625 0.025 0.0 0.025 0.0 120-121 2.4625 0.025 0.0 0.025 0.0 122-123 2.6375 0.025 0.0 0.025 0.0 124-125 3.125 0.025 0.0 0.025 0.0 126-127 3.5 0.025 0.0 0.025 0.0 128-129 3.9250000000000003 0.025 0.0 0.025 0.0 130-131 4.175 0.025 0.0 0.025 0.0 132-133 4.449999999999999 0.025 0.0 0.025 0.0 134-135 4.9 0.025 0.0 0.025 0.0 136-137 5.3625 0.025 0.0 0.025 0.0 138-139 5.8375 0.025 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169611 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169611_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.98 33.0 33.0 34.0 32.0 34.0 2 33.0695 34.0 33.0 34.0 32.0 34.0 3 33.105 34.0 33.0 34.0 33.0 34.0 4 33.108 34.0 33.0 34.0 33.0 34.0 5 33.018 34.0 33.0 34.0 33.0 34.0 6 37.17275 38.0 38.0 38.0 37.0 38.0 7 37.2135 38.0 38.0 38.0 37.0 38.0 8 37.16025 38.0 38.0 38.0 37.0 38.0 9 37.216 38.0 38.0 38.0 37.0 38.0 10-14 37.1341 38.0 38.0 38.0 37.0 38.0 15-19 37.13164999999999 38.0 38.0 38.0 37.0 38.0 20-24 37.07770000000001 38.0 38.0 38.0 37.0 38.0 25-29 37.066100000000006 38.0 38.0 38.0 37.0 38.0 30-34 37.0279 38.0 38.0 38.0 37.0 38.0 35-39 37.013999999999996 38.0 38.0 38.0 37.0 38.0 40-44 37.01845 38.0 38.0 38.0 37.0 38.0 45-49 37.0621 38.0 38.0 38.0 37.0 38.0 50-54 37.068799999999996 38.0 38.0 38.0 37.0 38.0 55-59 36.765750000000004 38.0 38.0 38.0 36.0 38.0 60-64 36.948249999999994 38.0 38.0 38.0 36.2 38.0 65-69 36.9043 38.0 38.0 38.0 36.0 38.0 70-74 36.86559999999999 38.0 38.0 38.0 36.0 38.0 75-79 36.83165 38.0 38.0 38.0 36.0 38.0 80-84 36.6676 38.0 38.0 38.0 35.2 38.0 85-89 36.57905000000001 38.0 38.0 38.0 35.0 38.0 90-94 36.55844999999999 38.0 38.0 38.0 35.0 38.0 95-99 36.57215 38.0 38.0 38.0 35.0 38.0 100-104 36.4613 38.0 38.0 38.0 34.4 38.0 105-109 36.32355 38.0 38.0 38.0 34.0 38.0 110-114 36.257850000000005 38.0 38.0 38.0 34.0 38.0 115-119 36.06849999999999 38.0 38.0 38.0 34.0 38.0 120-124 35.8001 38.0 37.8 38.0 33.0 38.0 125-129 35.596700000000006 38.0 37.0 38.0 32.0 38.0 130-134 35.4313 38.0 36.6 38.0 31.0 38.0 135-139 35.1261 38.0 36.0 38.0 30.6 38.0 140-144 34.62949999999999 38.0 35.6 38.0 27.6 38.0 145-149 34.15675 38.0 35.4 38.0 25.4 38.0 150-151 30.456000000000003 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 11.0 4 2.0 5 1.0 6 0.0 7 1.0 8 0.0 9 1.0 10 1.0 11 3.0 12 0.0 13 0.0 14 4.0 15 4.0 16 4.0 17 7.0 18 3.0 19 5.0 20 3.0 21 6.0 22 7.0 23 6.0 24 18.0 25 21.0 26 13.0 27 19.0 28 31.0 29 34.0 30 48.0 31 39.0 32 44.0 33 64.0 34 96.0 35 186.0 36 485.0 37 2828.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.575 23.35 14.149999999999999 25.924999999999997 2 27.775 26.700000000000003 29.425 16.1 3 21.9 28.275 29.65 20.175 4 23.400000000000002 35.075 22.975 18.55 5 24.925 34.725 23.65 16.7 6 22.336425169215342 35.97392830283279 23.063424417147154 18.62622211080471 7 21.78490849837052 22.762597142140887 37.52820255703184 17.924291802456757 8 23.414389571321134 25.921283529706695 26.873903233893202 23.790423665078965 9 22.762597142140887 25.69566307345199 28.32790172975683 23.21383805465029 10-14 23.710203058410627 28.75908749059915 26.031586863875656 21.499122587114567 15-19 24.16144397092003 27.896715968914513 27.12960641764853 20.812233642516922 20-24 23.43326982853705 28.48190113305926 27.063070289782416 21.021758748621277 25-29 24.181499122587113 27.681123088493358 27.264978691401353 20.872399097518173 30-34 23.083479568814237 27.896715968914513 27.345199298069687 21.674605164201555 35-39 23.414389571321134 28.212584607671094 27.194785660566556 21.178240160441213 40-44 23.836976137958693 27.772207740124323 27.446360537397236 20.94445558451975 45-49 23.68038498170334 28.477617925710565 27.344729059100708 20.497268033485387 50-54 23.834820086198256 27.713741605693095 27.453142227122378 20.998296080986268 55-59 23.80212510024058 27.646351242983158 27.460906174819566 21.0906174819567 60-64 23.402335722520174 27.362036990627036 28.008621121748284 21.227006165104505 65-69 24.030075187969924 27.423558897243105 27.67919799498747 20.8671679197995 70-74 24.268097052336074 27.917585722879483 27.35111289352316 20.463204331261277 75-79 24.295739348370926 27.9749373433584 27.11779448621554 20.61152882205514 80-84 24.306843820506394 27.65104036099273 27.485585359739282 20.556530458761593 85-89 24.38205063925796 27.264978691401353 27.86663324141389 20.4863374279268 90-94 24.908498370518927 27.450488844321885 27.054399598896968 20.58661318626222 95-99 23.816924002406257 27.651894926809707 27.997794265089233 20.533386805694807 100-104 23.63408521303258 27.959899749373434 27.343358395989974 21.06265664160401 105-109 24.520170383362565 27.98296166374342 27.276371836632425 20.22049611626159 110-114 23.99639152007217 27.304164787250034 28.186237658497472 20.513206034180325 115-119 24.804491678363746 27.426308401844796 27.51152997794265 20.257669941848807 120-124 24.521303258145362 27.513784461152884 27.468671679197993 20.49624060150376 125-129 25.063912978094137 27.610406536668503 26.958744799238055 20.366935685999298 130-134 24.819530780028074 27.45638660517345 28.098054942851412 19.626027671947064 135-139 24.725522634982706 27.668321050784577 26.981500977590617 20.6246553366421 140-144 25.314552107875084 27.19935836382776 27.64549601483784 19.84059351345932 145-149 25.018794166290782 27.4896005613191 27.118729013180975 20.372876259209143 150-151 25.150150150150154 27.82782782782783 26.539039039039036 20.482982982982982 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 1.5 3 3.0 4 2.5 5 0.5 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 2.0 24 2.0 25 1.5 26 3.0 27 3.0 28 2.0 29 3.5 30 5.0 31 8.5 32 17.5 33 24.0 34 25.5 35 43.0 36 67.5 37 83.0 38 109.0 39 146.5 40 198.5 41 230.5 42 224.0 43 262.5 44 291.0 45 315.5 46 311.0 47 275.5 48 251.5 49 219.5 50 191.0 51 157.0 52 132.0 53 100.0 54 85.0 55 57.0 56 30.0 57 29.0 58 22.5 59 13.5 60 10.5 61 9.5 62 9.0 63 5.0 64 2.0 65 1.5 66 1.5 67 0.5 68 1.0 69 2.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.27499999999999997 7 0.27499999999999997 8 0.27499999999999997 9 0.27499999999999997 10-14 0.27499999999999997 15-19 0.27499999999999997 20-24 0.27 25-29 0.27499999999999997 30-34 0.27499999999999997 35-39 0.27499999999999997 40-44 0.26 45-49 0.255 50-54 0.22999999999999998 55-59 0.24 60-64 0.245 65-69 0.25 70-74 0.26 75-79 0.25 80-84 0.27499999999999997 85-89 0.27499999999999997 90-94 0.27499999999999997 95-99 0.26 100-104 0.25 105-109 0.22499999999999998 110-114 0.23500000000000001 115-119 0.26 120-124 0.25 125-129 0.255 130-134 0.26 135-139 0.265 140-144 0.255 145-149 0.23500000000000001 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42167462911743 98.85000000000001 2 0.5783253708825749 1.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.42500000000000004 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 1.0 0.0 0.0 0.0 0.0 106-107 1.15 0.0 0.0 0.0 0.0 108-109 1.3250000000000002 0.0 0.0 0.0 0.0 110-111 1.375 0.0 0.0 0.0 0.0 112-113 1.6875 0.0 0.0 0.0 0.0 114-115 1.8375 0.0 0.0 0.0 0.0 116-117 2.0 0.0 0.0 0.0 0.0 118-119 2.2375 0.0 0.0 0.0 0.0 120-121 2.4375 0.0 0.0 0.0 0.0 122-123 2.6125 0.0 0.0 0.0 0.0 124-125 3.1 0.0 0.0 0.0 0.0 126-127 3.5 0.0 0.0 0.0 0.0 128-129 3.95 0.0 0.0 0.0 0.0 130-131 4.175 0.0 0.0 0.0 0.0 132-133 4.475 0.0 0.0 0.0 0.0 134-135 4.8875 0.0 0.0 0.0 0.0 136-137 5.325 0.0 0.0 0.0 0.0 138-139 5.800000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 810367 spots for SRR7169611.sra Written 810367 spots for SRR7169611.sra Read 810367 spots for SRR7169611.sra Written 810367 spots for SRR7169611.sra Read 810367 spots for SRR7169611.sra Written 810367 spots for SRR7169611.sra Read 810367 spots for SRR7169611.sra Written 810367 spots for SRR7169611.sra Read 810367 spots for SRR7169611.sra Written 810367 spots for SRR7169611.sra Read 810367 spots for SRR7169611.sra Written 810367 spots for SRR7169611.sra Read 810367 spots for SRR7169611.sra Written 810367 spots for SRR7169611.sra Read 810367 spots for SRR7169611.sra Written 810367 spots for SRR7169611.sra Read 810370 spots for SRR7169611.sra Written 810370 spots for SRR7169611.sra Read 810367 spots for SRR7169611.sra Written 810367 spots for SRR7169611.sra Read 810367 spots for SRR7169611.sra Written 810367 spots for SRR7169611.sra Read 810367 spots for SRR7169611.sra Written 810367 spots for SRR7169611.sra Read 810367 spots for SRR7169611.sra Written 810367 spots for SRR7169611.sra Read 810367 spots for SRR7169611.sra Written 810367 spots for SRR7169611.sra Read 810367 spots for SRR7169611.sra Written 810367 spots for SRR7169611.sra Read 810367 spots for SRR7169611.sra Written 810367 spots for SRR7169611.sra Read 810367 spots for SRR7169611.sra Written 810367 spots for SRR7169611.sra Read 810367 spots for SRR7169611.sra Written 810367 spots for SRR7169611.sra Read 810367 spots for SRR7169611.sra Written 810367 spots for SRR7169611.sra Read 810367 spots for SRR7169611.sra Written 810367 spots for SRR7169611.sra SRR ids: ['SRR7169611.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5_dazxo0 SRR7169611.sra spots: 16207343 blocks: [[1, 810367], [810368, 1620734], [1620735, 2431101], [2431102, 3241468], [3241469, 4051835], [4051836, 4862202], [4862203, 5672569], [5672570, 6482936], [6482937, 7293303], [7293304, 8103670], [8103671, 8914037], [8914038, 9724404], [9724405, 10534771], [10534772, 11345138], [11345139, 12155505], [12155506, 12965872], [12965873, 13776239], [13776240, 14586606], [14586607, 15396973], [15396974, 16207343]] SRR7169611 file size 5470436 SRR7169611 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169611 SRR7169611_1.fastq SRR7169611_2.fastq Input file: SRR7169611_1.fastq Paired file: SRR7169611_2.fastq trimmed: SRR7169611-trimmed-pair1.fastq, SRR7169611-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:47:42 2025 >> started Tue Feb 11 09:47:59 2025 >> done (17.061s) 16207343 read pairs processed; of these: 38262 ( 0.24%) short read pairs filtered out after trimming by size control 42503 ( 0.26%) empty read pairs filtered out after trimming by size control 16126578 (99.50%) read pairs available; of these: 7582078 (47.02%) trimmed read pairs available after processing 8544500 (52.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 4 0.00% 20 3 0.00% 21 3 0.00% 22 3 0.00% 23 6 0.00% 24 9 0.00% 25 6 0.00% 26 12 0.00% 27 10 0.00% 28 7 0.00% 29 8 0.00% 30 9 0.00% 31 16 0.00% 32 16 0.00% 33 10 0.00% 34 11 0.00% 35 20 0.00% 36 11 0.00% 37 15 0.00% 38 25 0.00% 39 20 0.00% 40 23 0.00% 41 22 0.00% 42 22 0.00% 43 23 0.00% 44 25 0.00% 45 34 0.00% 46 41 0.00% 47 49 0.00% 48 61 0.00% 49 55 0.00% 50 74 0.00% 51 75 0.00% 52 73 0.00% 53 91 0.00% 54 105 0.00% 55 97 0.00% 56 121 0.00% 57 127 0.00% 58 157 0.00% 59 170 0.00% 60 181 0.00% 61 238 0.00% 62 245 0.00% 63 280 0.00% 64 305 0.00% 65 383 0.00% 66 414 0.00% 67 538 0.00% 68 799 0.00% 69 1917 0.01% 70 2436 0.02% 71 1408 0.01% 72 1106 0.01% 73 1057 0.01% 74 1054 0.01% 75 1177 0.01% 76 1372 0.01% 77 1447 0.01% 78 1643 0.01% 79 1839 0.01% 80 2069 0.01% 81 2326 0.01% 82 2761 0.02% 83 3116 0.02% 84 4384 0.03% 85 5113 0.03% 86 5052 0.03% 87 5554 0.03% 88 6191 0.04% 89 6317 0.04% 90 7005 0.04% 91 7546 0.05% 92 8057 0.05% 93 8481 0.05% 94 9249 0.06% 95 9884 0.06% 96 10131 0.06% 97 10698 0.07% 98 11299 0.07% 99 11884 0.07% 100 12819 0.08% 101 13558 0.08% 102 14517 0.09% 103 15513 0.10% 104 16337 0.10% 105 17316 0.11% 106 18399 0.11% 107 18967 0.12% 108 19474 0.12% 109 20526 0.13% 110 21189 0.13% 111 21949 0.14% 112 23381 0.14% 113 24864 0.15% 114 26205 0.16% 115 28099 0.17% 116 28638 0.18% 117 29638 0.18% 118 30705 0.19% 119 31308 0.19% 120 32842 0.20% 121 33602 0.21% 122 35311 0.22% 123 37342 0.23% 124 39463 0.24% 125 41205 0.26% 126 42756 0.27% 127 44745 0.28% 128 46328 0.29% 129 47629 0.30% 130 49865 0.31% 131 52142 0.32% 132 54672 0.34% 133 58173 0.36% 134 61002 0.38% 135 64897 0.40% 136 69120 0.43% 137 72768 0.45% 138 77815 0.48% 139 82820 0.51% 140 87606 0.54% 141 95253 0.59% 142 103755 0.64% 143 115306 0.72% 144 132586 0.82% 145 155616 0.96% 146 188888 1.17% 147 254270 1.58% 148 388322 2.41% 149 776357 4.81% 150 3647587 22.62% 151 8544500 52.98% 16126578 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.76 fanout-score-rank=36 prefix-density=0.22 prefix-fanout=2.5 sequence=GCTGTCTTCAAGAACCTATT criterion=fanout-score sequence-density=0.13 sequence-density-rank=9 fanout-score=71.84 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=13.1 sequence=CCACCACCAACATCCACCAAGGATGTGAGGCCTTCAAAGCCTTTGTAGGTCTCAAGAAGCTTCTTCATGGTAATGGTAGAGTGGTCAGACATTCCCTTATTGAA criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=17.71 fanout-score-rank=5 prefix-density=0.43 prefix-fanout=7.5 sequence=TGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCATGGAGTACAGGCTGCTGAACTCCTTGTTGACTTCTTTGAGAAGTGCAAGGCTGATCCCAGTTACTGGGACAAAATCTCCCAGGGAGGCCTGCAGCGAATCCAAGAGAAGTATACCTGGAAAATTTACTCTCAAAGGCTCCTGACTCTCACAGGAGTTTATGGCTTCTGGAAGCATGTTTCCAACCTTGATCATCGTGAGAGCCGTCGCTATCTGGAAATGTTCTATGCACTCAAATATCGCAAATTGGCTGATTCTGTTCCTTTGACTATCGAGTAAATGGAGCTGGAGAAATCAAGGAAACATGGGTTGGTTTGAGTCGGGTTCCGGGTCCAGAATAATGGTGTCATTTCACGATAGTGATTGGACAAGAAAGGCTTTGATCTTCTT criterion=fanout-score sequence-density=0.12 sequence-density-rank=19 fanout-score=42.73 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=10.4 sequence=TCAAGGAAGCTTTCAG SRR7169611 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:48:41 Started mapping on | Feb 11 09:48:41 Finished on | Feb 11 09:50:13 Mapping speed, Million of reads per hour | 631.04 Number of input reads | 16126578 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 15227835 Uniquely mapped reads % | 94.43% Average mapped length | 293.95 Number of splices: Total | 13728586 Number of splices: Annotated (sjdb) | 13485167 Number of splices: GT/AG | 13527655 Number of splices: GC/AG | 156992 Number of splices: AT/AC | 11384 Number of splices: Non-canonical | 32555 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.80 Insertion rate per base | 0.02% Insertion average length | 2.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 294214 % of reads mapped to multiple loci | 1.82% Number of reads mapped to too many loci | 58737 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.32% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 623980 623980 623980 N_multimapping 294214 294214 294214 N_noFeature 313077 15017686 407152 N_ambiguous 179296 1338 62165 UnstrandedReadsAssigned:14735462 PositiveStrandReadsAssigned:208811 NegativeStrandReadsAssigned:14758518 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169611 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169611-trimmed-pair1.fastq SRR7169611-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,126,578 reads, 14,739,040 reads pseudoaligned [quant] estimated average fragment length: 236.509 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,067 rounds 52401 SRR7169611.ke.tsv 34699 SRR7169611.se.tsv 87100 total ==> SRR7169611.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1782.49 305 10.7702 Potri.005G024800.1.v4.1 1035 799.491 32 2.51934 Potri.004G059700.1.v4.1 961 725.497 1 0.0867592 Potri.007G009000.2.v4.1 1416 1180.49 0 0 Potri.003G141000.2.v4.1 2943 2707.49 241.034 5.60354 Potri.016G087400.1.v4.1 270 80.325 1519 1190.3 Potri.015G069301.1.v4.1 564 331.845 0 0 Potri.010G195200.1.v4.1 1773 1537.49 77 3.15231 Potri.012G127500.1.v4.1 977 741.497 4781 405.845 ==> SRR7169611.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1871 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 293 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 18 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7169611 completed mapping pipeline successfully