Starting /dee2/code/volunteer_pipeline.sh SRR7169612 current disk space = 3052859801600 free memory = 1578117332 SRR7169612 SRAfilesize daa6e278660c0fbd6919e7d4061536ed SRR7169612.sra SRR7169612.sra file validated SRR7169612 is paired end SRR7169612 is conventional basespace SRR7169612 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169612_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.78175 34.0 33.0 34.0 33.0 34.0 2 33.38375 34.0 33.0 34.0 33.0 34.0 3 33.42325 34.0 34.0 34.0 33.0 34.0 4 33.4455 34.0 34.0 34.0 33.0 34.0 5 33.45225 34.0 34.0 34.0 33.0 34.0 6 36.9945 38.0 37.0 38.0 36.0 38.0 7 37.32425 38.0 38.0 38.0 37.0 38.0 8 37.416 38.0 38.0 38.0 37.0 38.0 9 37.5085 38.0 38.0 38.0 37.0 38.0 10-14 37.497 38.0 38.0 38.0 37.2 38.0 15-19 37.4863 38.0 38.0 38.0 37.2 38.0 20-24 37.447799999999994 38.0 38.0 38.0 37.0 38.0 25-29 37.40035 38.0 38.0 38.0 37.0 38.0 30-34 37.36149999999999 38.0 38.0 38.0 37.0 38.0 35-39 37.288349999999994 38.0 38.0 38.0 36.8 38.0 40-44 37.172450000000005 38.0 38.0 38.0 36.0 38.0 45-49 37.040049999999994 38.0 38.0 38.0 36.0 38.0 50-54 36.971000000000004 38.0 38.0 38.0 36.0 38.0 55-59 36.927499999999995 38.0 38.0 38.0 35.4 38.0 60-64 36.83605 38.0 38.0 38.0 35.0 38.0 65-69 36.75475 38.0 38.0 38.0 34.8 38.0 70-74 36.7235 38.0 38.0 38.0 35.0 38.0 75-79 36.58855 38.0 38.0 38.0 34.2 38.0 80-84 36.4795 38.0 38.0 38.0 34.0 38.0 85-89 36.35855 38.0 37.6 38.0 34.0 38.0 90-94 36.23805 38.0 37.6 38.0 33.8 38.0 95-99 36.043 38.0 37.0 38.0 33.2 38.0 100-104 35.75025 38.0 37.0 38.0 31.2 38.0 105-109 35.598600000000005 38.0 37.0 38.0 30.8 38.0 110-114 35.274 38.0 36.4 38.0 28.8 38.0 115-119 35.07144999999999 38.0 36.0 38.0 28.4 38.0 120-124 34.87165 38.0 35.8 38.0 27.8 38.0 125-129 34.59355 38.0 35.0 38.0 27.0 38.0 130-134 34.290499999999994 38.0 35.0 38.0 24.2 38.0 135-139 34.07735 38.0 35.0 38.0 23.2 38.0 140-144 33.5615 38.0 34.2 38.0 20.2 38.0 145-149 32.723549999999996 38.0 33.6 38.0 14.2 38.0 150-151 28.9835 36.0 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 2.0 13 0.0 14 3.0 15 2.0 16 2.0 17 5.0 18 4.0 19 9.0 20 12.0 21 7.0 22 13.0 23 15.0 24 12.0 25 13.0 26 25.0 27 16.0 28 40.0 29 27.0 30 54.0 31 61.0 32 91.0 33 120.0 34 198.0 35 304.0 36 810.0 37 2154.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.2949273515167 12.592403772622992 8.055059903135357 38.05760897272496 2 23.025000000000002 15.4 32.925 28.65 3 20.025000000000002 19.35 25.35 35.275 4 22.650000000000002 28.175 22.375 26.8 5 23.325000000000003 31.5 23.200000000000003 21.975 6 19.725 32.824999999999996 26.200000000000003 21.25 7 14.149999999999999 26.075 41.675000000000004 18.099999999999998 8 16.525000000000002 25.650000000000002 31.65 26.174999999999997 9 17.825 23.575 34.025 24.575 10-14 20.09 29.59 27.41 22.91 15-19 19.375 28.93 28.000000000000004 23.695 20-24 19.975 28.535 27.49 24.0 25-29 19.564999999999998 28.675 27.935 23.825 30-34 19.85 28.27 27.584999999999997 24.295 35-39 19.465 28.835 27.125 24.575 40-44 20.13 28.835 27.245 23.79 45-49 19.855 28.605000000000004 27.750000000000004 23.79 50-54 20.23 28.299999999999997 27.794999999999998 23.674999999999997 55-59 20.085 28.754999999999995 27.034999999999997 24.125 60-64 20.185 28.325 27.685 23.805 65-69 20.215 28.050000000000004 27.38 24.355 70-74 20.535 28.27 27.625 23.57 75-79 20.235 28.705000000000002 27.365000000000002 23.695 80-84 20.175 28.325 27.52 23.98 85-89 20.724999999999998 27.884999999999998 27.644999999999996 23.745 90-94 20.45 28.37 27.655 23.525 95-99 19.845 28.299999999999997 27.894999999999996 23.96 100-104 20.972826902867435 28.244007406295353 27.368263023570034 23.414902667267175 105-109 20.880000000000003 27.889999999999997 27.42 23.810000000000002 110-114 20.832081706218084 27.92129768699309 27.74106338239712 23.50555722439171 115-119 20.560280140070038 28.73936968484242 27.01350675337669 23.686843421710854 120-124 20.536429143314653 28.332666132906326 27.241793434747798 23.889111289031227 125-129 21.135 27.705000000000002 27.715 23.445 130-134 20.443288137289237 28.358432981437936 27.247711012157904 23.950567869114924 135-139 20.52 28.444999999999997 27.224999999999998 23.810000000000002 140-144 20.44 28.935 26.615 24.01 145-149 20.974999999999998 27.900000000000002 26.915 24.21 150-151 20.1125 28.7375 26.85 24.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 1.5 24 2.0 25 2.5 26 2.5 27 4.5 28 6.5 29 11.5 30 18.0 31 25.0 32 34.5 33 38.0 34 44.5 35 56.0 36 83.0 37 95.0 38 120.5 39 172.0 40 194.5 41 215.5 42 238.0 43 264.5 44 284.5 45 269.5 46 262.5 47 258.5 48 236.5 49 207.5 50 172.0 51 141.5 52 118.5 53 102.5 54 90.0 55 65.5 56 38.0 57 30.0 58 25.5 59 18.5 60 12.5 61 9.0 62 5.5 63 4.0 64 5.5 65 4.0 66 1.5 67 1.5 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.925 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.08499999999999999 105-109 0.0 110-114 0.13 115-119 0.05 120-124 0.08 125-129 0.0 130-134 0.065 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47209653092006 98.925 2 0.5027652086475616 1.0 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.6125 0.0 0.0 0.0 0.0 102-103 0.8 0.0 0.0 0.0 0.0 104-105 0.875 0.0 0.0 0.0 0.0 106-107 0.9875 0.0 0.0 0.0 0.0 108-109 1.1875 0.0 0.0 0.0 0.0 110-111 1.325 0.0 0.0 0.0 0.0 112-113 1.45 0.0 0.0 0.0 0.0 114-115 1.5625 0.0 0.0 0.0 0.0 116-117 1.8 0.0 0.0 0.0 0.0 118-119 1.95 0.0 0.0 0.0 0.0 120-121 2.2125000000000004 0.0 0.0 0.0 0.0 122-123 2.5 0.0 0.0 0.0 0.0 124-125 2.8625 0.0 0.0 0.0 0.0 126-127 3.1125 0.0 0.0 0.0 0.0 128-129 3.3625 0.0 0.0 0.0 0.0 130-131 3.7625 0.0 0.0 0.0 0.0 132-133 4.025 0.0 0.0 0.0 0.0 134-135 4.4125 0.0 0.0 0.0 0.0 136-137 4.825 0.0 0.0 0.0 0.0 138-139 5.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169612 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169612_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.62675 33.0 33.0 34.0 32.0 34.0 2 32.9105 33.0 33.0 34.0 32.0 34.0 3 32.99825 34.0 33.0 34.0 32.0 34.0 4 32.95975 34.0 33.0 34.0 32.0 34.0 5 32.95425 34.0 33.0 34.0 32.0 34.0 6 37.159 38.0 38.0 38.0 37.0 38.0 7 37.1455 38.0 38.0 38.0 37.0 38.0 8 37.20025 38.0 38.0 38.0 37.0 38.0 9 37.0925 38.0 38.0 38.0 36.0 38.0 10-14 37.060050000000004 38.0 38.0 38.0 36.6 38.0 15-19 37.083999999999996 38.0 38.0 38.0 36.6 38.0 20-24 37.08735 38.0 38.0 38.0 36.8 38.0 25-29 37.100899999999996 38.0 38.0 38.0 36.8 38.0 30-34 37.0937 38.0 38.0 38.0 37.0 38.0 35-39 36.995450000000005 38.0 38.0 38.0 36.4 38.0 40-44 36.984899999999996 38.0 38.0 38.0 36.2 38.0 45-49 37.004599999999996 38.0 38.0 38.0 36.4 38.0 50-54 36.734449999999995 38.0 38.0 38.0 35.8 38.0 55-59 36.34895 38.0 38.0 38.0 35.2 38.0 60-64 36.133700000000005 38.0 38.0 38.0 34.8 38.0 65-69 35.9641 38.0 38.0 38.0 34.2 38.0 70-74 35.857000000000006 38.0 38.0 38.0 34.0 38.0 75-79 35.7233 38.0 38.0 38.0 33.6 38.0 80-84 35.781400000000005 38.0 38.0 38.0 33.6 38.0 85-89 35.886900000000004 38.0 38.0 38.0 34.0 38.0 90-94 35.852250000000005 38.0 38.0 38.0 33.6 38.0 95-99 35.7947 38.0 38.0 38.0 33.2 38.0 100-104 35.63315 38.0 38.0 38.0 32.6 38.0 105-109 35.60555000000001 38.0 38.0 38.0 32.4 38.0 110-114 35.523900000000005 38.0 38.0 38.0 31.8 38.0 115-119 35.21555 38.0 37.2 38.0 29.6 38.0 120-124 35.011700000000005 38.0 37.0 38.0 28.2 38.0 125-129 34.90514999999999 38.0 36.6 38.0 28.0 38.0 130-134 34.457550000000005 38.0 36.0 38.0 25.8 38.0 135-139 33.947649999999996 38.0 35.2 38.0 22.6 38.0 140-144 33.46715 38.0 35.0 38.0 17.0 38.0 145-149 32.59545000000001 38.0 34.4 38.0 11.2 38.0 150-151 28.727625 36.0 18.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 1.0 5 1.0 6 0.0 7 2.0 8 4.0 9 0.0 10 4.0 11 4.0 12 8.0 13 26.0 14 25.0 15 3.0 16 6.0 17 6.0 18 2.0 19 7.0 20 10.0 21 9.0 22 12.0 23 25.0 24 13.0 25 19.0 26 33.0 27 32.0 28 26.0 29 41.0 30 50.0 31 54.0 32 78.0 33 102.0 34 113.0 35 213.0 36 452.0 37 2615.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.52825923134891 21.652851042451644 13.28811856317508 27.530771163024365 2 27.450000000000003 27.1 29.349999999999998 16.1 3 19.175 30.375000000000004 31.025000000000002 19.425 4 23.1 34.875 23.525 18.5 5 24.825 35.825 21.224999999999998 18.125 6 21.175 38.3 22.75 17.775 7 20.125 22.5 38.074999999999996 19.3 8 21.575 26.05 26.625 25.75 9 20.75 26.224999999999998 29.875 23.150000000000002 10-14 23.499099459675808 29.23754252551531 26.15569341604963 21.107664598759253 15-19 23.540301195777253 27.40781507980187 27.17266223044979 21.879221493971084 20-24 23.455000000000002 28.15 26.955000000000002 21.44 25-29 23.285 28.42 27.77 20.525 30-34 23.24 27.750000000000004 27.805000000000003 21.205 35-39 23.65 27.615000000000002 27.62 21.115000000000002 40-44 23.43 27.865000000000002 27.715 20.990000000000002 45-49 23.49 27.77 27.755000000000003 20.985 50-54 23.397307073954984 28.019493569131832 27.13524919614148 21.447950160771704 55-59 23.294416243654823 27.79695431472081 28.187817258883246 20.720812182741117 60-64 23.723968966925277 27.58779093507554 27.705185790118414 20.983054307880767 65-69 23.3736297510501 27.589386333367482 28.050404671652494 20.986579243929924 70-74 23.69891811516177 27.44193201045993 27.862380146644107 20.996769727734193 75-79 23.51884177020228 27.913543484957387 27.39500975459493 21.172604990245407 80-84 23.757922715191167 27.489265998773256 27.857288897975874 20.8955223880597 85-89 23.874148622547526 27.41689539493748 28.34705702958219 20.361898952932805 90-94 24.000608766233768 27.65827922077922 28.038758116883116 20.3023538961039 95-99 23.442481906979097 28.042917151677717 27.906270560251023 20.60833038109216 100-104 24.55111021192656 27.33296241970563 27.525163117697637 20.590764250670173 105-109 24.11963825594907 27.787601677360684 27.570353155155864 20.52240691153438 110-114 24.339746503055093 27.369590466090997 27.768519921224055 20.52214310962985 115-119 24.38064483576366 27.599777990816893 27.725919572127754 20.293657601291688 120-124 23.942099157714228 27.81056135572704 27.82064861048066 20.426690876078073 125-129 24.135136504077394 27.533809451451148 27.635111178645595 20.695942865825863 130-134 24.309476575614223 28.00244162978788 27.63111043288061 20.05697136171728 135-139 24.77392326163593 27.640116486997396 27.33357175701221 20.252388494354467 140-144 24.948822927328557 28.019447287615147 27.364380757420676 19.66734902763562 145-149 25.722068043992184 27.500256963716723 27.135368485969778 19.642306506321308 150-151 25.361010830324908 27.746260959257352 27.68179473955647 19.21093347086127 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 1.5 20 4.5 21 5.5 22 4.5 23 8.5 24 10.0 25 6.5 26 9.0 27 10.0 28 9.0 29 10.5 30 16.0 31 18.5 32 19.5 33 31.5 34 37.5 35 50.0 36 75.5 37 94.5 38 125.5 39 157.0 40 183.0 41 222.0 42 256.0 43 277.0 44 291.0 45 283.5 46 267.0 47 272.5 48 248.5 49 205.5 50 179.0 51 143.5 52 102.0 53 81.0 54 66.5 55 46.0 56 43.5 57 36.0 58 22.5 59 15.0 60 10.0 61 10.0 62 10.0 63 8.5 64 5.5 65 2.0 66 2.0 67 1.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.475 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.06 15-19 0.065 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.48 55-59 1.5 60-64 2.04 65-69 2.39 70-74 2.485 75-79 2.6100000000000003 80-84 2.18 85-89 1.63 90-94 1.44 95-99 1.205 100-104 1.145 105-109 1.035 110-114 0.985 115-119 0.905 120-124 0.865 125-129 1.2850000000000001 130-134 1.7049999999999998 135-139 2.1350000000000002 140-144 2.3 145-149 2.71 150-151 3.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.30000000000000004 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.5625 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.825 0.0 0.0 0.0 0.0 106-107 0.9375 0.0 0.0 0.0 0.0 108-109 1.1375 0.0 0.0 0.0 0.0 110-111 1.275 0.0 0.0 0.0 0.0 112-113 1.4 0.0 0.0 0.0 0.0 114-115 1.5125 0.0 0.0 0.0 0.0 116-117 1.7374999999999998 0.0 0.0 0.0 0.0 118-119 1.875 0.0 0.0 0.0 0.0 120-121 2.1375 0.0 0.0 0.0 0.0 122-123 2.4125 0.0 0.0 0.0 0.0 124-125 2.7625 0.0 0.0 0.0 0.0 126-127 3.0375 0.0 0.0 0.0 0.0 128-129 3.2875 0.0 0.0 0.0 0.0 130-131 3.675 0.0 0.0 0.0 0.0 132-133 3.95 0.0 0.0 0.0 0.0 134-135 4.3125 0.0 0.0 0.0 0.0 136-137 4.7 0.0 0.0 0.0 0.0 138-139 5.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTAGGGA 40 0.004595968 57.14 145 >>END_MODULE Read 804241 spots for SRR7169612.sra Written 804241 spots for SRR7169612.sra Read 804241 spots for SRR7169612.sra Written 804241 spots for SRR7169612.sra Read 804241 spots for SRR7169612.sra Written 804241 spots for SRR7169612.sra Read 804241 spots for SRR7169612.sra Written 804241 spots for SRR7169612.sra Read 804241 spots for SRR7169612.sra Written 804241 spots for SRR7169612.sra Read 804241 spots for SRR7169612.sra Written 804241 spots for SRR7169612.sra Read 804241 spots for SRR7169612.sra Written 804241 spots for SRR7169612.sra Read 804241 spots for SRR7169612.sra Written 804241 spots for SRR7169612.sra Read 804241 spots for SRR7169612.sra Written 804241 spots for SRR7169612.sra Read 804241 spots for SRR7169612.sra Written 804241 spots for SRR7169612.sra Read 804241 spots for SRR7169612.sra Written 804241 spots for SRR7169612.sra Read 804241 spots for SRR7169612.sra Written 804241 spots for SRR7169612.sra Read 804241 spots for SRR7169612.sra Written 804241 spots for SRR7169612.sra Read 804241 spots for SRR7169612.sra Written 804241 spots for SRR7169612.sra Read 804241 spots for SRR7169612.sra Written 804241 spots for SRR7169612.sra Read 804241 spots for SRR7169612.sra Written 804241 spots for SRR7169612.sra Read 804246 spots for SRR7169612.sra Written 804246 spots for SRR7169612.sra Read 804241 spots for SRR7169612.sra Written 804241 spots for SRR7169612.sra Read 804241 spots for SRR7169612.sra Written 804241 spots for SRR7169612.sra Read 804241 spots for SRR7169612.sra Written 804241 spots for SRR7169612.sra SRR ids: ['SRR7169612.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ctlzaddn SRR7169612.sra spots: 16084825 blocks: [[1, 804241], [804242, 1608482], [1608483, 2412723], [2412724, 3216964], [3216965, 4021205], [4021206, 4825446], [4825447, 5629687], [5629688, 6433928], [6433929, 7238169], [7238170, 8042410], [8042411, 8846651], [8846652, 9650892], [9650893, 10455133], [10455134, 11259374], [11259375, 12063615], [12063616, 12867856], [12867857, 13672097], [13672098, 14476338], [14476339, 15280579], [15280580, 16084825]] SRR7169612 file size 5428919 SRR7169612 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169612 SRR7169612_1.fastq SRR7169612_2.fastq Input file: SRR7169612_1.fastq Paired file: SRR7169612_2.fastq trimmed: SRR7169612-trimmed-pair1.fastq, SRR7169612-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:51:53 2025 >> started Tue Feb 11 10:52:11 2025 >> done (18.502s) 16084825 read pairs processed; of these: 14167 ( 0.09%) short read pairs filtered out after trimming by size control 14064 ( 0.09%) empty read pairs filtered out after trimming by size control 16056594 (99.82%) read pairs available; of these: 8933124 (55.64%) trimmed read pairs available after processing 7123470 (44.36%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 5 0.00% 21 5 0.00% 22 3 0.00% 23 4 0.00% 24 2 0.00% 25 6 0.00% 26 11 0.00% 27 9 0.00% 28 7 0.00% 29 8 0.00% 30 9 0.00% 31 11 0.00% 32 10 0.00% 33 12 0.00% 34 16 0.00% 35 15 0.00% 36 14 0.00% 37 14 0.00% 38 24 0.00% 39 21 0.00% 40 20 0.00% 41 17 0.00% 42 30 0.00% 43 29 0.00% 44 36 0.00% 45 34 0.00% 46 48 0.00% 47 49 0.00% 48 61 0.00% 49 70 0.00% 50 74 0.00% 51 63 0.00% 52 94 0.00% 53 99 0.00% 54 114 0.00% 55 125 0.00% 56 145 0.00% 57 150 0.00% 58 170 0.00% 59 200 0.00% 60 247 0.00% 61 241 0.00% 62 300 0.00% 63 320 0.00% 64 379 0.00% 65 406 0.00% 66 458 0.00% 67 511 0.00% 68 686 0.00% 69 800 0.00% 70 901 0.01% 71 921 0.01% 72 1062 0.01% 73 1219 0.01% 74 1374 0.01% 75 1822 0.01% 76 1510 0.01% 77 1401 0.01% 78 1758 0.01% 79 2709 0.02% 80 4165 0.03% 81 2032 0.01% 82 2565 0.02% 83 2930 0.02% 84 3871 0.02% 85 4432 0.03% 86 5123 0.03% 87 5406 0.03% 88 5366 0.03% 89 5816 0.04% 90 6394 0.04% 91 6662 0.04% 92 7112 0.04% 93 7958 0.05% 94 8606 0.05% 95 9388 0.06% 96 9985 0.06% 97 10867 0.07% 98 12044 0.08% 99 14704 0.09% 100 17661 0.11% 101 15529 0.10% 102 14016 0.09% 103 14378 0.09% 104 15287 0.10% 105 16574 0.10% 106 17487 0.11% 107 17871 0.11% 108 18746 0.12% 109 19123 0.12% 110 19997 0.12% 111 21072 0.13% 112 22202 0.14% 113 23745 0.15% 114 25112 0.16% 115 26419 0.16% 116 27667 0.17% 117 28864 0.18% 118 30043 0.19% 119 31057 0.19% 120 32127 0.20% 121 33950 0.21% 122 35326 0.22% 123 37535 0.23% 124 39511 0.25% 125 41628 0.26% 126 44409 0.28% 127 45708 0.28% 128 48118 0.30% 129 50127 0.31% 130 52536 0.33% 131 55097 0.34% 132 58743 0.37% 133 62950 0.39% 134 66832 0.42% 135 72476 0.45% 136 77549 0.48% 137 83082 0.52% 138 90015 0.56% 139 99703 0.62% 140 108458 0.68% 141 117992 0.73% 142 131395 0.82% 143 148733 0.93% 144 176859 1.10% 145 214279 1.33% 146 270829 1.69% 147 369626 2.30% 148 563546 3.51% 149 1101859 6.86% 150 4022983 25.06% 151 7123470 44.36% 16056594 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=39 prefix-density=0.20 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.09 sequence-density-rank=25 fanout-score=67.10 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=12.3 sequence=CACCACCAACATCCACCAAGGATGTGAGGCCTTCAAAGCCTTTGTAGGTCTCAAGAAGCTTCTTCATGGTAATGGTAGAGTGGTCAGACATTCCCTTATTGAAGACCTTGTTGAATCTTGGATCCGTGCCATGATATTCAAATGCAGTCATCCCATAGGCCTTGTTAAATGGAATTCCTCCATCAAGAATTGCATCTTTCAAATAATACCAGCTTTCCATGAGGACCTTGTCCTGGTTCATGAGA criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=42 prefix-density=0.30 prefix-fanout=2.2 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.13 sequence-density-rank=9 fanout-score=49.72 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=12.8 sequence=TGTTGGTGGTGG SRR7169612 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:52:57 Started mapping on | Feb 11 10:52:57 Finished on | Feb 11 10:54:24 Mapping speed, Million of reads per hour | 664.41 Number of input reads | 16056594 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 15313350 Uniquely mapped reads % | 95.37% Average mapped length | 293.31 Number of splices: Total | 14446229 Number of splices: Annotated (sjdb) | 14189544 Number of splices: GT/AG | 14237088 Number of splices: GC/AG | 166155 Number of splices: AT/AC | 11679 Number of splices: Non-canonical | 31307 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 266369 % of reads mapped to multiple loci | 1.66% Number of reads mapped to too many loci | 22585 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.78% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 492229 492229 492229 N_multimapping 266369 266369 266369 N_noFeature 341373 15134169 419338 N_ambiguous 160876 748 59288 UnstrandedReadsAssigned:14811101 PositiveStrandReadsAssigned:178433 NegativeStrandReadsAssigned:14834724 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169612 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169612-trimmed-pair1.fastq SRR7169612-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,056,594 reads, 14,734,634 reads pseudoaligned [quant] estimated average fragment length: 249.529 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,077 rounds 52401 SRR7169612.ke.tsv 34699 SRR7169612.se.tsv 87100 total ==> SRR7169612.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1769.47 315 11.6269 Potri.005G024800.1.v4.1 1035 786.471 36 2.98961 Potri.004G059700.1.v4.1 961 712.516 5 0.458322 Potri.007G009000.2.v4.1 1416 1167.47 0 0 Potri.003G141000.2.v4.1 2943 2694.47 286 6.93247 Potri.016G087400.1.v4.1 270 76.3939 1167.53 998.167 Potri.015G069301.1.v4.1 564 321.211 0 0 Potri.010G195200.1.v4.1 1773 1524.47 39 1.67086 Potri.012G127500.1.v4.1 977 728.497 5817 521.515 ==> SRR7169612.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1488 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 269 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 21 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169612 completed mapping pipeline successfully