Starting /dee2/code/volunteer_pipeline.sh SRR7169614 current disk space = 3054146547712 free memory = 1413589680 SRR7169614 SRAfilesize b8629b0b4719c026a3276c2e111e9cd2 SRR7169614.sra SRR7169614.sra file validated SRR7169614 is paired end SRR7169614 is conventional basespace SRR7169614 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169614_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8705 34.0 33.0 34.0 33.0 34.0 2 33.379 34.0 34.0 34.0 33.0 34.0 3 33.405 34.0 34.0 34.0 33.0 34.0 4 33.4465 34.0 34.0 34.0 33.0 34.0 5 33.46025 34.0 34.0 34.0 33.0 34.0 6 37.10125 38.0 37.0 38.0 36.0 38.0 7 37.239 38.0 38.0 38.0 37.0 38.0 8 37.036 38.0 38.0 38.0 36.0 38.0 9 37.4215 38.0 38.0 38.0 37.0 38.0 10-14 37.475049999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.489149999999995 38.0 38.0 38.0 37.4 38.0 20-24 37.505100000000006 38.0 38.0 38.0 37.4 38.0 25-29 37.46145 38.0 38.0 38.0 37.0 38.0 30-34 37.4571 38.0 38.0 38.0 37.2 38.0 35-39 37.3322 38.0 38.0 38.0 36.8 38.0 40-44 37.24225 38.0 38.0 38.0 37.0 38.0 45-49 37.28294999999999 38.0 38.0 38.0 37.0 38.0 50-54 37.268299999999996 38.0 38.0 38.0 36.8 38.0 55-59 37.1622 38.0 38.0 38.0 36.2 38.0 60-64 37.165000000000006 38.0 38.0 38.0 36.2 38.0 65-69 37.1051 38.0 38.0 38.0 36.0 38.0 70-74 37.035199999999996 38.0 38.0 38.0 36.0 38.0 75-79 36.9804 38.0 38.0 38.0 36.0 38.0 80-84 36.9089 38.0 38.0 38.0 35.8 38.0 85-89 36.841100000000004 38.0 38.0 38.0 35.4 38.0 90-94 36.7247 38.0 38.0 38.0 35.0 38.0 95-99 36.6317 38.0 38.0 38.0 34.4 38.0 100-104 36.54245 38.0 38.0 38.0 34.2 38.0 105-109 36.34055 38.0 38.0 38.0 34.0 38.0 110-114 36.2207 38.0 38.0 38.0 33.8 38.0 115-119 36.1121 38.0 37.0 38.0 33.2 38.0 120-124 35.94955 38.0 37.0 38.0 33.0 38.0 125-129 35.80765 38.0 36.6 38.0 32.0 38.0 130-134 35.50135 38.0 36.0 38.0 31.0 38.0 135-139 35.21955 38.0 36.0 38.0 30.4 38.0 140-144 34.7842 38.0 35.4 38.0 27.8 38.0 145-149 34.142950000000006 38.0 35.0 38.0 25.6 38.0 150-151 30.738625 36.5 29.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 0.0 17 2.0 18 7.0 19 3.0 20 6.0 21 5.0 22 6.0 23 3.0 24 9.0 25 5.0 26 17.0 27 23.0 28 28.0 29 29.0 30 53.0 31 46.0 32 52.0 33 90.0 34 125.0 35 225.0 36 591.0 37 2672.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.83014537107881 13.593471053302727 8.824279520530478 31.752104055087987 2 23.875 15.575 30.925000000000004 29.625 3 20.025000000000002 21.0 26.450000000000003 32.525 4 24.25 26.575 24.0 25.174999999999997 5 21.475 32.7 23.275000000000002 22.55 6 20.625 33.35 26.3 19.725 7 15.0 27.950000000000003 39.775 17.275 8 17.775 25.825 30.625000000000004 25.775 9 16.75 25.2 33.025 25.025 10-14 20.145 29.195 27.11 23.549999999999997 15-19 19.7 29.555 26.939999999999998 23.805 20-24 19.74 29.515 26.790000000000003 23.955000000000002 25-29 20.055 29.015 27.245 23.685000000000002 30-34 20.385 28.325 27.060000000000002 24.23 35-39 20.685000000000002 28.62 27.495000000000005 23.200000000000003 40-44 20.34 28.58 27.015 24.065 45-49 20.515 28.48 27.215 23.79 50-54 20.015 28.825 27.015 24.145 55-59 20.855 28.34 26.985 23.82 60-64 20.695 28.835 26.640000000000004 23.830000000000002 65-69 20.674999999999997 28.585 27.125 23.615 70-74 20.66 28.675 27.125 23.54 75-79 20.77 28.810000000000002 26.685 23.735 80-84 20.715 29.195 26.740000000000002 23.35 85-89 20.465 28.71 26.82 24.005000000000003 90-94 20.745 28.205000000000002 27.095000000000002 23.955000000000002 95-99 21.035 28.294999999999998 26.72 23.95 100-104 21.165 28.075 27.034999999999997 23.724999999999998 105-109 20.485 28.494999999999997 26.91 24.11 110-114 20.990000000000002 27.994999999999997 26.810000000000002 24.205 115-119 20.54 28.449999999999996 26.945000000000004 24.065 120-124 20.445 28.095 26.88 24.58 125-129 21.075 27.83 27.305 23.79 130-134 21.17 27.725 26.900000000000002 24.205 135-139 21.04 27.77 27.095000000000002 24.095 140-144 20.79 27.83 26.505000000000003 24.875 145-149 21.745 27.700000000000003 26.56 23.995 150-151 20.875 28.212500000000002 27.05 23.8625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.0 22 0.5 23 1.0 24 2.0 25 5.0 26 5.5 27 6.5 28 10.0 29 13.5 30 21.0 31 27.5 32 29.5 33 40.0 34 57.5 35 63.0 36 72.5 37 97.5 38 122.5 39 147.0 40 163.0 41 181.0 42 219.5 43 250.0 44 260.5 45 274.0 46 273.0 47 248.5 48 233.0 49 220.0 50 205.5 51 172.5 52 129.5 53 106.0 54 85.0 55 61.0 56 38.5 57 26.0 58 21.5 59 22.0 60 21.0 61 14.0 62 10.0 63 10.0 64 8.0 65 6.0 66 5.5 67 3.0 68 1.5 69 2.5 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.975 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67369477911646 99.275 2 0.30120481927710846 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0251004016064257 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCTATATCTCGTATGC 5 0.125 TruSeq Adapter, Index 15 (97% over 37bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.025 0.0 0.0 0.0 62-63 0.05 0.025 0.0 0.0 0.0 64-65 0.05 0.025 0.0 0.0 0.0 66-67 0.05 0.025 0.0 0.0 0.0 68-69 0.05 0.025 0.0 0.0 0.0 70-71 0.05 0.025 0.0 0.0 0.0 72-73 0.05 0.025 0.0 0.0 0.0 74-75 0.05 0.025 0.0 0.0 0.0 76-77 0.05 0.025 0.0 0.0 0.0 78-79 0.07500000000000001 0.025 0.0 0.0 0.0 80-81 0.1 0.025 0.0 0.0 0.0 82-83 0.15 0.025 0.0 0.0 0.0 84-85 0.2 0.025 0.0 0.0 0.0 86-87 0.2625 0.025 0.0 0.0 0.0 88-89 0.3125 0.025 0.0 0.0 0.0 90-91 0.4875 0.025 0.0 0.0 0.0 92-93 0.55 0.025 0.0 0.0 0.0 94-95 0.6 0.025 0.0 0.0 0.0 96-97 0.6875 0.025 0.0 0.0 0.0 98-99 0.85 0.025 0.0 0.0 0.0 100-101 0.925 0.025 0.0 0.0 0.0 102-103 1.1125 0.025 0.0 0.0 0.0 104-105 1.3875000000000002 0.025 0.0 0.0 0.0 106-107 1.6625 0.025 0.0 0.0 0.0 108-109 1.9625 0.025 0.0 0.0 0.0 110-111 2.0875 0.025 0.0 0.0 0.0 112-113 2.2625 0.025 0.0 0.0 0.0 114-115 2.4125 0.025 0.0 0.0 0.0 116-117 2.7125 0.025 0.0 0.0 0.0 118-119 3.0875 0.025 0.0 0.0 0.0 120-121 3.3499999999999996 0.025 0.0 0.0 0.0 122-123 3.675 0.025 0.0 0.0 0.0 124-125 4.025 0.025 0.0 0.0 0.0 126-127 4.387499999999999 0.025 0.0 0.0 0.0 128-129 4.6625 0.025 0.0 0.0 0.0 130-131 5.125 0.025 0.0 0.0 0.0 132-133 5.4125 0.025 0.0 0.0 0.0 134-135 5.85 0.025 0.0 0.0 0.0 136-137 6.2875 0.025 0.0 0.0 0.0 138-139 6.7875 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169614 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169614_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8515 33.0 33.0 34.0 32.0 34.0 2 32.944 34.0 33.0 34.0 32.0 34.0 3 32.93375 34.0 33.0 34.0 32.0 34.0 4 32.93275 34.0 33.0 34.0 32.0 34.0 5 32.95975 34.0 33.0 34.0 33.0 34.0 6 36.971 38.0 38.0 38.0 37.0 38.0 7 37.10225 38.0 38.0 38.0 37.0 38.0 8 37.081 38.0 38.0 38.0 37.0 38.0 9 37.11275 38.0 38.0 38.0 37.0 38.0 10-14 37.04585 38.0 38.0 38.0 37.0 38.0 15-19 36.99905 38.0 38.0 38.0 37.0 38.0 20-24 36.9864 38.0 38.0 38.0 37.0 38.0 25-29 36.85865 38.0 38.0 38.0 36.2 38.0 30-34 36.77935 38.0 38.0 38.0 36.0 38.0 35-39 36.7784 38.0 38.0 38.0 36.0 38.0 40-44 36.83975 38.0 38.0 38.0 36.4 38.0 45-49 36.8748 38.0 38.0 38.0 36.2 38.0 50-54 36.84439999999999 38.0 38.0 38.0 36.2 38.0 55-59 36.8332 38.0 38.0 38.0 36.0 38.0 60-64 36.7871 38.0 38.0 38.0 36.0 38.0 65-69 36.6617 38.0 38.0 38.0 36.0 38.0 70-74 36.613249999999994 38.0 38.0 38.0 35.6 38.0 75-79 36.4458 38.0 38.0 38.0 34.8 38.0 80-84 36.37670000000001 38.0 38.0 38.0 34.4 38.0 85-89 36.2577 38.0 38.0 38.0 34.2 38.0 90-94 36.17315 38.0 38.0 38.0 34.0 38.0 95-99 36.185500000000005 38.0 38.0 38.0 34.0 38.0 100-104 36.0334 38.0 38.0 38.0 33.6 38.0 105-109 35.92275 38.0 38.0 38.0 33.4 38.0 110-114 35.7429 38.0 37.8 38.0 32.2 38.0 115-119 35.58435000000001 38.0 37.2 38.0 31.2 38.0 120-124 35.38725 38.0 37.0 38.0 30.6 38.0 125-129 35.091800000000006 38.0 36.2 38.0 28.6 38.0 130-134 34.792649999999995 38.0 36.0 38.0 27.6 38.0 135-139 34.51655 38.0 35.8 38.0 26.0 38.0 140-144 33.9679 38.0 34.6 38.0 22.8 38.0 145-149 33.404900000000005 38.0 33.2 38.0 20.4 38.0 150-151 28.796 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 5.0 4 2.0 5 2.0 6 3.0 7 3.0 8 2.0 9 3.0 10 0.0 11 2.0 12 3.0 13 0.0 14 2.0 15 4.0 16 8.0 17 10.0 18 9.0 19 4.0 20 10.0 21 6.0 22 14.0 23 12.0 24 14.0 25 11.0 26 19.0 27 21.0 28 25.0 29 25.0 30 42.0 31 75.0 32 61.0 33 92.0 34 128.0 35 204.0 36 503.0 37 2661.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.267267267267265 22.147147147147148 12.912912912912914 22.67267267267267 2 28.77877877877878 26.476476476476474 27.352352352352355 17.39239239239239 3 20.826032540675847 30.01251564455569 29.637046307884855 19.524405506883603 4 23.504380475594495 34.968710888610765 22.65331664580726 18.873591989987485 5 23.979974968710888 36.2953692115144 21.8523153942428 17.872340425531917 6 21.70212765957447 36.846057571964955 22.95369211514393 18.498122653316646 7 21.051314142678347 22.453066332916144 36.37046307884856 20.125156445556946 8 23.34834834834835 24.924924924924923 26.426426426426424 25.3003003003003 9 22.67267267267267 25.55055055055055 28.37837837837838 23.3983983983984 10-14 24.20905086103324 28.479175010012014 25.79595514617541 21.515818982779336 15-19 23.54825790949139 27.558069683620346 26.972366840208252 21.921305566680015 20-24 23.15778934721666 28.273928714457348 26.81718061674009 21.751101321585903 25-29 23.92610393511565 28.20666866927005 26.985080604786223 20.882146790828077 30-34 24.245306633291612 27.749687108886107 26.938673341677095 21.066332916145182 35-39 23.484355444305383 27.68961201501877 27.434292866082604 21.39173967459324 40-44 24.30781555099384 27.737445551494517 26.906323536774646 21.048415360736993 45-49 24.06387665198238 27.573087705246298 27.237685222266723 21.125350420504603 50-54 23.755882647441673 27.8712326023831 27.350555722439168 21.022329027736056 55-59 23.863636363636363 27.35782939527433 27.53303964757709 21.245494593512216 60-64 23.81858229875851 27.377853424108935 27.88346015218262 20.92010412494994 65-69 23.519399249061326 27.754693366708384 27.794743429286605 20.93116395494368 70-74 24.25531914893617 27.349186483103882 27.574468085106385 20.821026282853566 75-79 23.11389236545682 27.244055068836044 28.55569461827284 21.08635794743429 80-84 24.155193992490613 27.384230287859822 27.028785982478098 21.431789737171464 85-89 24.310387984981226 27.284105131414265 27.51439299123905 20.891113892365457 90-94 24.07388866639968 27.267721265518624 27.733279935923104 20.92511013215859 95-99 24.043661125575806 27.313238533947526 27.588624073703183 21.054476266773484 100-104 24.064064064064063 28.043043043043042 26.916916916916918 20.975975975975977 105-109 24.3469122209989 27.57481733560204 27.499749774797316 20.57852066860174 110-114 24.653351354057165 27.446563548080295 27.09115482805226 20.808930269810283 115-119 23.948738486183423 27.613135762915498 27.23267921505807 21.205446535843013 120-124 24.480600750938674 27.163954943679595 27.359198998748436 20.99624530663329 125-129 23.989785188523356 28.25597115817936 26.94907616043263 20.805167492864655 130-134 24.94743166115951 27.721037348553118 27.090217282467204 20.241313707820165 135-139 25.095133186461045 27.62367314239936 26.922691768475865 20.35850190266373 140-144 24.88610763454318 27.894868585732162 26.703379224030037 20.515644555694617 145-149 25.832290362953692 28.290362953692117 26.548185231539424 19.32916145181477 150-151 25.39404553415061 27.383037277958465 26.36977733299975 20.853139854891168 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 4.0 1 2.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.5 22 0.5 23 0.0 24 0.5 25 1.5 26 1.5 27 1.5 28 3.0 29 5.0 30 8.5 31 10.0 32 12.5 33 19.0 34 25.0 35 43.0 36 60.5 37 78.5 38 116.0 39 148.5 40 173.5 41 206.0 42 249.5 43 279.0 44 277.0 45 282.5 46 279.5 47 285.5 48 271.0 49 226.0 50 198.5 51 162.5 52 132.0 53 105.0 54 81.5 55 63.5 56 44.5 57 33.0 58 26.5 59 20.5 60 15.5 61 10.0 62 9.0 63 6.5 64 4.0 65 4.5 66 2.0 67 0.0 68 1.0 69 1.5 70 0.5 71 0.0 72 0.5 73 0.5 74 1.0 75 1.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.1 3 0.125 4 0.125 5 0.125 6 0.125 7 0.125 8 0.1 9 0.1 10-14 0.12 15-19 0.12 20-24 0.12 25-29 0.13 30-34 0.125 35-39 0.125 40-44 0.135 45-49 0.12 50-54 0.13 55-59 0.12 60-64 0.12 65-69 0.125 70-74 0.125 75-79 0.125 80-84 0.125 85-89 0.125 90-94 0.12 95-99 0.13999999999999999 100-104 0.1 105-109 0.09 110-114 0.11499999999999999 115-119 0.12 120-124 0.125 125-129 0.145 130-134 0.13 135-139 0.13999999999999999 140-144 0.125 145-149 0.125 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26860025220681 98.4 2 0.6305170239596469 1.25 3 0.05044136191677175 0.15 4 0.05044136191677175 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.07500000000000001 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.6 0.0 0.0 0.0 0.0 94-95 0.65 0.0 0.0 0.0 0.0 96-97 0.7375 0.0 0.0 0.0 0.0 98-99 0.9 0.0 0.0 0.0 0.0 100-101 0.975 0.0 0.0 0.0 0.0 102-103 1.1625 0.0 0.0 0.0 0.0 104-105 1.4 0.0 0.0 0.0 0.0 106-107 1.6375000000000002 0.0 0.0 0.0 0.0 108-109 1.9375 0.0 0.0 0.0 0.0 110-111 2.0999999999999996 0.0 0.0 0.0 0.0 112-113 2.2625 0.0 0.0 0.0 0.0 114-115 2.4000000000000004 0.0 0.0 0.0 0.0 116-117 2.6625 0.0 0.0 0.0 0.0 118-119 3.0375 0.0 0.0 0.0 0.0 120-121 3.3 0.0 0.0 0.0 0.0 122-123 3.625 0.0 0.0 0.0 0.0 124-125 3.95 0.0 0.0 0.0 0.0 126-127 4.324999999999999 0.0 0.0 0.0 0.0 128-129 4.637499999999999 0.0 0.0 0.0 0.0 130-131 5.0875 0.0 0.0 0.0 0.0 132-133 5.387499999999999 0.0 0.0 0.0 0.0 134-135 5.824999999999999 0.0 0.0 0.0 0.0 136-137 6.25 0.0 0.0 0.0 0.0 138-139 6.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1380152 spots for SRR7169614.sra Written 1380152 spots for SRR7169614.sra Read 1380152 spots for SRR7169614.sra Written 1380152 spots for SRR7169614.sra Read 1380152 spots for SRR7169614.sra Written 1380152 spots for SRR7169614.sra Read 1380152 spots for SRR7169614.sra Written 1380152 spots for SRR7169614.sra Read 1380152 spots for SRR7169614.sra Written 1380152 spots for SRR7169614.sra Read 1380152 spots for SRR7169614.sra Written 1380152 spots for SRR7169614.sra Read 1380152 spots for SRR7169614.sra Written 1380152 spots for SRR7169614.sra Read 1380152 spots for SRR7169614.sra Written 1380152 spots for SRR7169614.sra Read 1380152 spots for SRR7169614.sra Written 1380152 spots for SRR7169614.sra Read 1380152 spots for SRR7169614.sra Written 1380152 spots for SRR7169614.sra Read 1380152 spots for SRR7169614.sra Written 1380152 spots for SRR7169614.sra Read 1380152 spots for SRR7169614.sra Written 1380152 spots for SRR7169614.sra Read 1380158 spots for SRR7169614.sra Written 1380158 spots for SRR7169614.sra Read 1380152 spots for SRR7169614.sra Written 1380152 spots for SRR7169614.sra Read 1380152 spots for SRR7169614.sra Written 1380152 spots for SRR7169614.sra Read 1380152 spots for SRR7169614.sra Written 1380152 spots for SRR7169614.sra Read 1380152 spots for SRR7169614.sra Written 1380152 spots for SRR7169614.sra Read 1380152 spots for SRR7169614.sra Written 1380152 spots for SRR7169614.sra Read 1380152 spots for SRR7169614.sra Written 1380152 spots for SRR7169614.sra Read 1380152 spots for SRR7169614.sra Written 1380152 spots for SRR7169614.sra SRR ids: ['SRR7169614.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7tjb1ocg SRR7169614.sra spots: 27603046 blocks: [[1, 1380152], [1380153, 2760304], [2760305, 4140456], [4140457, 5520608], [5520609, 6900760], [6900761, 8280912], [8280913, 9661064], [9661065, 11041216], [11041217, 12421368], [12421369, 13801520], [13801521, 15181672], [15181673, 16561824], [16561825, 17941976], [17941977, 19322128], [19322129, 20702280], [20702281, 22082432], [22082433, 23462584], [23462585, 24842736], [24842737, 26222888], [26222889, 27603046]] SRR7169614 file size 9332066 SRR7169614 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169614 SRR7169614_1.fastq SRR7169614_2.fastq Input file: SRR7169614_1.fastq Paired file: SRR7169614_2.fastq trimmed: SRR7169614-trimmed-pair1.fastq, SRR7169614-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:59:30 2025 >> started Tue Feb 11 10:00:09 2025 >> done (38.383s) 27603046 read pairs processed; of these: 70504 ( 0.26%) short read pairs filtered out after trimming by size control 144450 ( 0.52%) empty read pairs filtered out after trimming by size control 27388092 (99.22%) read pairs available; of these: 13490948 (49.26%) trimmed read pairs available after processing 13897144 (50.74%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 11 0.00% 20 19 0.00% 21 18 0.00% 22 17 0.00% 23 20 0.00% 24 19 0.00% 25 17 0.00% 26 24 0.00% 27 25 0.00% 28 13 0.00% 29 23 0.00% 30 39 0.00% 31 38 0.00% 32 22 0.00% 33 24 0.00% 34 35 0.00% 35 34 0.00% 36 30 0.00% 37 38 0.00% 38 39 0.00% 39 51 0.00% 40 61 0.00% 41 63 0.00% 42 88 0.00% 43 72 0.00% 44 93 0.00% 45 85 0.00% 46 122 0.00% 47 124 0.00% 48 140 0.00% 49 169 0.00% 50 162 0.00% 51 220 0.00% 52 240 0.00% 53 254 0.00% 54 256 0.00% 55 252 0.00% 56 329 0.00% 57 332 0.00% 58 460 0.00% 59 440 0.00% 60 498 0.00% 61 573 0.00% 62 670 0.00% 63 766 0.00% 64 936 0.00% 65 1111 0.00% 66 1182 0.00% 67 1487 0.01% 68 2299 0.01% 69 5158 0.02% 70 4906 0.02% 71 2857 0.01% 72 2570 0.01% 73 2659 0.01% 74 2853 0.01% 75 3269 0.01% 76 3436 0.01% 77 3679 0.01% 78 4152 0.02% 79 4560 0.02% 80 5212 0.02% 81 5968 0.02% 82 6619 0.02% 83 7767 0.03% 84 10866 0.04% 85 13004 0.05% 86 13433 0.05% 87 14405 0.05% 88 15096 0.06% 89 15740 0.06% 90 16284 0.06% 91 17265 0.06% 92 18246 0.07% 93 19925 0.07% 94 20953 0.08% 95 22134 0.08% 96 23404 0.09% 97 24121 0.09% 98 24691 0.09% 99 25662 0.09% 100 27568 0.10% 101 28801 0.11% 102 30581 0.11% 103 32094 0.12% 104 33999 0.12% 105 35825 0.13% 106 37211 0.14% 107 38173 0.14% 108 38975 0.14% 109 40415 0.15% 110 42392 0.15% 111 43886 0.16% 112 45793 0.17% 113 47920 0.17% 114 50093 0.18% 115 52738 0.19% 116 54212 0.20% 117 56179 0.21% 118 57434 0.21% 119 58616 0.21% 120 60726 0.22% 121 62026 0.23% 122 64685 0.24% 123 68520 0.25% 124 72063 0.26% 125 74705 0.27% 126 78522 0.29% 127 80270 0.29% 128 83835 0.31% 129 86152 0.31% 130 89968 0.33% 131 93945 0.34% 132 98749 0.36% 133 103917 0.38% 134 110997 0.41% 135 117753 0.43% 136 124354 0.45% 137 132775 0.48% 138 140773 0.51% 139 150088 0.55% 140 160850 0.59% 141 173403 0.63% 142 190080 0.69% 143 212499 0.78% 144 242724 0.89% 145 284662 1.04% 146 343773 1.26% 147 459090 1.68% 148 686681 2.51% 149 1381667 5.04% 150 6232854 22.76% 151 13897144 50.74% 27388092 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=42 prefix-density=0.28 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.15 sequence-density-rank=9 fanout-score=84.84 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=16.6 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=38 prefix-density=0.27 prefix-fanout=1.9 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=148.99 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=10.2 sequence=CTCTTCCTCTTCACAATTAGCAAACAGTAAGTTTGAACACACTCAAGATTTGAAATATCCTACAACGATGAGAAAGCAACTCCTCTCCCCATTCGTTCCTTTCTTGATGTTCTTCCTCTACAGCTCCACCACTTTTGCTCAAACCCCATCTCCAGCACCTTCAGGTCCAACCAACATAACGGCGATCCTTGCGAAAGCTGGTCAGTTCACAACCTTAATTCGGTTGTTGAAAAGCACCCAAGAGGCTGACCAAATCAACACACAACTCAACAATTCAAACCAAGGCCTAACAGT SRR7169614 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:00:51 Started mapping on | Feb 11 10:00:52 Finished on | Feb 11 10:03:40 Mapping speed, Million of reads per hour | 586.89 Number of input reads | 27388092 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 25297408 Uniquely mapped reads % | 92.37% Average mapped length | 292.72 Number of splices: Total | 22873453 Number of splices: Annotated (sjdb) | 22498945 Number of splices: GT/AG | 22550557 Number of splices: GC/AG | 258175 Number of splices: AT/AC | 18107 Number of splices: Non-canonical | 46614 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 481090 % of reads mapped to multiple loci | 1.76% Number of reads mapped to too many loci | 52029 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.64% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1665139 1665139 1665139 N_multimapping 481090 481090 481090 N_noFeature 468458 24978810 597420 N_ambiguous 286237 1874 95191 UnstrandedReadsAssigned:24542713 PositiveStrandReadsAssigned:316724 NegativeStrandReadsAssigned:24604797 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169614 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169614-trimmed-pair1.fastq SRR7169614-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,388,092 reads, 24,503,541 reads pseudoaligned [quant] estimated average fragment length: 238.662 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,175 rounds 52401 SRR7169614.ke.tsv 34699 SRR7169614.se.tsv 87100 total ==> SRR7169614.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1780.34 391 8.09018 Potri.005G024800.1.v4.1 1035 797.338 45 2.079 Potri.004G059700.1.v4.1 961 723.377 4 0.203694 Potri.007G009000.2.v4.1 1416 1178.34 0 0 Potri.003G141000.2.v4.1 2943 2705.34 485 6.60395 Potri.016G087400.1.v4.1 270 81.9431 2770 1245.23 Potri.015G069301.1.v4.1 564 330.653 0 0 Potri.010G195200.1.v4.1 1773 1535.34 6 0.143956 Potri.012G127500.1.v4.1 977 739.349 11287 562.358 ==> SRR7169614.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1666 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 437 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 2 SRR7169614 completed mapping pipeline successfully