Starting /dee2/code/volunteer_pipeline.sh SRR7169615 current disk space = 3054469935104 free memory = 1410670128 SRR7169615 SRAfilesize 9dac5e88783a6a2c64acb2eb3bf22447 SRR7169615.sra SRR7169615.sra file validated SRR7169615 is paired end SRR7169615 is conventional basespace SRR7169615 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169615_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.89675 34.0 33.0 34.0 33.0 34.0 2 33.42625 34.0 34.0 34.0 33.0 34.0 3 33.3755 34.0 34.0 34.0 33.0 34.0 4 33.45375 34.0 34.0 34.0 33.0 34.0 5 33.50375 34.0 34.0 34.0 33.0 34.0 6 37.096 38.0 38.0 38.0 36.0 38.0 7 37.16875 38.0 38.0 38.0 36.0 38.0 8 36.9675 38.0 38.0 38.0 36.0 38.0 9 37.38275 38.0 38.0 38.0 37.0 38.0 10-14 37.427350000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.4745 38.0 38.0 38.0 37.0 38.0 20-24 37.48795 38.0 38.0 38.0 37.0 38.0 25-29 37.466449999999995 38.0 38.0 38.0 37.4 38.0 30-34 37.4259 38.0 38.0 38.0 37.0 38.0 35-39 37.28945 38.0 38.0 38.0 36.8 38.0 40-44 37.24955 38.0 38.0 38.0 36.6 38.0 45-49 37.2639 38.0 38.0 38.0 37.0 38.0 50-54 37.2131 38.0 38.0 38.0 36.4 38.0 55-59 37.1151 38.0 38.0 38.0 36.0 38.0 60-64 37.1086 38.0 38.0 38.0 36.0 38.0 65-69 37.07575 38.0 38.0 38.0 36.0 38.0 70-74 37.010949999999994 38.0 38.0 38.0 36.0 38.0 75-79 36.864850000000004 38.0 38.0 38.0 36.0 38.0 80-84 36.85205 38.0 38.0 38.0 35.6 38.0 85-89 36.82175 38.0 38.0 38.0 35.2 38.0 90-94 36.6486 38.0 38.0 38.0 34.6 38.0 95-99 36.533950000000004 38.0 38.0 38.0 34.2 38.0 100-104 36.46585 38.0 38.0 38.0 34.0 38.0 105-109 36.1983 38.0 37.8 38.0 33.8 38.0 110-114 36.1023 38.0 37.6 38.0 33.2 38.0 115-119 36.0167 38.0 37.0 38.0 33.2 38.0 120-124 35.82175 38.0 37.0 38.0 32.6 38.0 125-129 35.723349999999996 38.0 36.6 38.0 31.8 38.0 130-134 35.349450000000004 38.0 36.0 38.0 29.8 38.0 135-139 35.09755 38.0 36.0 38.0 29.4 38.0 140-144 34.60705 38.0 35.2 38.0 27.4 38.0 145-149 33.983450000000005 38.0 35.0 38.0 23.6 38.0 150-151 30.431125 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 1.0 14 2.0 15 1.0 16 3.0 17 1.0 18 7.0 19 6.0 20 2.0 21 1.0 22 4.0 23 5.0 24 10.0 25 13.0 26 21.0 27 21.0 28 35.0 29 26.0 30 33.0 31 57.0 32 83.0 33 79.0 34 144.0 35 232.0 36 573.0 37 2638.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.25993883792049 13.65953109072375 8.613659531090724 32.466870540265035 2 25.3 13.700000000000001 29.575000000000003 31.424999999999997 3 20.25 17.65 27.125 34.975 4 22.95 24.125 23.225 29.7 5 23.825 28.799999999999997 23.625 23.75 6 20.474999999999998 33.125 25.4 21.0 7 15.375 28.599999999999998 39.35 16.675 8 17.724999999999998 27.625 30.95 23.7 9 17.1 25.95 34.675 22.275 10-14 19.81 30.335 27.195000000000004 22.66 15-19 19.326932693269328 29.212921292129213 27.562756275627564 23.8973897389739 20-24 19.685 30.04 27.139999999999997 23.135 25-29 19.955000000000002 29.020000000000003 27.555000000000003 23.47 30-34 19.905 29.465000000000003 27.29 23.34 35-39 20.26 29.770000000000003 26.55 23.419999999999998 40-44 19.950000000000003 29.325000000000003 26.955000000000002 23.77 45-49 20.26 29.020000000000003 27.065 23.655 50-54 20.07 28.76 27.589999999999996 23.580000000000002 55-59 20.255000000000003 28.860000000000003 27.1 23.785 60-64 20.201010050502525 28.961448072403623 26.936346817340866 23.90119505975299 65-69 20.115 28.865000000000002 27.07 23.95 70-74 20.474999999999998 29.175 26.950000000000003 23.400000000000002 75-79 20.446022301115054 28.61143057152858 27.026351317565876 23.916195809790487 80-84 19.939999999999998 28.675 26.955000000000002 24.43 85-89 20.04 28.410000000000004 27.26 24.29 90-94 20.251012550627532 28.431421571078552 26.901345067253363 24.41622081104055 95-99 20.211010550527526 28.581429071453574 27.38136906845342 23.826191309565477 100-104 20.516025801290063 28.15640782039102 27.38136906845342 23.946197309865493 105-109 20.857300055019255 28.014805181813635 26.859400790276595 24.26849397289051 110-114 20.44 28.475 27.089999999999996 23.995 115-119 20.674999999999997 28.13 26.939999999999998 24.255 120-124 20.715 27.83 27.47 23.985 125-129 21.2 27.794999999999998 26.924999999999997 24.08 130-134 21.26 27.93 26.884999999999998 23.925 135-139 20.825 28.58 26.619999999999997 23.974999999999998 140-144 21.377137713771376 27.96779677967797 26.49264926492649 24.162416241624165 145-149 20.915 28.08 27.015 23.990000000000002 150-151 22.0 27.3 26.387500000000003 24.3125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.0 22 0.5 23 2.0 24 3.5 25 4.5 26 6.5 27 7.0 28 10.0 29 14.5 30 16.0 31 27.5 32 40.0 33 45.5 34 59.0 35 76.5 36 93.5 37 113.0 38 120.0 39 136.0 40 172.5 41 212.0 42 227.0 43 246.5 44 266.5 45 244.5 46 253.5 47 251.5 48 229.0 49 214.5 50 178.0 51 158.0 52 133.5 53 103.0 54 86.5 55 71.0 56 54.0 57 32.0 58 23.5 59 20.0 60 8.5 61 5.0 62 9.0 63 7.5 64 3.0 65 3.0 66 2.0 67 0.5 68 2.0 69 2.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.9 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.01 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.005 65-69 0.0 70-74 0.0 75-79 0.005 80-84 0.0 85-89 0.0 90-94 0.005 95-99 0.005 100-104 0.005 105-109 0.034999999999999996 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.01 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42109237352128 98.75 2 0.5285678328718851 1.05 3 0.025169896803423106 0.075 4 0.0 0.0 5 0.025169896803423106 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTCGAAATCTCGTATGC 5 0.125 TruSeq Adapter, Index 3 (97% over 37bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.5375 0.0 0.0 0.0 0.0 110-111 0.6875 0.0 0.0 0.0 0.0 112-113 0.8375 0.0 0.0 0.0 0.0 114-115 0.975 0.0 0.0 0.0 0.0 116-117 1.15 0.0 0.0 0.0 0.0 118-119 1.3375 0.0 0.0 0.0 0.0 120-121 1.55 0.0 0.0 0.0 0.0 122-123 1.8 0.0 0.0 0.0 0.0 124-125 1.95 0.0 0.0 0.0 0.0 126-127 2.1625 0.0 0.0 0.0 0.0 128-129 2.3875 0.0 0.0 0.0 0.0 130-131 2.6375 0.0 0.0 0.0 0.0 132-133 2.9125 0.0 0.0 0.0 0.0 134-135 3.125 0.0 0.0 0.0 0.0 136-137 3.425 0.0 0.0 0.0 0.0 138-139 3.7249999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169615 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169615_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8525 33.0 33.0 34.0 32.0 34.0 2 32.99825 34.0 33.0 34.0 32.0 34.0 3 32.98825 34.0 33.0 34.0 32.0 34.0 4 32.89075 34.0 33.0 34.0 32.0 34.0 5 32.9985 34.0 33.0 34.0 33.0 34.0 6 36.97625 38.0 38.0 38.0 37.0 38.0 7 37.11075 38.0 38.0 38.0 37.0 38.0 8 37.07775 38.0 38.0 38.0 37.0 38.0 9 37.06025 38.0 38.0 38.0 37.0 38.0 10-14 37.02060000000001 38.0 38.0 38.0 37.0 38.0 15-19 37.04335 38.0 38.0 38.0 37.0 38.0 20-24 36.986050000000006 38.0 38.0 38.0 37.0 38.0 25-29 36.876999999999995 38.0 38.0 38.0 36.2 38.0 30-34 36.8374 38.0 38.0 38.0 36.0 38.0 35-39 36.8099 38.0 38.0 38.0 36.0 38.0 40-44 36.900999999999996 38.0 38.0 38.0 36.4 38.0 45-49 36.904450000000004 38.0 38.0 38.0 36.0 38.0 50-54 36.867399999999996 38.0 38.0 38.0 36.0 38.0 55-59 36.809900000000006 38.0 38.0 38.0 36.0 38.0 60-64 36.8154 38.0 38.0 38.0 36.0 38.0 65-69 36.65665 38.0 38.0 38.0 35.4 38.0 70-74 36.57535 38.0 38.0 38.0 35.0 38.0 75-79 36.44425 38.0 38.0 38.0 34.6 38.0 80-84 36.39065000000001 38.0 38.0 38.0 34.2 38.0 85-89 36.24745 38.0 38.0 38.0 34.0 38.0 90-94 36.191449999999996 38.0 38.0 38.0 34.0 38.0 95-99 36.126050000000006 38.0 38.0 38.0 34.0 38.0 100-104 36.01495 38.0 38.0 38.0 33.4 38.0 105-109 35.9868 38.0 38.0 38.0 33.2 38.0 110-114 35.68205 38.0 37.2 38.0 32.2 38.0 115-119 35.63925 38.0 37.0 38.0 31.8 38.0 120-124 35.3001 38.0 37.0 38.0 30.0 38.0 125-129 35.0871 38.0 36.0 38.0 28.6 38.0 130-134 34.84835 38.0 36.0 38.0 28.2 38.0 135-139 34.536150000000006 38.0 35.4 38.0 26.6 38.0 140-144 33.9782 38.0 34.4 38.0 23.4 38.0 145-149 33.269149999999996 38.0 33.0 38.0 18.2 38.0 150-151 28.59075 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 1.0 4 2.0 5 1.0 6 2.0 7 0.0 8 2.0 9 1.0 10 2.0 11 0.0 12 4.0 13 4.0 14 3.0 15 3.0 16 3.0 17 8.0 18 9.0 19 8.0 20 2.0 21 6.0 22 5.0 23 14.0 24 13.0 25 17.0 26 23.0 27 31.0 28 27.0 29 38.0 30 48.0 31 57.0 32 81.0 33 99.0 34 127.0 35 229.0 36 510.0 37 2602.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.43068438205064 23.89069942341439 12.634745550263224 25.04387064427175 2 28.252694911005268 28.378039608924542 28.22762597142141 15.141639508648785 3 21.634494860867385 29.20531461519178 30.23314113812986 18.927049385810978 4 23.865630483830532 33.36675858611181 24.266733517172224 18.500877412885437 5 26.046628227625973 34.895963900727 21.659563800451238 17.397844071195788 6 21.333667585861118 36.525444973677615 23.31411381298571 18.826773627475557 7 20.86258776328987 22.71815446339017 37.036108324974926 19.383149448345037 8 24.34194033592379 26.57307595888694 25.520180496365004 23.564803208824266 9 22.135873652544497 27.174730508899476 28.67886688393081 22.01052895462522 10-14 24.168714579467377 28.38657906615176 26.134710868147852 21.30999548623301 15-19 24.155049643967505 28.211814261357937 26.832815163975525 20.800320930699026 20-24 23.802597923667186 28.752695721951955 26.224986207934197 21.21972014644666 25-29 24.191767068273094 28.268072289156628 26.330321285140563 21.20983935742972 30-34 23.81000150473993 28.22390530170036 27.471535336309376 20.49455785725034 35-39 23.657423657423656 28.180313894599607 26.971869829012686 21.190392618964047 40-44 23.730684326710815 28.48685530804736 26.86634557495485 20.916114790286976 45-49 23.936810431293882 27.768304914744235 27.4222668004012 20.872617853560683 50-54 24.322833065810595 28.430979133226327 26.65529695024077 20.590890850722314 55-59 24.18238362760835 27.518057784911715 27.548154093097914 20.751404494382022 60-64 23.755077478561756 27.98756331176972 27.17015194824733 21.08720726142119 65-69 24.293813657117052 27.685515026842605 27.720636194872313 20.30003512116803 70-74 24.198484772465005 27.595203451909082 27.123576338367368 21.082735437258542 75-79 24.2626404494382 27.186998394863565 27.96448635634029 20.585874799357946 80-84 24.485803150396308 27.70643122303602 28.007424500852814 19.80034112571486 85-89 23.933340026101796 27.266338721011945 27.657865676136932 21.142455576749324 90-94 24.5310462433544 27.164209048048953 27.655732771591936 20.649011937004715 95-99 24.2123218944411 27.498494882600845 27.097130242825607 21.192052980132452 100-104 24.05393213372763 27.763019397523937 27.26179138890281 20.92125707984562 105-109 23.81573011178505 27.84600731866259 27.71066218858088 20.62760038097148 110-114 23.931581059390048 27.788924558587482 27.57825040128411 20.70124398073836 115-119 24.605045388434725 27.528963338181455 27.41361151512112 20.4523797582627 120-124 24.194681384846962 27.425990968389364 27.360762669342698 21.018564977420972 125-129 24.259463801586502 27.648358268902502 27.19650567326037 20.895672256250627 130-134 24.17775546070801 27.481797639969873 27.66256590509666 20.677880994225458 135-139 24.200271179631397 26.962285943855775 28.02691708933862 20.810525787174207 140-144 24.77303506044039 27.095350353613885 27.642072528464663 20.489542057481067 145-149 24.666532945542073 27.57998194764818 27.359342092066996 20.394143014742756 150-151 25.225450901803608 27.968436873747493 26.92885771543086 19.877254509018037 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 10.0 1 5.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 0.0 24 0.5 25 1.5 26 2.0 27 2.5 28 1.5 29 2.5 30 7.0 31 10.5 32 13.5 33 15.0 34 30.0 35 51.5 36 69.5 37 92.0 38 108.5 39 143.0 40 181.0 41 201.0 42 234.0 43 274.0 44 294.5 45 309.0 46 295.5 47 277.0 48 267.5 49 227.5 50 187.5 51 147.5 52 127.5 53 113.0 54 77.5 55 61.0 56 48.0 57 28.5 58 18.0 59 19.0 60 17.5 61 7.5 62 5.5 63 6.0 64 3.5 65 1.5 66 1.5 67 2.0 68 1.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.27499999999999997 3 0.27499999999999997 4 0.27499999999999997 5 0.27499999999999997 6 0.27499999999999997 7 0.3 8 0.27499999999999997 9 0.27499999999999997 10-14 0.305 15-19 0.29 20-24 0.305 25-29 0.4 30-34 0.315 35-39 0.28500000000000003 40-44 0.33999999999999997 45-49 0.3 50-54 0.32 55-59 0.32 60-64 0.295 65-69 0.345 70-74 0.345 75-79 0.32 80-84 0.33 85-89 0.38999999999999996 90-94 0.31 95-99 0.33999999999999997 100-104 0.245 105-109 0.255 110-114 0.32 115-119 0.305 120-124 0.35000000000000003 125-129 0.41000000000000003 130-134 0.42500000000000004 135-139 0.43499999999999994 140-144 0.315 145-149 0.29 150-151 0.2 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4452849218356 98.6 2 0.4790721129601614 0.95 3 0.02521432173474534 0.075 4 0.0 0.0 5 0.02521432173474534 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02521432173474534 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 10 0.25 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 5 0.125 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.4875 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.6625 0.0 0.0 0.0 0.0 112-113 0.8125 0.0 0.0 0.0 0.0 114-115 0.95 0.0 0.0 0.0 0.0 116-117 1.125 0.0 0.0 0.0 0.0 118-119 1.3125 0.0 0.0 0.0 0.0 120-121 1.55 0.0 0.0 0.0 0.0 122-123 1.8 0.0 0.0 0.0 0.0 124-125 1.925 0.0 0.0 0.0 0.0 126-127 2.1 0.0 0.0 0.0 0.0 128-129 2.3375 0.0 0.0 0.0 0.0 130-131 2.5625 0.0 0.0 0.0 0.0 132-133 2.8875 0.0 0.0 0.0 0.0 134-135 3.1 0.0 0.0 0.0 0.0 136-137 3.375 0.0 0.0 0.0 0.0 138-139 3.6500000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTGGGG 10 0.006830828 145.0 9 >>END_MODULE Read 1309361 spots for SRR7169615.sra Written 1309361 spots for SRR7169615.sra Read 1309361 spots for SRR7169615.sra Written 1309361 spots for SRR7169615.sra Read 1309361 spots for SRR7169615.sra Written 1309361 spots for SRR7169615.sra Read 1309361 spots for SRR7169615.sra Written 1309361 spots for SRR7169615.sra Read 1309361 spots for SRR7169615.sra Written 1309361 spots for SRR7169615.sra Read 1309361 spots for SRR7169615.sra Written 1309361 spots for SRR7169615.sra Read 1309361 spots for SRR7169615.sra Written 1309361 spots for SRR7169615.sra Read 1309361 spots for SRR7169615.sra Written 1309361 spots for SRR7169615.sra Read 1309361 spots for SRR7169615.sra Written 1309361 spots for SRR7169615.sra Read 1309361 spots for SRR7169615.sra Written 1309361 spots for SRR7169615.sra Read 1309361 spots for SRR7169615.sra Written 1309361 spots for SRR7169615.sra Read 1309361 spots for SRR7169615.sra Written 1309361 spots for SRR7169615.sra Read 1309361 spots for SRR7169615.sra Written 1309361 spots for SRR7169615.sra Read 1309373 spots for SRR7169615.sra Written 1309373 spots for SRR7169615.sra Read 1309361 spots for SRR7169615.sra Written 1309361 spots for SRR7169615.sra Read 1309361 spots for SRR7169615.sra Written 1309361 spots for SRR7169615.sra Read 1309361 spots for SRR7169615.sra Written 1309361 spots for SRR7169615.sra Read 1309361 spots for SRR7169615.sra Written 1309361 spots for SRR7169615.sra Read 1309361 spots for SRR7169615.sra Written 1309361 spots for SRR7169615.sra Read 1309361 spots for SRR7169615.sra Written 1309361 spots for SRR7169615.sra SRR ids: ['SRR7169615.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f1g9gsh8 SRR7169615.sra spots: 26187232 blocks: [[1, 1309361], [1309362, 2618722], [2618723, 3928083], [3928084, 5237444], [5237445, 6546805], [6546806, 7856166], [7856167, 9165527], [9165528, 10474888], [10474889, 11784249], [11784250, 13093610], [13093611, 14402971], [14402972, 15712332], [15712333, 17021693], [17021694, 18331054], [18331055, 19640415], [19640416, 20949776], [20949777, 22259137], [22259138, 23568498], [23568499, 24877859], [24877860, 26187232]] SRR7169615 file size 8852293 SRR7169615 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169615 SRR7169615_1.fastq SRR7169615_2.fastq Input file: SRR7169615_1.fastq Paired file: SRR7169615_2.fastq trimmed: SRR7169615-trimmed-pair1.fastq, SRR7169615-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:44:50 2025 >> started Tue Feb 11 09:45:35 2025 >> done (45.342s) 26187232 read pairs processed; of these: 37495 ( 0.14%) short read pairs filtered out after trimming by size control 106335 ( 0.41%) empty read pairs filtered out after trimming by size control 26043402 (99.45%) read pairs available; of these: 12117178 (46.53%) trimmed read pairs available after processing 13926224 (53.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 11 0.00% 20 9 0.00% 21 14 0.00% 22 16 0.00% 23 21 0.00% 24 17 0.00% 25 16 0.00% 26 22 0.00% 27 27 0.00% 28 22 0.00% 29 22 0.00% 30 36 0.00% 31 25 0.00% 32 25 0.00% 33 26 0.00% 34 31 0.00% 35 35 0.00% 36 21 0.00% 37 35 0.00% 38 30 0.00% 39 36 0.00% 40 42 0.00% 41 55 0.00% 42 55 0.00% 43 50 0.00% 44 51 0.00% 45 74 0.00% 46 98 0.00% 47 85 0.00% 48 94 0.00% 49 108 0.00% 50 116 0.00% 51 116 0.00% 52 130 0.00% 53 139 0.00% 54 182 0.00% 55 192 0.00% 56 190 0.00% 57 195 0.00% 58 232 0.00% 59 265 0.00% 60 299 0.00% 61 311 0.00% 62 345 0.00% 63 385 0.00% 64 421 0.00% 65 580 0.00% 66 647 0.00% 67 843 0.00% 68 1230 0.00% 69 3347 0.01% 70 4108 0.02% 71 2187 0.01% 72 1380 0.01% 73 1244 0.00% 74 1270 0.00% 75 1381 0.01% 76 1495 0.01% 77 1727 0.01% 78 1808 0.01% 79 1929 0.01% 80 2248 0.01% 81 2403 0.01% 82 2734 0.01% 83 3290 0.01% 84 4757 0.02% 85 5959 0.02% 86 6099 0.02% 87 6737 0.03% 88 7366 0.03% 89 7436 0.03% 90 7743 0.03% 91 7986 0.03% 92 8648 0.03% 93 9103 0.03% 94 9787 0.04% 95 10526 0.04% 96 11012 0.04% 97 11793 0.05% 98 12309 0.05% 99 12769 0.05% 100 13515 0.05% 101 14073 0.05% 102 15080 0.06% 103 16002 0.06% 104 16996 0.07% 105 18215 0.07% 106 19128 0.07% 107 20197 0.08% 108 21272 0.08% 109 22339 0.09% 110 23327 0.09% 111 24134 0.09% 112 25801 0.10% 113 27691 0.11% 114 28798 0.11% 115 30769 0.12% 116 32250 0.12% 117 33694 0.13% 118 35368 0.14% 119 36878 0.14% 120 38891 0.15% 121 39943 0.15% 122 42133 0.16% 123 44725 0.17% 124 48147 0.18% 125 50358 0.19% 126 53778 0.21% 127 56107 0.22% 128 58836 0.23% 129 62715 0.24% 130 66074 0.25% 131 69716 0.27% 132 74113 0.28% 133 79927 0.31% 134 85553 0.33% 135 91827 0.35% 136 98943 0.38% 137 107251 0.41% 138 116477 0.45% 139 125931 0.48% 140 135725 0.52% 141 150538 0.58% 142 166007 0.64% 143 187569 0.72% 144 218582 0.84% 145 257261 0.99% 146 316916 1.22% 147 429797 1.65% 148 655211 2.52% 149 1348318 5.18% 150 6183665 23.74% 151 13926224 53.47% 26043402 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.47 fanout-score-rank=34 prefix-density=0.28 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=40 fanout-score=38.52 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=5.7 sequence=AACAATCTTACATCAAATTACAAGCACGTATGGTCTTGTAATATTTGCAGTAAACCGAGCTTTTTTTTCTAAAAAGGAAGAAAAACAGTAGATGGACATAACCAAACAAGCCACACATCAAGCATCATCATCACCGTTCTATAGAACACAAGAATACTGCCTGCTGCCCTACTGGGAAGCACTCTCCTTTTCTTTCTCCTTCTCTTCTTCAGTCTTGGGGTGGTACCCAGGTAACTTCTCCTTGATCTTCTCGAG criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=39 prefix-density=0.28 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.13 sequence-density-rank=14 fanout-score=40.17 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=11.0 sequence=TCAAGGAAGCTTTCAG SRR7169615 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:46:48 Started mapping on | Feb 11 09:46:49 Finished on | Feb 11 09:51:05 Mapping speed, Million of reads per hour | 366.24 Number of input reads | 26043402 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 24387514 Uniquely mapped reads % | 93.64% Average mapped length | 295.36 Number of splices: Total | 21944983 Number of splices: Annotated (sjdb) | 21556527 Number of splices: GT/AG | 21621049 Number of splices: GC/AG | 251452 Number of splices: AT/AC | 17210 Number of splices: Non-canonical | 55272 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 456510 % of reads mapped to multiple loci | 1.75% Number of reads mapped to too many loci | 34431 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.42% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1229254 1229254 1229254 N_multimapping 456510 456510 456510 N_noFeature 503095 24090829 616337 N_ambiguous 285066 1569 100665 UnstrandedReadsAssigned:23599353 PositiveStrandReadsAssigned:295116 NegativeStrandReadsAssigned:23670512 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169615 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169615-trimmed-pair1.fastq SRR7169615-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,043,402 reads, 23,544,142 reads pseudoaligned [quant] estimated average fragment length: 245.282 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,104 rounds 52401 SRR7169615.ke.tsv 34699 SRR7169615.se.tsv 87100 total ==> SRR7169615.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.72 339 6.76001 Potri.005G024800.1.v4.1 1035 790.718 112 5.0099 Potri.004G059700.1.v4.1 961 716.743 4 0.197392 Potri.007G009000.2.v4.1 1416 1171.72 0 0 Potri.003G141000.2.v4.1 2943 2698.72 444 5.81913 Potri.016G087400.1.v4.1 270 72.6928 2941 1430.99 Potri.015G069301.1.v4.1 564 323.828 0 0 Potri.010G195200.1.v4.1 1773 1528.72 21 0.485875 Potri.012G127500.1.v4.1 977 732.737 7604 367.051 ==> SRR7169615.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1465 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 478 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7169615 completed mapping pipeline successfully