Starting /dee2/code/volunteer_pipeline.sh SRR7169613 current disk space = 3054040506368 free memory = 1431499328 SRR7169613 SRAfilesize cd4ad2516fd7283fd7bed98b1edb799a SRR7169613.sra SRR7169613.sra file validated SRR7169613 is paired end SRR7169613 is conventional basespace SRR7169613 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169613_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0735 34.0 33.0 34.0 33.0 34.0 2 33.39575 34.0 34.0 34.0 33.0 34.0 3 33.4545 34.0 34.0 34.0 33.0 34.0 4 33.40275 34.0 34.0 34.0 33.0 34.0 5 33.47575 34.0 34.0 34.0 33.0 34.0 6 37.06775 38.0 37.0 38.0 36.0 38.0 7 37.2705 38.0 38.0 38.0 36.0 38.0 8 37.346 38.0 38.0 38.0 37.0 38.0 9 37.45 38.0 38.0 38.0 37.0 38.0 10-14 37.48180000000001 38.0 38.0 38.0 37.0 38.0 15-19 37.431999999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.4765 38.0 38.0 38.0 37.0 38.0 25-29 37.4446 38.0 38.0 38.0 37.0 38.0 30-34 37.41315 38.0 38.0 38.0 37.0 38.0 35-39 37.340849999999996 38.0 38.0 38.0 37.0 38.0 40-44 37.232150000000004 38.0 38.0 38.0 36.6 38.0 45-49 37.1843 38.0 38.0 38.0 36.0 38.0 50-54 37.1258 38.0 38.0 38.0 36.0 38.0 55-59 37.086850000000005 38.0 38.0 38.0 36.0 38.0 60-64 37.02075 38.0 38.0 38.0 36.0 38.0 65-69 36.9621 38.0 38.0 38.0 36.0 38.0 70-74 36.8949 38.0 38.0 38.0 35.4 38.0 75-79 36.85360000000001 38.0 38.0 38.0 35.2 38.0 80-84 36.7975 38.0 38.0 38.0 34.8 38.0 85-89 36.7878 38.0 38.0 38.0 35.0 38.0 90-94 36.6377 38.0 38.0 38.0 34.2 38.0 95-99 36.556200000000004 38.0 38.0 38.0 34.0 38.0 100-104 36.331900000000005 38.0 37.4 38.0 33.8 38.0 105-109 36.25145 38.0 37.0 38.0 33.8 38.0 110-114 36.1024 38.0 37.0 38.0 33.2 38.0 115-119 35.93895 38.0 37.0 38.0 32.6 38.0 120-124 35.71255 38.0 37.0 38.0 31.2 38.0 125-129 35.6087 38.0 36.2 38.0 31.0 38.0 130-134 35.3557 38.0 36.0 38.0 30.6 38.0 135-139 35.168099999999995 38.0 35.8 38.0 30.0 38.0 140-144 34.640550000000005 38.0 35.0 38.0 27.6 38.0 145-149 33.971799999999995 38.0 35.0 38.0 24.2 38.0 150-151 30.802374999999998 36.5 31.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 1.0 12 1.0 13 1.0 14 1.0 15 2.0 16 1.0 17 3.0 18 1.0 19 4.0 20 2.0 21 3.0 22 7.0 23 2.0 24 12.0 25 13.0 26 17.0 27 19.0 28 23.0 29 33.0 30 45.0 31 60.0 32 69.0 33 94.0 34 152.0 35 270.0 36 656.0 37 2507.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.81652306132793 12.747085656360872 9.503294475418144 33.933096806893055 2 24.325 14.924999999999999 30.975 29.775000000000002 3 20.625 20.375 25.35 33.650000000000006 4 22.6 26.1 24.95 26.35 5 21.925 32.800000000000004 23.75 21.525 6 19.400000000000002 34.775 26.075 19.75 7 15.65 26.724999999999998 40.65 16.975 8 18.625 27.0 29.25 25.124999999999996 9 17.2 24.5 34.575 23.724999999999998 10-14 20.11 29.37 27.034999999999997 23.485 15-19 19.744999999999997 29.035 27.67 23.549999999999997 20-24 19.994999999999997 29.160000000000004 27.04 23.805 25-29 19.945 28.605000000000004 27.765 23.685000000000002 30-34 20.13 29.630000000000003 27.275 22.965 35-39 20.4 28.705000000000002 27.43 23.465 40-44 20.375 28.83 27.405 23.39 45-49 21.09 28.29 26.985 23.635 50-54 20.54 28.76 27.229999999999997 23.47 55-59 20.39 28.485 27.295 23.830000000000002 60-64 20.035 28.410000000000004 27.145000000000003 24.41 65-69 20.635 27.875 27.38 24.11 70-74 20.044999999999998 28.849999999999998 27.12 23.985 75-79 20.02 28.470000000000002 27.515 23.995 80-84 20.44 28.299999999999997 27.21 24.05 85-89 20.25 28.199999999999996 27.54 24.01 90-94 21.05 28.044999999999998 27.310000000000002 23.595 95-99 20.119999999999997 27.96 27.779999999999998 24.14 100-104 20.435 28.105000000000004 27.675 23.785 105-109 20.805 27.750000000000004 27.35 24.095 110-114 20.625 28.16 27.1 24.115000000000002 115-119 20.84 28.79 26.605 23.765 120-124 20.815 28.08 26.96 24.145 125-129 20.599999999999998 27.435 27.310000000000002 24.654999999999998 130-134 21.765 27.47 26.740000000000002 24.025 135-139 21.055 28.525 26.784999999999997 23.635 140-144 20.68 27.985 26.865 24.47 145-149 21.21 27.99 26.86 23.94 150-151 20.1625 27.5875 27.575 24.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.5 16 0.5 17 0.0 18 0.0 19 1.5 20 2.0 21 1.0 22 1.5 23 2.0 24 1.5 25 2.0 26 2.5 27 5.0 28 10.0 29 13.0 30 17.5 31 27.5 32 33.5 33 39.5 34 48.5 35 66.0 36 96.0 37 109.0 38 116.0 39 141.5 40 173.0 41 210.0 42 235.5 43 244.5 44 274.5 45 284.5 46 248.0 47 228.0 48 229.5 49 218.5 50 190.0 51 163.0 52 128.0 53 94.0 54 81.5 55 65.0 56 48.5 57 38.5 58 27.0 59 17.5 60 12.5 61 9.0 62 8.5 63 10.0 64 6.5 65 3.0 66 3.5 67 2.5 68 1.5 69 2.0 70 1.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.35 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.6499999999999999 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 0.8 0.0 0.0 0.0 0.0 106-107 0.8625 0.0 0.0 0.0 0.0 108-109 1.075 0.0 0.0 0.0 0.0 110-111 1.3624999999999998 0.0 0.0 0.0 0.0 112-113 1.5375 0.0 0.0 0.0 0.0 114-115 1.75 0.0 0.0 0.0 0.0 116-117 1.9500000000000002 0.0 0.0 0.0 0.0 118-119 2.1125 0.0 0.0 0.0 0.0 120-121 2.4125 0.0 0.0 0.0 0.0 122-123 2.7125 0.0 0.0 0.0 0.0 124-125 3.1125 0.0 0.0 0.0 0.0 126-127 3.4125 0.0 0.0 0.0 0.0 128-129 3.7375 0.0 0.0 0.0 0.0 130-131 4.05 0.0 0.0 0.0 0.0 132-133 4.525 0.0 0.0 0.0 0.0 134-135 5.012499999999999 0.0 0.0 0.0 0.0 136-137 5.3875 0.0 0.0 0.0 0.0 138-139 5.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCACTA 10 0.006577216 146.82278 1 >>END_MODULE SRR7169613 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169613_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.71 33.0 33.0 34.0 32.0 34.0 2 32.7905 33.0 33.0 34.0 32.0 34.0 3 32.8425 34.0 33.0 34.0 32.0 34.0 4 32.814 34.0 33.0 34.0 32.0 34.0 5 32.80375 34.0 33.0 34.0 32.0 34.0 6 36.97575 38.0 38.0 38.0 36.0 38.0 7 36.982 38.0 38.0 38.0 37.0 38.0 8 36.8525 38.0 38.0 38.0 36.0 38.0 9 36.87125 38.0 38.0 38.0 36.0 38.0 10-14 36.895500000000006 38.0 38.0 38.0 36.0 38.0 15-19 36.83465 38.0 38.0 38.0 36.0 38.0 20-24 36.708999999999996 38.0 38.0 38.0 36.0 38.0 25-29 36.69625 38.0 38.0 38.0 35.6 38.0 30-34 36.597300000000004 38.0 38.0 38.0 35.6 38.0 35-39 36.63725 38.0 38.0 38.0 35.8 38.0 40-44 36.66289999999999 38.0 38.0 38.0 35.8 38.0 45-49 36.6644 38.0 38.0 38.0 35.8 38.0 50-54 36.63915000000001 38.0 38.0 38.0 36.0 38.0 55-59 36.65325 38.0 38.0 38.0 36.0 38.0 60-64 36.517900000000004 38.0 38.0 38.0 35.0 38.0 65-69 36.5335 38.0 38.0 38.0 35.0 38.0 70-74 36.4435 38.0 38.0 38.0 34.4 38.0 75-79 36.38885 38.0 38.0 38.0 34.4 38.0 80-84 36.17695 38.0 38.0 38.0 34.0 38.0 85-89 36.09795 38.0 38.0 38.0 33.8 38.0 90-94 35.98475 38.0 38.0 38.0 33.4 38.0 95-99 35.97135 38.0 38.0 38.0 33.2 38.0 100-104 35.93150000000001 38.0 38.0 38.0 33.2 38.0 105-109 35.836400000000005 38.0 38.0 38.0 33.0 38.0 110-114 35.6646 38.0 37.2 38.0 32.8 38.0 115-119 35.42935 38.0 37.0 38.0 30.8 38.0 120-124 35.165 38.0 36.4 38.0 29.6 38.0 125-129 34.83925 38.0 36.0 38.0 28.0 38.0 130-134 34.6494 38.0 35.4 38.0 27.6 38.0 135-139 34.3801 38.0 35.4 38.0 25.0 38.0 140-144 33.851749999999996 38.0 35.0 38.0 23.0 38.0 145-149 33.40085 38.0 35.0 38.0 18.2 38.0 150-151 29.611125 36.5 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 2.0 4 5.0 5 3.0 6 2.0 7 3.0 8 2.0 9 2.0 10 2.0 11 2.0 12 9.0 13 3.0 14 3.0 15 2.0 16 8.0 17 3.0 18 7.0 19 5.0 20 4.0 21 6.0 22 15.0 23 11.0 24 10.0 25 22.0 26 23.0 27 27.0 28 31.0 29 30.0 30 61.0 31 61.0 32 77.0 33 101.0 34 136.0 35 218.0 36 531.0 37 2555.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.928446334751065 23.817863397548162 13.385038779084313 24.86865148861646 2 30.01251564455569 26.958698372966204 26.33291614518148 16.69586983729662 3 20.906359539308962 30.39559339008513 29.644466700050074 19.053580370555835 4 23.128911138923655 34.51814768460576 22.478097622027533 19.874843554443054 5 23.979974968710888 37.596996245306634 21.35168961201502 17.07133917396746 6 21.256885327991988 37.70655983975964 23.084626940410615 17.95192789183776 7 21.26220886551465 21.61282243926872 37.365389431505136 19.759579263711498 8 23.59128474830954 25.79514149762084 26.045579764588027 24.567993989481593 9 22.49247743229689 26.253761283851556 27.607823470411237 23.64593781344032 10-14 23.914458857114237 28.6673010467271 25.592227174838484 21.826012921320178 15-19 24.05145660226249 27.815597156872563 26.624286715386923 21.508659525478027 20-24 23.805229936880075 28.27372006812945 26.926159703436532 20.994890291553954 25-29 24.435318275154007 27.92607802874743 26.874342665397904 20.764261030700656 30-34 23.765895664363672 28.266746770802044 26.919995994793233 21.047361570041055 35-39 23.627888326399678 28.169014084507044 26.63525637812641 21.56784121096687 40-44 24.270384113930398 27.835723598435465 27.023367766522917 20.87052452111122 45-49 23.60575236759032 27.273638322393147 27.183444405471764 21.93716490454477 50-54 23.79592041297048 27.90557810855511 27.088658347115725 21.209843131358692 55-59 24.10495218066196 27.019177807821343 27.79029592909719 21.08557408241951 60-64 23.820979301358193 27.92562521926527 27.279105898862326 20.974289580514206 65-69 24.292228290825275 27.268627549230846 27.75968331913614 20.679460840807735 70-74 23.849624060150376 27.00751879699248 27.984962406015036 21.157894736842106 75-79 24.285714285714285 27.598997493734334 27.273182957393484 20.842105263157894 80-84 23.537074148296593 27.92084168336673 27.324649298597194 21.217434869739478 85-89 24.381802678437076 27.406329939308822 27.476551136078648 20.735316246175454 90-94 24.042510527371164 27.491477842390218 27.431321435732908 21.034690194505714 95-99 24.416391143172028 28.27372006812945 27.171626089570182 20.138262699128344 100-104 24.512799959921846 27.663944692149695 27.288212013426183 20.53504333450228 105-109 24.584251652975357 27.694850731316368 27.35924664395913 20.36165097174915 110-114 24.100250626566417 27.92982456140351 27.2531328320802 20.716791979949875 115-119 24.763240968081373 27.804780277596837 27.063185849576588 20.368792904745202 120-124 24.597643519679117 27.841564301830036 26.98420656806217 20.57658561042868 125-129 24.62248532584157 27.436913660763558 27.31149350323584 20.629107510159034 130-134 24.521957340025093 28.095357590966124 27.091593475533248 20.29109159347553 135-139 24.55999598856742 27.247655819084393 27.11226996941283 21.080078222935366 140-144 25.205575611712796 27.782791817087848 26.810068190934615 20.20156438026474 145-149 24.635356623728132 27.77304395769636 27.2116685880407 20.37993083053481 150-151 24.96871088861076 28.02252816020025 26.583229036295368 20.425531914893615 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 3.0 1 1.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 1.5 24 2.0 25 1.5 26 2.0 27 3.0 28 5.0 29 8.0 30 9.5 31 10.0 32 11.0 33 17.0 34 29.0 35 39.0 36 58.0 37 76.5 38 96.0 39 125.5 40 171.0 41 228.5 42 246.0 43 273.5 44 292.0 45 287.5 46 299.0 47 283.5 48 260.0 49 231.0 50 197.5 51 172.5 52 139.0 53 105.0 54 78.0 55 58.5 56 44.5 57 34.0 58 26.5 59 18.5 60 15.0 61 10.0 62 6.0 63 5.5 64 4.0 65 2.5 66 2.0 67 0.5 68 0.0 69 0.0 70 0.5 71 0.5 72 1.0 73 1.0 74 0.0 75 0.0 76 0.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.125 3 0.15 4 0.125 5 0.125 6 0.15 7 0.17500000000000002 8 0.17500000000000002 9 0.3 10-14 0.165 15-19 0.11 20-24 0.19 25-29 0.165 30-34 0.13 35-39 0.245 40-44 0.29 45-49 0.215 50-54 0.23500000000000001 55-59 0.145 60-64 0.23500000000000001 65-69 0.215 70-74 0.25 75-79 0.25 80-84 0.2 85-89 0.315 90-94 0.26 95-99 0.19 100-104 0.19499999999999998 105-109 0.18 110-114 0.25 115-119 0.215 120-124 0.27499999999999997 125-129 0.335 130-134 0.375 135-139 0.28500000000000003 140-144 0.27999999999999997 145-149 0.245 150-151 0.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47209653092006 98.925 2 0.5027652086475616 1.0 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.45 0.0 0.0 0.0 0.0 100-101 0.6000000000000001 0.0 0.0 0.0 0.0 102-103 0.6875 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 0.8125 0.0 0.0 0.0 0.0 108-109 1.0 0.0 0.0 0.0 0.0 110-111 1.2875 0.0 0.0 0.0 0.0 112-113 1.45 0.0 0.0 0.0 0.0 114-115 1.65 0.0 0.0 0.0 0.0 116-117 1.85 0.0 0.0 0.0 0.0 118-119 2.0 0.0 0.0 0.0 0.0 120-121 2.325 0.0 0.0 0.0 0.0 122-123 2.625 0.0 0.0 0.0 0.0 124-125 2.9875 0.0 0.0 0.0 0.0 126-127 3.2625 0.0 0.0 0.0 0.0 128-129 3.5875 0.0 0.0 0.0 0.0 130-131 3.9000000000000004 0.0 0.0 0.0 0.0 132-133 4.3375 0.0 0.0 0.0 0.0 134-135 4.800000000000001 0.0 0.0 0.0 0.0 136-137 5.1875 0.0 0.0 0.0 0.0 138-139 5.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACAGGT 10 0.00682755 145.0 6 AAGCAAC 10 0.00682755 145.0 7 >>END_MODULE Read 974594 spots for SRR7169613.sra Written 974594 spots for SRR7169613.sra Read 974594 spots for SRR7169613.sra Written 974594 spots for SRR7169613.sra Read 974594 spots for SRR7169613.sra Written 974594 spots for SRR7169613.sra Read 974594 spots for SRR7169613.sra Written 974594 spots for SRR7169613.sra Read 974594 spots for SRR7169613.sra Written 974594 spots for SRR7169613.sra Read 974594 spots for SRR7169613.sra Written 974594 spots for SRR7169613.sra Read 974594 spots for SRR7169613.sra Written 974594 spots for SRR7169613.sra Read 974594 spots for SRR7169613.sra Written 974594 spots for SRR7169613.sra Read 974594 spots for SRR7169613.sra Written 974594 spots for SRR7169613.sra Read 974594 spots for SRR7169613.sra Written 974594 spots for SRR7169613.sra Read 974594 spots for SRR7169613.sra Written 974594 spots for SRR7169613.sra Read 974594 spots for SRR7169613.sra Written 974594 spots for SRR7169613.sra Read 974594 spots for SRR7169613.sra Written 974594 spots for SRR7169613.sra Read 974594 spots for SRR7169613.sra Written 974594 spots for SRR7169613.sra Read 974594 spots for SRR7169613.sra Written 974594 spots for SRR7169613.sra Read 974594 spots for SRR7169613.sra Written 974594 spots for SRR7169613.sra Read 974594 spots for SRR7169613.sra Written 974594 spots for SRR7169613.sra Read 974594 spots for SRR7169613.sra Written 974594 spots for SRR7169613.sra Read 974595 spots for SRR7169613.sra Written 974595 spots for SRR7169613.sra Read 974594 spots for SRR7169613.sra Written 974594 spots for SRR7169613.sra SRR ids: ['SRR7169613.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_amxdhojy SRR7169613.sra spots: 19491881 blocks: [[1, 974594], [974595, 1949188], [1949189, 2923782], [2923783, 3898376], [3898377, 4872970], [4872971, 5847564], [5847565, 6822158], [6822159, 7796752], [7796753, 8771346], [8771347, 9745940], [9745941, 10720534], [10720535, 11695128], [11695129, 12669722], [12669723, 13644316], [13644317, 14618910], [14618911, 15593504], [15593505, 16568098], [16568099, 17542692], [17542693, 18517286], [18517287, 19491881]] SRR7169613 file size 6583458 SRR7169613 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169613 SRR7169613_1.fastq SRR7169613_2.fastq Input file: SRR7169613_1.fastq Paired file: SRR7169613_2.fastq trimmed: SRR7169613-trimmed-pair1.fastq, SRR7169613-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:01:09 2025 >> started Tue Feb 11 10:01:32 2025 >> done (22.294s) 19491881 read pairs processed; of these: 37390 ( 0.19%) short read pairs filtered out after trimming by size control 73021 ( 0.37%) empty read pairs filtered out after trimming by size control 19381470 (99.43%) read pairs available; of these: 9768092 (50.40%) trimmed read pairs available after processing 9613378 (49.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 9 0.00% 20 5 0.00% 21 11 0.00% 22 11 0.00% 23 22 0.00% 24 25 0.00% 25 28 0.00% 26 21 0.00% 27 33 0.00% 28 22 0.00% 29 1003 0.01% 30 37 0.00% 31 68 0.00% 32 16 0.00% 33 29 0.00% 34 35 0.00% 35 58 0.00% 36 45 0.00% 37 34 0.00% 38 48 0.00% 39 46 0.00% 40 58 0.00% 41 47 0.00% 42 47 0.00% 43 47 0.00% 44 44 0.00% 45 67 0.00% 46 70 0.00% 47 82 0.00% 48 87 0.00% 49 81 0.00% 50 110 0.00% 51 102 0.00% 52 116 0.00% 53 129 0.00% 54 144 0.00% 55 159 0.00% 56 188 0.00% 57 195 0.00% 58 182 0.00% 59 252 0.00% 60 272 0.00% 61 331 0.00% 62 352 0.00% 63 362 0.00% 64 387 0.00% 65 507 0.00% 66 516 0.00% 67 706 0.00% 68 1249 0.01% 69 2711 0.01% 70 3226 0.02% 71 1721 0.01% 72 1329 0.01% 73 1319 0.01% 74 1406 0.01% 75 1410 0.01% 76 1616 0.01% 77 1763 0.01% 78 1983 0.01% 79 2276 0.01% 80 2537 0.01% 81 2795 0.01% 82 3198 0.02% 83 3771 0.02% 84 5735 0.03% 85 6324 0.03% 86 6480 0.03% 87 7040 0.04% 88 7301 0.04% 89 7642 0.04% 90 7820 0.04% 91 8587 0.04% 92 9412 0.05% 93 9898 0.05% 94 10675 0.06% 95 10891 0.06% 96 11609 0.06% 97 12356 0.06% 98 12771 0.07% 99 13335 0.07% 100 14338 0.07% 101 15317 0.08% 102 16511 0.09% 103 17865 0.09% 104 18820 0.10% 105 19967 0.10% 106 21237 0.11% 107 21419 0.11% 108 22051 0.11% 109 22730 0.12% 110 23828 0.12% 111 25500 0.13% 112 27184 0.14% 113 29318 0.15% 114 30814 0.16% 115 32240 0.17% 116 33955 0.18% 117 34791 0.18% 118 36019 0.19% 119 36475 0.19% 120 38384 0.20% 121 39877 0.21% 122 42562 0.22% 123 44951 0.23% 124 47563 0.25% 125 49962 0.26% 126 52828 0.27% 127 54781 0.28% 128 57356 0.30% 129 59501 0.31% 130 62195 0.32% 131 65747 0.34% 132 70421 0.36% 133 74784 0.39% 134 79382 0.41% 135 84374 0.44% 136 90466 0.47% 137 95317 0.49% 138 101724 0.52% 139 108602 0.56% 140 116508 0.60% 141 127349 0.66% 142 142769 0.74% 143 159953 0.83% 144 185381 0.96% 145 221686 1.14% 146 274126 1.41% 147 370792 1.91% 148 569346 2.94% 149 1049609 5.42% 150 4539983 23.42% 151 9613378 49.60% 19381470 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.88 fanout-score-rank=33 prefix-density=0.22 prefix-fanout=2.5 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.11 sequence-density-rank=21 fanout-score=52.81 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=13.1 sequence=CCTTCCTTGTCCTGGATCTTGGCCTTCACGTTGTCAATGGT criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=41 prefix-density=0.20 prefix-fanout=2.0 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.10 sequence-density-rank=26 fanout-score=48.39 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=10.7 sequence=TCAAGGAAGCTTTCAG SRR7169613 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:02:18 Started mapping on | Feb 11 10:02:18 Finished on | Feb 11 10:04:33 Mapping speed, Million of reads per hour | 516.84 Number of input reads | 19381470 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 18248015 Uniquely mapped reads % | 94.15% Average mapped length | 293.77 Number of splices: Total | 16464360 Number of splices: Annotated (sjdb) | 16187435 Number of splices: GT/AG | 16235089 Number of splices: GC/AG | 182452 Number of splices: AT/AC | 13948 Number of splices: Non-canonical | 32871 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 309773 % of reads mapped to multiple loci | 1.60% Number of reads mapped to too many loci | 48543 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.94% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 853644 853644 853644 N_multimapping 309773 309773 309773 N_noFeature 364834 18005326 457054 N_ambiguous 221714 1439 70207 UnstrandedReadsAssigned:17661467 PositiveStrandReadsAssigned:241250 NegativeStrandReadsAssigned:17720754 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169613 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169613-trimmed-pair1.fastq SRR7169613-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,381,470 reads, 17,657,423 reads pseudoaligned [quant] estimated average fragment length: 241.407 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,061 rounds 52401 SRR7169613.ke.tsv 34699 SRR7169613.se.tsv 87100 total ==> SRR7169613.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.59 319 9.35959 Potri.005G024800.1.v4.1 1035 794.593 34 2.23169 Potri.004G059700.1.v4.1 961 720.62 5 0.361878 Potri.007G009000.2.v4.1 1416 1175.59 0 0 Potri.003G141000.2.v4.1 2943 2702.59 303 5.84737 Potri.016G087400.1.v4.1 270 77.5828 1436 965.356 Potri.015G069301.1.v4.1 564 327.445 0 0 Potri.010G195200.1.v4.1 1773 1532.59 44 1.49735 Potri.012G127500.1.v4.1 977 736.604 5099 361.035 ==> SRR7169613.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1784 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 334 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 22 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169613 completed mapping pipeline successfully