Starting /dee2/code/volunteer_pipeline.sh SRR7169617 current disk space = 3052950970368 free memory = 1494695880 SRR7169617 SRAfilesize 062b493ed333959db93b3d8ea2189c00 SRR7169617.sra SRR7169617.sra file validated SRR7169617 is paired end SRR7169617 is conventional basespace SRR7169617 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169617_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.3025 34.0 33.0 34.0 18.0 34.0 2 32.84725 34.0 33.0 34.0 28.0 34.0 3 32.97025 34.0 33.0 34.0 30.0 34.0 4 33.38925 34.0 33.0 34.0 33.0 34.0 5 33.3225 34.0 33.0 34.0 33.0 34.0 6 36.912 38.0 37.0 38.0 35.0 38.0 7 37.29625 38.0 38.0 38.0 36.0 38.0 8 37.36025 38.0 38.0 38.0 37.0 38.0 9 37.5225 38.0 38.0 38.0 37.0 38.0 10-14 37.46885 38.0 38.0 38.0 37.4 38.0 15-19 37.5176 38.0 38.0 38.0 37.6 38.0 20-24 37.46915 38.0 38.0 38.0 37.2 38.0 25-29 37.396950000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.3095 38.0 38.0 38.0 37.0 38.0 35-39 37.267399999999995 38.0 38.0 38.0 36.8 38.0 40-44 36.921299999999995 38.0 38.0 38.0 35.4 38.0 45-49 36.769999999999996 38.0 38.0 38.0 34.8 38.0 50-54 36.62305 38.0 38.0 38.0 34.0 38.0 55-59 36.507600000000004 38.0 38.0 38.0 34.0 38.0 60-64 36.424549999999996 38.0 38.0 38.0 34.0 38.0 65-69 36.2894 38.0 37.6 38.0 33.6 38.0 70-74 36.18005 38.0 37.0 38.0 33.0 38.0 75-79 36.0316 38.0 37.0 38.0 33.0 38.0 80-84 35.90745 38.0 37.0 38.0 32.2 38.0 85-89 35.7718 38.0 37.0 38.0 31.4 38.0 90-94 35.44865 38.0 36.2 38.0 29.4 38.0 95-99 35.1789 38.0 36.2 38.0 29.2 38.0 100-104 34.8001 38.0 35.8 38.0 26.8 38.0 105-109 34.581050000000005 38.0 35.2 38.0 25.8 38.0 110-114 34.23175 38.0 34.8 38.0 23.4 38.0 115-119 34.017450000000004 38.0 34.6 38.0 21.4 38.0 120-124 33.351 37.8 33.8 38.0 17.8 38.0 125-129 33.15659999999999 38.0 34.0 38.0 15.0 38.0 130-134 32.790200000000006 37.8 33.2 38.0 15.0 38.0 135-139 32.4182 37.6 33.0 38.0 14.6 38.0 140-144 31.425599999999996 36.0 30.6 38.0 13.6 38.0 145-149 29.856450000000002 35.6 28.0 38.0 4.2 38.0 150-151 25.436999999999998 33.0 14.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 1.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 2.0 13 1.0 14 1.0 15 4.0 16 6.0 17 14.0 18 10.0 19 9.0 20 9.0 21 10.0 22 21.0 23 28.0 24 21.0 25 23.0 26 25.0 27 39.0 28 38.0 29 45.0 30 78.0 31 98.0 32 127.0 33 178.0 34 259.0 35 466.0 36 1137.0 37 1347.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.267886855241265 13.948973932334995 10.676650027731558 36.10648918469218 2 24.875 15.45 29.225 30.45 3 21.2 18.25 25.35 35.199999999999996 4 21.575 25.650000000000002 24.05 28.725 5 22.35 29.95 25.124999999999996 22.575 6 20.1 35.4 24.975 19.525000000000002 7 14.825 28.775000000000002 39.625 16.775000000000002 8 17.95 28.15 31.5 22.400000000000002 9 16.75 27.3 33.15 22.8 10-14 18.575 31.405 27.1 22.919999999999998 15-19 18.73 30.165 27.505000000000003 23.599999999999998 20-24 19.45 29.805 27.375 23.369999999999997 25-29 19.29 29.975 27.37 23.365 30-34 19.185 29.509999999999998 27.894999999999996 23.41 35-39 19.439999999999998 29.585 27.145000000000003 23.830000000000002 40-44 19.45 30.125 27.245 23.18 45-49 19.625 29.509999999999998 27.275 23.59 50-54 19.62 30.0 26.834999999999997 23.544999999999998 55-59 19.625 29.665000000000003 27.13 23.580000000000002 60-64 19.35 30.175 26.905 23.57 65-69 19.825 29.080000000000002 27.35 23.745 70-74 20.305 29.15 27.515 23.03 75-79 19.475 29.73 27.169999999999998 23.625 80-84 19.56 29.29 26.915 24.235 85-89 19.759999999999998 28.884999999999998 27.200000000000003 24.154999999999998 90-94 19.814999999999998 29.07 27.325 23.79 95-99 19.78 28.68 26.974999999999998 24.565 100-104 19.869999999999997 28.92 27.325 23.885 105-109 19.965 28.675 27.27 24.09 110-114 19.52 29.185 27.395000000000003 23.9 115-119 20.044999999999998 28.235 27.650000000000002 24.07 120-124 20.375 28.689999999999998 26.825 24.11 125-129 20.025000000000002 29.085 26.91 23.98 130-134 19.985 28.23 27.075 24.709999999999997 135-139 20.28 29.335 26.77 23.615 140-144 20.355 28.79 26.21 24.645 145-149 20.53 28.975 26.265 24.23 150-151 20.5 29.1625 25.4625 24.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 1.0 19 3.0 20 3.5 21 3.5 22 2.0 23 1.0 24 5.0 25 7.0 26 10.0 27 14.5 28 20.0 29 23.5 30 28.0 31 41.0 32 54.0 33 61.0 34 73.0 35 89.0 36 97.5 37 107.5 38 133.0 39 164.0 40 192.5 41 219.0 42 236.5 43 248.0 44 253.5 45 238.5 46 232.0 47 230.0 48 207.5 49 190.5 50 161.5 51 129.5 52 108.0 53 85.0 54 72.0 55 61.5 56 46.5 57 40.5 58 33.5 59 18.5 60 12.5 61 11.0 62 7.0 63 6.0 64 4.5 65 3.0 66 1.5 67 1.5 68 2.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 9.85 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4206549118388 98.675 2 0.5289672544080605 1.05 3 0.025188916876574305 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025188916876574305 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCACGATATCTCGTATGC 8 0.2 TruSeq Adapter, Index 7 (97% over 35bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.7875 0.0 0.0 0.0 0.0 102-103 0.9874999999999999 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.2374999999999998 0.0 0.0 0.0 0.0 108-109 1.3624999999999998 0.0 0.0 0.0 0.0 110-111 1.525 0.0 0.0 0.0 0.0 112-113 1.6875 0.0 0.0 0.0 0.0 114-115 1.875 0.0 0.0 0.0 0.0 116-117 2.15 0.0 0.0 0.0 0.0 118-119 2.4124999999999996 0.0 0.0 0.0 0.0 120-121 2.7625 0.0 0.0 0.0 0.0 122-123 3.05 0.0 0.0 0.0 0.0 124-125 3.425 0.0 0.0 0.0 0.0 126-127 3.7875 0.0 0.0 0.0 0.0 128-129 4.1 0.0 0.0 0.0 0.0 130-131 4.35 0.0 0.0 0.0 0.0 132-133 4.825 0.0 0.0 0.0 0.0 134-135 5.175 0.0 0.0 0.0 0.0 136-137 5.637499999999999 0.0 0.0 0.0 0.0 138-139 6.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169617 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169617_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7185 33.0 33.0 34.0 32.0 34.0 2 32.6975 34.0 33.0 34.0 32.0 34.0 3 32.812 34.0 33.0 34.0 32.0 34.0 4 32.81875 34.0 33.0 34.0 32.0 34.0 5 32.807 34.0 33.0 34.0 32.0 34.0 6 36.94575 38.0 38.0 38.0 37.0 38.0 7 36.8595 38.0 38.0 38.0 37.0 38.0 8 36.913 38.0 38.0 38.0 37.0 38.0 9 36.9525 38.0 38.0 38.0 37.0 38.0 10-14 36.95815 38.0 38.0 38.0 37.0 38.0 15-19 36.84805 38.0 38.0 38.0 37.0 38.0 20-24 36.81515 38.0 38.0 38.0 37.0 38.0 25-29 36.743399999999994 38.0 38.0 38.0 36.6 38.0 30-34 36.64135 38.0 38.0 38.0 36.0 38.0 35-39 36.7245 38.0 38.0 38.0 36.4 38.0 40-44 36.67065 38.0 38.0 38.0 36.2 38.0 45-49 36.5689 38.0 38.0 38.0 35.8 38.0 50-54 36.5887 38.0 38.0 38.0 36.0 38.0 55-59 36.51755 38.0 38.0 38.0 35.8 38.0 60-64 36.4234 38.0 38.0 38.0 35.2 38.0 65-69 36.218450000000004 38.0 38.0 38.0 34.4 38.0 70-74 36.19349999999999 38.0 38.0 38.0 34.6 38.0 75-79 36.128499999999995 38.0 38.0 38.0 34.2 38.0 80-84 36.0961 38.0 38.0 38.0 34.0 38.0 85-89 35.9957 38.0 38.0 38.0 34.0 38.0 90-94 35.816 38.0 38.0 38.0 33.4 38.0 95-99 35.775999999999996 38.0 38.0 38.0 33.0 38.0 100-104 35.674 38.0 38.0 38.0 33.0 38.0 105-109 35.4546 38.0 38.0 38.0 32.2 38.0 110-114 35.2863 38.0 37.8 38.0 30.6 38.0 115-119 35.007400000000004 38.0 37.0 38.0 28.4 38.0 120-124 34.77385 38.0 36.6 38.0 27.2 38.0 125-129 34.4221 38.0 36.0 38.0 25.2 38.0 130-134 34.1055 38.0 35.4 38.0 22.2 38.0 135-139 33.70455 38.0 35.0 38.0 19.0 38.0 140-144 33.38955 38.0 34.0 38.0 18.2 38.0 145-149 32.6974 38.0 33.0 38.0 10.8 38.0 150-151 28.306624999999997 35.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 31.0 3 5.0 4 5.0 5 1.0 6 1.0 7 1.0 8 3.0 9 2.0 10 5.0 11 3.0 12 4.0 13 8.0 14 5.0 15 7.0 16 3.0 17 13.0 18 12.0 19 7.0 20 14.0 21 15.0 22 16.0 23 16.0 24 9.0 25 23.0 26 28.0 27 35.0 28 26.0 29 43.0 30 41.0 31 50.0 32 48.0 33 72.0 34 111.0 35 197.0 36 504.0 37 2636.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.75012543903663 22.77972905168088 16.658304064224787 24.811841445057702 2 29.07268170426065 26.11528822055138 27.21804511278195 17.593984962406015 3 22.31135622963149 30.734519929806968 28.428177488092253 18.52594635246929 4 24.035087719298247 33.33333333333333 23.1328320802005 19.49874686716792 5 25.720732013035846 34.294309350714464 22.837803960892455 17.147154675357232 6 21.96343601302279 36.28850488354621 23.6664162283997 18.081642875031303 7 21.813173052842476 22.489356373653894 37.13999499123466 18.55747558226897 8 23.541197094916104 24.718256949661907 26.62158777861257 25.118958176809414 9 22.71475081392437 24.818432256448787 29.97746055597295 22.489356373653894 10-14 24.25487151229775 28.307368631969144 25.968040875619895 21.46971898011321 15-19 24.11184045698251 27.514155434183497 27.013078117953597 21.360925990880393 20-24 23.856291025705268 28.16054517212006 26.96798115949291 21.015182642681765 25-29 24.046509296847592 28.512003207537713 26.81802235252844 20.623465143086253 30-34 23.792585170340683 27.875751503006015 27.48496993987976 20.846693386773545 35-39 24.153136901182602 27.305071156544397 27.500501102425336 21.041290839847665 40-44 24.57652600982259 27.8340182419565 26.84674751929438 20.74270822892653 45-49 23.875883502932478 28.226978795929618 27.2895884505489 20.607549250589003 50-54 23.856291025705268 27.368843012476823 27.4991231146966 21.27574284712131 55-59 23.88613241116624 27.46955345060893 27.94567232997544 20.698641808249384 60-64 23.839366288980244 27.980547478191113 27.67973528527023 20.500350947558406 65-69 24.210367993582675 27.820114308633308 27.980547478191113 19.9889702195929 70-74 24.641460234680572 27.880854477986162 26.983251429144516 20.49443385818875 75-79 24.019657005315416 27.600040116337375 27.99618894794905 20.384113930398154 80-84 25.026325026325026 27.573584716441857 27.287770144913004 20.112320112320113 85-89 25.080240722166497 27.81344032096289 27.442326980942827 19.663991975927782 90-94 24.00441368241549 27.435048650817535 27.86137024776808 20.699167418998897 95-99 24.303987960872835 27.79533483822423 27.454226235264613 20.446450965638324 100-104 24.19880635939616 27.684437534480168 27.875018807362455 20.241737298761223 105-109 24.247743229689068 27.75827482447342 27.918756268806423 20.075225677031096 110-114 24.731668171331126 28.573578092085466 27.154177951650116 19.540575784933292 115-119 24.662687465516374 27.677183126849574 27.762451722927224 19.897677684706828 120-124 24.969903691813805 28.17516051364366 27.573234349919744 19.281701444622794 125-129 24.821912310625063 28.13785492124009 27.77164643322966 19.268586334905187 130-134 24.851981936778724 27.436026091319622 27.88760662318113 19.824385348720522 135-139 25.033863442532482 28.370039632769778 27.44193046706467 19.15416645763307 140-144 25.002508780732562 28.40943301555444 27.175112895132962 19.412945308580028 145-149 25.37380832915203 27.857501254390364 27.631710988459606 19.136979427997993 150-151 25.5415049455365 27.306873669713283 27.01890572179792 20.132715662952297 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 7.0 1 3.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 1.5 23 3.0 24 2.0 25 1.0 26 1.5 27 1.5 28 3.0 29 7.0 30 8.0 31 12.0 32 20.5 33 26.0 34 25.5 35 36.0 36 66.0 37 84.5 38 107.0 39 141.0 40 181.5 41 217.0 42 248.0 43 287.5 44 301.5 45 300.0 46 297.0 47 277.5 48 238.5 49 199.5 50 174.0 51 165.0 52 137.0 53 99.5 54 78.0 55 59.5 56 45.0 57 32.5 58 23.0 59 19.5 60 14.5 61 7.5 62 8.5 63 8.0 64 5.5 65 5.5 66 4.5 67 2.0 68 1.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.25 3 0.27499999999999997 4 0.25 5 0.27499999999999997 6 0.17500000000000002 7 0.17500000000000002 8 0.17500000000000002 9 0.17500000000000002 10-14 0.185 15-19 0.215 20-24 0.215 25-29 0.23500000000000001 30-34 0.2 35-39 0.22 40-44 0.22999999999999998 45-49 0.255 50-54 0.215 55-59 0.23500000000000001 60-64 0.27 65-69 0.27 70-74 0.29 75-79 0.29 80-84 0.28500000000000003 85-89 0.3 90-94 0.31 95-99 0.325 100-104 0.305 105-109 0.3 110-114 0.31 115-119 0.315 120-124 0.32 125-129 0.33 130-134 0.35000000000000003 135-139 0.335 140-144 0.35000000000000003 145-149 0.35000000000000003 150-151 0.1625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49596774193549 98.7 2 0.4284274193548387 0.8500000000000001 3 0.025201612903225805 0.075 4 0.0 0.0 5 0.0 0.0 6 0.025201612903225805 0.15 7 0.0 0.0 8 0.0 0.0 9 0.025201612903225805 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 9 0.22499999999999998 Illumina Single End PCR Primer 1 (100% over 50bp) NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.6499999999999999 0.0 0.0 0.0 0.0 100-101 0.8125 0.0 0.0 0.0 0.0 102-103 1.025 0.0 0.0 0.0 0.0 104-105 1.1749999999999998 0.0 0.0 0.0 0.0 106-107 1.3624999999999998 0.0 0.0 0.0 0.0 108-109 1.5125 0.0 0.0 0.0 0.0 110-111 1.7125 0.0 0.0 0.0 0.0 112-113 1.875 0.0 0.0 0.0 0.0 114-115 2.025 0.0 0.0 0.0 0.0 116-117 2.325 0.0 0.0 0.0 0.0 118-119 2.6125 0.0 0.0 0.0 0.0 120-121 2.975 0.0 0.0 0.0 0.0 122-123 3.275 0.0 0.0 0.0 0.0 124-125 3.65 0.0 0.0 0.0 0.0 126-127 4.0375 0.0 0.0 0.0 0.0 128-129 4.3375 0.0 0.0 0.0 0.0 130-131 4.6375 0.0 0.0 0.0 0.0 132-133 5.175 0.0 0.0 0.0 0.0 134-135 5.5875 0.0 0.0 0.0 0.0 136-137 6.074999999999999 0.0 0.0 0.0 0.0 138-139 6.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 969526 spots for SRR7169617.sra Written 969526 spots for SRR7169617.sra Read 969526 spots for SRR7169617.sra Written 969526 spots for SRR7169617.sra Read 969526 spots for SRR7169617.sra Written 969526 spots for SRR7169617.sra Read 969526 spots for SRR7169617.sra Written 969526 spots for SRR7169617.sra Read 969526 spots for SRR7169617.sra Written 969526 spots for SRR7169617.sra Read 969526 spots for SRR7169617.sra Written 969526 spots for SRR7169617.sra Read 969526 spots for SRR7169617.sra Written 969526 spots for SRR7169617.sra Read 969539 spots for SRR7169617.sra Written 969539 spots for SRR7169617.sra Read 969526 spots for SRR7169617.sra Written 969526 spots for SRR7169617.sra Read 969526 spots for SRR7169617.sra Written 969526 spots for SRR7169617.sra Read 969526 spots for SRR7169617.sra Written 969526 spots for SRR7169617.sra Read 969526 spots for SRR7169617.sra Written 969526 spots for SRR7169617.sra Read 969526 spots for SRR7169617.sra Written 969526 spots for SRR7169617.sra Read 969526 spots for SRR7169617.sra Written 969526 spots for SRR7169617.sra Read 969526 spots for SRR7169617.sra Written 969526 spots for SRR7169617.sra Read 969526 spots for SRR7169617.sra Written 969526 spots for SRR7169617.sra Read 969526 spots for SRR7169617.sra Written 969526 spots for SRR7169617.sra Read 969526 spots for SRR7169617.sra Written 969526 spots for SRR7169617.sra Read 969526 spots for SRR7169617.sra Written 969526 spots for SRR7169617.sra Read 969526 spots for SRR7169617.sra Written 969526 spots for SRR7169617.sra SRR ids: ['SRR7169617.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zwtnbzmu SRR7169617.sra spots: 19390533 blocks: [[1, 969526], [969527, 1939052], [1939053, 2908578], [2908579, 3878104], [3878105, 4847630], [4847631, 5817156], [5817157, 6786682], [6786683, 7756208], [7756209, 8725734], [8725735, 9695260], [9695261, 10664786], [10664787, 11634312], [11634313, 12603838], [12603839, 13573364], [13573365, 14542890], [14542891, 15512416], [15512417, 16481942], [16481943, 17451468], [17451469, 18420994], [18420995, 19390533]] SRR7169617 file size 6549115 SRR7169617 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169617 SRR7169617_1.fastq SRR7169617_2.fastq Input file: SRR7169617_1.fastq Paired file: SRR7169617_2.fastq trimmed: SRR7169617-trimmed-pair1.fastq, SRR7169617-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:51:10 2025 >> started Tue Feb 11 10:51:32 2025 >> done (21.538s) 19390533 read pairs processed; of these: 48368 ( 0.25%) short read pairs filtered out after trimming by size control 162281 ( 0.84%) empty read pairs filtered out after trimming by size control 19179884 (98.91%) read pairs available; of these: 10425462 (54.36%) trimmed read pairs available after processing 8754422 (45.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 9 0.00% 20 10 0.00% 21 11 0.00% 22 21 0.00% 23 14 0.00% 24 15 0.00% 25 11 0.00% 26 11 0.00% 27 22 0.00% 28 12 0.00% 29 28 0.00% 30 36 0.00% 31 28 0.00% 32 16 0.00% 33 16 0.00% 34 31 0.00% 35 22 0.00% 36 30 0.00% 37 31 0.00% 38 40 0.00% 39 45 0.00% 40 45 0.00% 41 48 0.00% 42 46 0.00% 43 59 0.00% 44 81 0.00% 45 102 0.00% 46 102 0.00% 47 106 0.00% 48 124 0.00% 49 128 0.00% 50 191 0.00% 51 221 0.00% 52 298 0.00% 53 287 0.00% 54 212 0.00% 55 220 0.00% 56 239 0.00% 57 255 0.00% 58 340 0.00% 59 323 0.00% 60 334 0.00% 61 398 0.00% 62 451 0.00% 63 536 0.00% 64 621 0.00% 65 662 0.00% 66 1086 0.01% 67 1754 0.01% 68 2020 0.01% 69 2711 0.01% 70 3798 0.02% 71 2856 0.01% 72 2287 0.01% 73 1943 0.01% 74 1918 0.01% 75 2001 0.01% 76 2175 0.01% 77 2242 0.01% 78 2414 0.01% 79 2856 0.01% 80 3171 0.02% 81 3689 0.02% 82 4105 0.02% 83 4769 0.02% 84 6872 0.04% 85 7914 0.04% 86 8300 0.04% 87 8996 0.05% 88 9595 0.05% 89 10112 0.05% 90 10909 0.06% 91 11131 0.06% 92 11772 0.06% 93 13122 0.07% 94 13886 0.07% 95 14499 0.08% 96 15405 0.08% 97 16463 0.09% 98 16559 0.09% 99 17152 0.09% 100 18838 0.10% 101 19242 0.10% 102 20866 0.11% 103 22068 0.12% 104 23205 0.12% 105 24813 0.13% 106 26281 0.14% 107 26791 0.14% 108 28047 0.15% 109 29180 0.15% 110 30598 0.16% 111 31831 0.17% 112 32974 0.17% 113 35666 0.19% 114 37146 0.19% 115 38486 0.20% 116 39618 0.21% 117 41309 0.22% 118 42106 0.22% 119 43800 0.23% 120 45098 0.24% 121 46687 0.24% 122 48859 0.25% 123 51579 0.27% 124 54375 0.28% 125 57084 0.30% 126 59531 0.31% 127 62096 0.32% 128 64364 0.34% 129 67002 0.35% 130 69818 0.36% 131 72548 0.38% 132 76094 0.40% 133 79969 0.42% 134 85012 0.44% 135 90698 0.47% 136 95392 0.50% 137 101375 0.53% 138 108154 0.56% 139 115445 0.60% 140 124030 0.65% 141 134310 0.70% 142 148613 0.77% 143 170058 0.89% 144 192494 1.00% 145 229827 1.20% 146 286984 1.50% 147 389850 2.03% 148 595262 3.10% 149 1170381 6.10% 150 4672226 24.36% 151 8754422 45.64% 19179884 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=4.68 fanout-score-rank=28 prefix-density=0.21 prefix-fanout=3.4 sequence=GGCTTCTCCCATTTGAGGGGCTTGACAAC criterion=fanout-score sequence-density=0.10 sequence-density-rank=18 fanout-score=109.86 fanout-score-rank=1 prefix-density=0.60 prefix-fanout=18.8 sequence=TCATCTTCACAAAC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=4.79 fanout-score-rank=22 prefix-density=0.45 prefix-fanout=3.1 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.03 sequence-density-rank=38 fanout-score=155.62 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=14.0 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGAT SRR7169617 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:52:17 Started mapping on | Feb 11 10:52:17 Finished on | Feb 11 10:54:30 Mapping speed, Million of reads per hour | 519.15 Number of input reads | 19179884 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 17871307 Uniquely mapped reads % | 93.18% Average mapped length | 292.51 Number of splices: Total | 14519454 Number of splices: Annotated (sjdb) | 14255671 Number of splices: GT/AG | 14306287 Number of splices: GC/AG | 163778 Number of splices: AT/AC | 13417 Number of splices: Non-canonical | 35972 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 355508 % of reads mapped to multiple loci | 1.85% Number of reads mapped to too many loci | 32423 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.73% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 987155 987155 987155 N_multimapping 355508 355508 355508 N_noFeature 421519 17617699 528763 N_ambiguous 217978 1118 70881 UnstrandedReadsAssigned:17231810 PositiveStrandReadsAssigned:252490 NegativeStrandReadsAssigned:17271663 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7169617 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169617-trimmed-pair1.fastq SRR7169617-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,179,884 reads, 17,252,404 reads pseudoaligned [quant] estimated average fragment length: 233.704 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,187 rounds 52401 SRR7169617.ke.tsv 34699 SRR7169617.se.tsv 87100 total ==> SRR7169617.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1785.3 265 7.1196 Potri.005G024800.1.v4.1 1035 802.296 49 2.92942 Potri.004G059700.1.v4.1 961 728.306 1 0.0658577 Potri.007G009000.2.v4.1 1416 1183.3 0 0 Potri.003G141000.2.v4.1 2943 2710.3 323.038 5.71686 Potri.016G087400.1.v4.1 270 79.0156 2261.53 1372.81 Potri.015G069301.1.v4.1 564 333.89 0 0 Potri.010G195200.1.v4.1 1773 1540.3 51 1.58813 Potri.012G127500.1.v4.1 977 744.296 7747 499.238 ==> SRR7169617.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1698 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 425 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169617 completed mapping pipeline successfully