Starting /dee2/code/volunteer_pipeline.sh SRR7169616 current disk space = 3052885995520 free memory = 1579206128 SRR7169616 SRAfilesize d59799189d90b6555474a6569d28711f SRR7169616.sra SRR7169616.sra file validated SRR7169616 is paired end SRR7169616 is conventional basespace SRR7169616 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169616_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.101 34.0 33.0 34.0 33.0 34.0 2 33.40725 34.0 34.0 34.0 33.0 34.0 3 33.492 34.0 34.0 34.0 33.0 34.0 4 33.464 34.0 34.0 34.0 33.0 34.0 5 33.49025 34.0 34.0 34.0 33.0 34.0 6 37.067 38.0 38.0 38.0 36.0 38.0 7 37.31975 38.0 38.0 38.0 37.0 38.0 8 37.34625 38.0 38.0 38.0 37.0 38.0 9 37.48175 38.0 38.0 38.0 37.0 38.0 10-14 37.46265 38.0 38.0 38.0 37.2 38.0 15-19 37.421850000000006 38.0 38.0 38.0 37.0 38.0 20-24 37.4734 38.0 38.0 38.0 37.0 38.0 25-29 37.432300000000005 38.0 38.0 38.0 37.0 38.0 30-34 37.4153 38.0 38.0 38.0 37.0 38.0 35-39 37.32735 38.0 38.0 38.0 37.0 38.0 40-44 37.2307 38.0 38.0 38.0 36.8 38.0 45-49 37.182249999999996 38.0 38.0 38.0 36.2 38.0 50-54 37.0825 38.0 38.0 38.0 36.0 38.0 55-59 37.06815 38.0 38.0 38.0 36.0 38.0 60-64 37.0338 38.0 38.0 38.0 36.0 38.0 65-69 36.98604999999999 38.0 38.0 38.0 36.0 38.0 70-74 36.8711 38.0 38.0 38.0 35.6 38.0 75-79 36.8137 38.0 38.0 38.0 35.0 38.0 80-84 36.8171 38.0 38.0 38.0 35.2 38.0 85-89 36.6691 38.0 38.0 38.0 35.0 38.0 90-94 36.578149999999994 38.0 38.0 38.0 34.4 38.0 95-99 36.4605 38.0 38.0 38.0 34.0 38.0 100-104 36.2119 38.0 37.8 38.0 33.6 38.0 105-109 36.2128 38.0 37.6 38.0 33.6 38.0 110-114 36.06665 38.0 37.2 38.0 33.2 38.0 115-119 35.928000000000004 38.0 37.0 38.0 33.0 38.0 120-124 35.70595 38.0 36.8 38.0 31.4 38.0 125-129 35.6904 38.0 36.4 38.0 31.4 38.0 130-134 35.4107 38.0 36.0 38.0 31.0 38.0 135-139 35.24365 38.0 36.0 38.0 30.6 38.0 140-144 34.58235 38.0 35.0 38.0 27.2 38.0 145-149 34.09235 38.0 35.0 38.0 24.8 38.0 150-151 30.903624999999998 36.5 31.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 1.0 13 0.0 14 2.0 15 3.0 16 0.0 17 8.0 18 2.0 19 7.0 20 5.0 21 3.0 22 6.0 23 8.0 24 8.0 25 15.0 26 7.0 27 24.0 28 27.0 29 34.0 30 36.0 31 69.0 32 60.0 33 82.0 34 134.0 35 243.0 36 618.0 37 2596.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.77347506960263 13.540875727663881 8.47886610984561 33.206783092887875 2 23.075000000000003 15.225 32.475 29.225 3 19.400000000000002 21.0 25.924999999999997 33.675 4 22.875 27.150000000000002 23.875 26.1 5 22.475 32.25 22.875 22.400000000000002 6 19.725 34.525 24.75 21.0 7 15.325 26.075 40.949999999999996 17.65 8 17.0 26.474999999999998 31.674999999999997 24.85 9 16.650000000000002 24.05 33.675 25.624999999999996 10-14 20.044999999999998 29.959999999999997 27.0 22.994999999999997 15-19 20.1 29.645 26.96 23.294999999999998 20-24 19.86 28.575 27.08 24.485 25-29 20.150000000000002 29.470000000000002 26.979999999999997 23.400000000000002 30-34 19.63 29.515 27.07 23.785 35-39 19.975 28.765 27.065 24.195 40-44 20.655 28.575 27.150000000000002 23.62 45-49 20.205000000000002 27.825 27.775 24.195 50-54 19.650000000000002 28.355000000000004 27.505000000000003 24.490000000000002 55-59 20.21 28.595 27.584999999999997 23.61 60-64 20.365 28.465 27.52 23.65 65-69 20.105 28.744999999999997 27.02 24.13 70-74 20.445 28.65 26.765 24.14 75-79 19.515 28.76 27.500000000000004 24.224999999999998 80-84 20.064999999999998 27.985 27.355 24.595 85-89 20.255000000000003 28.185 27.250000000000004 24.310000000000002 90-94 20.185 27.82 27.605 24.39 95-99 20.080000000000002 28.16 27.685 24.075 100-104 20.94 28.63 26.6 23.830000000000002 105-109 20.49 28.134999999999998 27.115000000000002 24.26 110-114 20.29 27.839999999999996 27.52 24.349999999999998 115-119 20.375 28.705000000000002 27.105 23.815 120-124 20.57 27.474999999999998 27.48 24.474999999999998 125-129 20.585 27.515 27.245 24.654999999999998 130-134 20.885 28.139999999999997 26.825 24.15 135-139 20.47 28.325 27.155 24.05 140-144 20.595 28.155 26.97 24.279999999999998 145-149 20.349999999999998 28.365000000000002 27.07 24.215 150-151 19.5 28.3375 27.500000000000004 24.6625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 2.0 24 3.5 25 4.0 26 5.0 27 7.5 28 11.0 29 14.5 30 17.5 31 21.5 32 33.5 33 44.5 34 46.5 35 56.0 36 81.5 37 103.0 38 120.0 39 151.5 40 184.5 41 205.0 42 229.0 43 245.0 44 247.0 45 257.0 46 271.0 47 253.5 48 236.0 49 240.5 50 201.0 51 150.0 52 132.5 53 115.5 54 83.5 55 60.5 56 45.5 57 30.5 58 24.0 59 21.5 60 15.0 61 6.5 62 6.5 63 5.5 64 1.5 65 0.0 66 0.0 67 0.0 68 1.5 69 2.5 70 1.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.225 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64859437751004 99.25 2 0.32630522088353414 0.65 3 0.0 0.0 4 0.0251004016064257 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.30000000000000004 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.4875 0.0 0.0 0.0 0.0 102-103 0.6125 0.0 0.0 0.0 0.0 104-105 0.725 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 0.9375 0.0 0.0 0.0 0.0 110-111 1.125 0.0 0.0 0.0 0.0 112-113 1.275 0.0 0.0 0.0 0.0 114-115 1.45 0.0 0.0 0.0 0.0 116-117 1.6749999999999998 0.0 0.0 0.0 0.0 118-119 1.7625000000000002 0.0 0.0 0.0 0.0 120-121 1.975 0.0 0.0 0.0 0.0 122-123 2.3499999999999996 0.0 0.0 0.0 0.0 124-125 2.725 0.0 0.0 0.0 0.0 126-127 2.8875 0.0 0.0 0.0 0.0 128-129 3.1875 0.0 0.0 0.0 0.0 130-131 3.6875 0.0 0.0 0.0 0.0 132-133 3.8875 0.0 0.0 0.0 0.0 134-135 4.300000000000001 0.0 0.0 0.0 0.0 136-137 4.75 0.0 0.0 0.0 0.0 138-139 5.175000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTACAAC 10 0.006832588 144.9875 6 CCACCCT 10 0.006832588 144.9875 3 TTTGGGC 10 0.006832588 144.9875 7 >>END_MODULE SRR7169616 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169616_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.93275 33.0 33.0 34.0 32.0 34.0 2 33.073 34.0 33.0 34.0 32.0 34.0 3 33.095 34.0 33.0 34.0 33.0 34.0 4 33.0545 34.0 33.0 34.0 33.0 34.0 5 33.0055 34.0 33.0 34.0 33.0 34.0 6 37.2105 38.0 38.0 38.0 37.0 38.0 7 37.22325 38.0 38.0 38.0 37.0 38.0 8 37.1855 38.0 38.0 38.0 37.0 38.0 9 37.16925 38.0 38.0 38.0 37.0 38.0 10-14 37.1669 38.0 38.0 38.0 37.0 38.0 15-19 37.099199999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.05085 38.0 38.0 38.0 36.8 38.0 25-29 37.00915 38.0 38.0 38.0 36.6 38.0 30-34 36.88895 38.0 38.0 38.0 36.4 38.0 35-39 36.94225 38.0 38.0 38.0 36.4 38.0 40-44 36.98129999999999 38.0 38.0 38.0 36.8 38.0 45-49 37.01185 38.0 38.0 38.0 36.8 38.0 50-54 36.99145 38.0 38.0 38.0 36.6 38.0 55-59 37.00025 38.0 38.0 38.0 36.8 38.0 60-64 36.92155 38.0 38.0 38.0 36.0 38.0 65-69 36.849849999999996 38.0 38.0 38.0 36.0 38.0 70-74 36.7918 38.0 38.0 38.0 36.0 38.0 75-79 36.76825 38.0 38.0 38.0 35.8 38.0 80-84 36.53715 38.0 38.0 38.0 34.8 38.0 85-89 36.51045 38.0 38.0 38.0 35.0 38.0 90-94 36.46055 38.0 38.0 38.0 34.8 38.0 95-99 36.367900000000006 38.0 38.0 38.0 34.2 38.0 100-104 36.39045 38.0 38.0 38.0 34.2 38.0 105-109 36.311400000000006 38.0 38.0 38.0 34.0 38.0 110-114 36.17 38.0 38.0 38.0 34.0 38.0 115-119 35.99705 38.0 38.0 38.0 33.6 38.0 120-124 35.7271 38.0 37.2 38.0 32.2 38.0 125-129 35.4493 38.0 36.6 38.0 31.0 38.0 130-134 35.25215 38.0 36.0 38.0 30.6 38.0 135-139 35.0386 38.0 36.0 38.0 30.0 38.0 140-144 34.5835 38.0 35.4 38.0 27.6 38.0 145-149 34.02445 38.0 35.0 38.0 24.4 38.0 150-151 30.231625 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 2.0 4 1.0 5 0.0 6 2.0 7 1.0 8 0.0 9 0.0 10 3.0 11 1.0 12 2.0 13 1.0 14 1.0 15 1.0 16 6.0 17 6.0 18 5.0 19 5.0 20 5.0 21 11.0 22 13.0 23 13.0 24 13.0 25 19.0 26 8.0 27 18.0 28 35.0 29 34.0 30 38.0 31 46.0 32 51.0 33 79.0 34 122.0 35 181.0 36 512.0 37 2753.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.556167125344004 23.942957217913435 11.133350012509382 23.367525644233176 2 27.9459594696022 27.395546659994995 28.471353515136354 16.18714035526645 3 20.745745745745744 30.455455455455454 30.105105105105107 18.693693693693696 4 25.11883912934701 33.75031273455092 22.516887665749312 18.613960470352765 5 24.96872654490868 35.60170127595696 20.740555416562422 18.689016762571928 6 21.02102102102102 37.83783783783784 23.04804804804805 18.093093093093092 7 20.575719649561954 21.90237797246558 37.221526908635795 20.30037546933667 8 21.802252816020026 26.107634543178975 27.008760951188986 25.081351689612013 9 22.489356373653894 25.77009767092412 29.17605810167794 22.564487853744055 10-14 23.73610972069276 28.791670837921714 26.18380218240064 21.288417258984886 15-19 23.735174898663864 27.853675624280637 27.513386378421657 20.89776309863384 20-24 23.873648378053662 27.973568281938327 26.86223468161794 21.29054865839007 25-29 23.71108219040945 27.66042646911603 27.870657723495846 20.757833616978676 30-34 24.080468398138418 27.793624580893763 26.99794825601762 21.127958764950208 35-39 23.540310465698546 28.202303455182776 27.356034051076616 20.901352028042062 40-44 24.273692646764175 27.94029252654779 27.158885994790623 20.627128831897416 45-49 24.167626295498923 27.902668602613527 26.986431682771745 20.94327341911581 50-54 24.280206299133745 27.424765910570326 27.2845626157929 21.01046517450303 55-59 24.70223200880793 27.28956060454409 27.43469122209989 20.573516164548096 60-64 23.875813720580872 28.02704056084126 27.636454682023036 20.46069103655483 65-69 24.086312205867628 28.42695504155402 26.904976469410236 20.58175628316812 70-74 24.30767689919375 27.682908508187694 27.292303069758123 20.717111522860435 75-79 23.60659021483299 27.737993890530323 27.427512644599126 21.227903250037556 80-84 24.21147491739261 27.56583558626214 27.32051667167317 20.902172824672075 85-89 23.92665698111317 27.69901307549722 27.563749311156755 20.810580632232853 90-94 24.03846153846154 27.69931891025641 27.423878205128204 20.838341346153847 95-99 23.639549436795996 28.030037546933666 27.554443053817273 20.77596996245307 100-104 23.820967257434663 27.841193551617106 27.485731450886153 20.85210774006208 105-109 24.72343194673875 27.07613755819192 27.641788056264705 20.558642438804625 110-114 24.257599278882267 27.622815363813913 27.557714457408984 20.56187089989484 115-119 24.962451186542506 27.63592670471613 27.105236807850204 20.29638530089116 120-124 24.417731029301276 27.978963185574756 27.38292011019284 20.22038567493113 125-129 24.83339179235356 27.689532494863954 26.722453274540264 20.754622438242222 130-134 25.387198636659818 27.567540474161696 26.91594406295424 20.12931682622425 135-139 24.44021439663377 27.931673596152883 27.23037619596253 20.397735811250815 140-144 25.20789500050095 27.908025247971146 26.75583608856828 20.128243662959626 145-149 25.15773660490736 27.706559839759638 26.755132699048573 20.38057085628443 150-151 25.94445834375782 27.733299974981236 27.383037277958465 18.939204403302476 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 0.5 25 1.0 26 1.5 27 1.5 28 3.0 29 4.5 30 6.0 31 9.5 32 14.0 33 21.5 34 33.0 35 40.0 36 51.5 37 80.5 38 118.5 39 157.0 40 183.5 41 209.5 42 268.5 43 288.5 44 290.0 45 298.5 46 282.5 47 271.0 48 242.5 49 213.5 50 193.0 51 164.0 52 136.5 53 117.5 54 82.5 55 55.5 56 43.5 57 30.0 58 22.5 59 15.5 60 12.0 61 8.0 62 5.5 63 4.5 64 2.0 65 2.5 66 1.5 67 1.5 68 2.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.075 3 0.1 4 0.075 5 0.075 6 0.1 7 0.125 8 0.125 9 0.17500000000000002 10-14 0.11 15-19 0.08499999999999999 20-24 0.12 25-29 0.11 30-34 0.08499999999999999 35-39 0.15 40-44 0.18 45-49 0.135 50-54 0.145 55-59 0.09 60-64 0.15 65-69 0.13 70-74 0.155 75-79 0.155 80-84 0.13 85-89 0.19499999999999998 90-94 0.16 95-99 0.125 100-104 0.13 105-109 0.11499999999999999 110-114 0.155 115-119 0.13 120-124 0.17500000000000002 125-129 0.215 130-134 0.245 135-139 0.185 140-144 0.19 145-149 0.15 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57286432160805 99.075 2 0.37688442211055273 0.75 3 0.02512562814070352 0.075 4 0.02512562814070352 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.4625 0.0 0.0 0.0 0.0 102-103 0.6000000000000001 0.0 0.0 0.0 0.0 104-105 0.725 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 0.925 0.0 0.0 0.0 0.0 110-111 1.0750000000000002 0.0 0.0 0.0 0.0 112-113 1.25 0.0 0.0 0.0 0.0 114-115 1.425 0.0 0.0 0.0 0.0 116-117 1.6749999999999998 0.0 0.0 0.0 0.0 118-119 1.8125 0.0 0.0 0.0 0.0 120-121 2.0125 0.0 0.0 0.0 0.0 122-123 2.375 0.0 0.0 0.0 0.0 124-125 2.75 0.0 0.0 0.0 0.0 126-127 2.9125 0.0 0.0 0.0 0.0 128-129 3.2125000000000004 0.0 0.0 0.0 0.0 130-131 3.7125 0.0 0.0 0.0 0.0 132-133 3.9125 0.0 0.0 0.0 0.0 134-135 4.3125 0.0 0.0 0.0 0.0 136-137 4.725 0.0 0.0 0.0 0.0 138-139 5.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCAACT 10 0.00682755 145.0 7 GCATTCT 10 0.00682755 145.0 9 >>END_MODULE Read 1025345 spots for SRR7169616.sra Written 1025345 spots for SRR7169616.sra Read 1025345 spots for SRR7169616.sra Written 1025345 spots for SRR7169616.sra Read 1025345 spots for SRR7169616.sra Written 1025345 spots for SRR7169616.sra Read 1025345 spots for SRR7169616.sra Written 1025345 spots for SRR7169616.sra Read 1025345 spots for SRR7169616.sra Written 1025345 spots for SRR7169616.sra Read 1025345 spots for SRR7169616.sra Written 1025345 spots for SRR7169616.sra Read 1025345 spots for SRR7169616.sra Written 1025345 spots for SRR7169616.sra Read 1025345 spots for SRR7169616.sra Written 1025345 spots for SRR7169616.sra Read 1025345 spots for SRR7169616.sra Written 1025345 spots for SRR7169616.sra Read 1025345 spots for SRR7169616.sra Written 1025345 spots for SRR7169616.sra Read 1025345 spots for SRR7169616.sra Written 1025345 spots for SRR7169616.sra Read 1025345 spots for SRR7169616.sra Written 1025345 spots for SRR7169616.sra Read 1025345 spots for SRR7169616.sra Written 1025345 spots for SRR7169616.sra Read 1025345 spots for SRR7169616.sra Written 1025345 spots for SRR7169616.sra Read 1025348 spots for SRR7169616.sra Written 1025348 spots for SRR7169616.sra Read 1025345 spots for SRR7169616.sra Written 1025345 spots for SRR7169616.sra Read 1025345 spots for SRR7169616.sra Written 1025345 spots for SRR7169616.sra Read 1025345 spots for SRR7169616.sra Written 1025345 spots for SRR7169616.sra Read 1025345 spots for SRR7169616.sra Written 1025345 spots for SRR7169616.sra Read 1025345 spots for SRR7169616.sra Written 1025345 spots for SRR7169616.sra SRR ids: ['SRR7169616.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pv12atko SRR7169616.sra spots: 20506903 blocks: [[1, 1025345], [1025346, 2050690], [2050691, 3076035], [3076036, 4101380], [4101381, 5126725], [5126726, 6152070], [6152071, 7177415], [7177416, 8202760], [8202761, 9228105], [9228106, 10253450], [10253451, 11278795], [11278796, 12304140], [12304141, 13329485], [13329486, 14354830], [14354831, 15380175], [15380176, 16405520], [16405521, 17430865], [17430866, 18456210], [18456211, 19481555], [19481556, 20506903]] SRR7169616 file size 6927416 SRR7169616 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169616 SRR7169616_1.fastq SRR7169616_2.fastq Input file: SRR7169616_1.fastq Paired file: SRR7169616_2.fastq trimmed: SRR7169616-trimmed-pair1.fastq, SRR7169616-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:55:30 2025 >> started Tue Feb 11 10:55:54 2025 >> done (23.804s) 20506903 read pairs processed; of these: 34955 ( 0.17%) short read pairs filtered out after trimming by size control 74523 ( 0.36%) empty read pairs filtered out after trimming by size control 20397425 (99.47%) read pairs available; of these: 10158178 (49.80%) trimmed read pairs available after processing 10239247 (50.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 7 0.00% 20 10 0.00% 21 10 0.00% 22 9 0.00% 23 13 0.00% 24 13 0.00% 25 12 0.00% 26 20 0.00% 27 13 0.00% 28 25 0.00% 29 22 0.00% 30 30 0.00% 31 19 0.00% 32 25 0.00% 33 15 0.00% 34 21 0.00% 35 23 0.00% 36 18 0.00% 37 27 0.00% 38 32 0.00% 39 28 0.00% 40 48 0.00% 41 46 0.00% 42 53 0.00% 43 41 0.00% 44 50 0.00% 45 60 0.00% 46 85 0.00% 47 88 0.00% 48 65 0.00% 49 110 0.00% 50 109 0.00% 51 131 0.00% 52 114 0.00% 53 156 0.00% 54 133 0.00% 55 125 0.00% 56 186 0.00% 57 173 0.00% 58 219 0.00% 59 234 0.00% 60 260 0.00% 61 312 0.00% 62 370 0.00% 63 373 0.00% 64 448 0.00% 65 597 0.00% 66 580 0.00% 67 656 0.00% 68 768 0.00% 69 1609 0.01% 70 2175 0.01% 71 1512 0.01% 72 1319 0.01% 73 1305 0.01% 74 1356 0.01% 75 1531 0.01% 76 1641 0.01% 77 1880 0.01% 78 2067 0.01% 79 2326 0.01% 80 2605 0.01% 81 3074 0.02% 82 3383 0.02% 83 4017 0.02% 84 5788 0.03% 85 6631 0.03% 86 6694 0.03% 87 7230 0.04% 88 7554 0.04% 89 7866 0.04% 90 8401 0.04% 91 9107 0.04% 92 9836 0.05% 93 10634 0.05% 94 11272 0.06% 95 11997 0.06% 96 12764 0.06% 97 13202 0.06% 98 13770 0.07% 99 14639 0.07% 100 15580 0.08% 101 16679 0.08% 102 17911 0.09% 103 18971 0.09% 104 20225 0.10% 105 22012 0.11% 106 22917 0.11% 107 23182 0.11% 108 24078 0.12% 109 25205 0.12% 110 26119 0.13% 111 27867 0.14% 112 29520 0.14% 113 31592 0.15% 114 33097 0.16% 115 34958 0.17% 116 36662 0.18% 117 38128 0.19% 118 39127 0.19% 119 40124 0.20% 120 41877 0.21% 121 43850 0.21% 122 45927 0.23% 123 48702 0.24% 124 52068 0.26% 125 54796 0.27% 126 57057 0.28% 127 59156 0.29% 128 61257 0.30% 129 64080 0.31% 130 67172 0.33% 131 69821 0.34% 132 74323 0.36% 133 78507 0.38% 134 83879 0.41% 135 88354 0.43% 136 94368 0.46% 137 100143 0.49% 138 105745 0.52% 139 112823 0.55% 140 120432 0.59% 141 131258 0.64% 142 145429 0.71% 143 163308 0.80% 144 190061 0.93% 145 224221 1.10% 146 279005 1.37% 147 374715 1.84% 148 575009 2.82% 149 1064301 5.22% 150 4746407 23.27% 151 10239247 50.20% 20397425 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=40 prefix-density=0.22 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=97.23 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=10.2 sequence=ATATTCATCATAACTCAATTACATTATTCTCACCCAGAACATCTCTTCCAGCAATAGATACAAACCATGGCAATTAACTAGAGCAGAACATCATTTCACAAGGTTTATAAGGAAAGAGACCTCCTTGACTTGGACAAACACTCGTCTATAAGAAACACCCAAATTTCCAACTATTCGGCTGTTTGTTTCATTAATAACTGGAGAGCAGGAGATGCCAGTGCCTCAGACAAACTGATCAAGGTACTCTTCCACGGTGGTATATTTGACATCTGGATATAGCTCAGAGGCCTCAAGGCCCCATGATGGGTCAATCTCAAAGTTGGTCATGTCACCATTAACGAGGGCTGAGTGGTTGATTGACAGAACAATATTAATCGGAATCGGAGACTCTTGGATGTCCTTCAGAAGTTTCTCTTCAGGAACAAAGGTTTTTTCGAGGGTTTTGCCAATCTTTTTCTCCCATAGATCAATAAGCTCATTGAATGAGTAGGTGTTTTTAGGAGGCTTGATT criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=36 prefix-density=0.22 prefix-fanout=2.1 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.13 sequence-density-rank=13 fanout-score=58.51 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=14.8 sequence=TGTTGGTGGTGG SRR7169616 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:56:39 Started mapping on | Feb 11 10:56:40 Finished on | Feb 11 10:58:43 Mapping speed, Million of reads per hour | 597.00 Number of input reads | 20397425 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 19298460 Uniquely mapped reads % | 94.61% Average mapped length | 293.63 Number of splices: Total | 17893598 Number of splices: Annotated (sjdb) | 17592989 Number of splices: GT/AG | 17637838 Number of splices: GC/AG | 204009 Number of splices: AT/AC | 15340 Number of splices: Non-canonical | 36411 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.81 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 358734 % of reads mapped to multiple loci | 1.76% Number of reads mapped to too many loci | 21264 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.50% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 770774 770774 770774 N_multimapping 358734 358734 358734 N_noFeature 385310 19062879 482205 N_ambiguous 211750 1237 72162 UnstrandedReadsAssigned:18701400 PositiveStrandReadsAssigned:234344 NegativeStrandReadsAssigned:18744093 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169616 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169616-trimmed-pair1.fastq SRR7169616-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,397,425 reads, 18,660,566 reads pseudoaligned [quant] estimated average fragment length: 237.524 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,174 rounds 52401 SRR7169616.ke.tsv 34699 SRR7169616.se.tsv 87100 total ==> SRR7169616.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1781.48 361 9.81519 Potri.005G024800.1.v4.1 1035 798.476 51 3.09371 Potri.004G059700.1.v4.1 961 724.504 2 0.133709 Potri.007G009000.2.v4.1 1416 1179.48 0 0 Potri.003G141000.2.v4.1 2943 2706.48 328.127 5.87231 Potri.016G087400.1.v4.1 270 79.8097 1847 1120.94 Potri.015G069301.1.v4.1 564 331.595 0 0 Potri.010G195200.1.v4.1 1773 1536.48 12 0.378292 Potri.012G127500.1.v4.1 977 740.497 6866 449.109 ==> SRR7169616.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1410 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 366 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169616 completed mapping pipeline successfully