Starting /dee2/code/volunteer_pipeline.sh SRR7169618 current disk space = 3052997718016 free memory = 1507109644 SRR7169618 SRAfilesize 596f4f95eaeb11061ff15d3fdaad5291 SRR7169618.sra SRR7169618.sra file validated SRR7169618 is paired end SRR7169618 is conventional basespace SRR7169618 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169618_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.86675 34.0 33.0 34.0 33.0 34.0 2 33.41075 34.0 34.0 34.0 33.0 34.0 3 33.453 34.0 34.0 34.0 33.0 34.0 4 33.4805 34.0 34.0 34.0 33.0 34.0 5 33.49875 34.0 34.0 34.0 33.0 34.0 6 37.048 38.0 37.0 38.0 36.0 38.0 7 37.3995 38.0 38.0 38.0 37.0 38.0 8 37.39925 38.0 38.0 38.0 37.0 38.0 9 37.49225 38.0 38.0 38.0 37.0 38.0 10-14 37.52145 38.0 38.0 38.0 37.4 38.0 15-19 37.4962 38.0 38.0 38.0 37.8 38.0 20-24 37.48465 38.0 38.0 38.0 37.8 38.0 25-29 37.4462 38.0 38.0 38.0 38.0 38.0 30-34 37.4188 38.0 38.0 38.0 37.4 38.0 35-39 37.20525000000001 38.0 38.0 38.0 36.6 38.0 40-44 37.326899999999995 38.0 38.0 38.0 37.0 38.0 45-49 37.2961 38.0 38.0 38.0 37.0 38.0 50-54 37.1784 38.0 38.0 38.0 36.8 38.0 55-59 37.177299999999995 38.0 38.0 38.0 36.6 38.0 60-64 37.163 38.0 38.0 38.0 36.6 38.0 65-69 37.07545 38.0 38.0 38.0 36.0 38.0 70-74 37.029450000000004 38.0 38.0 38.0 36.0 38.0 75-79 36.98025 38.0 38.0 38.0 36.0 38.0 80-84 36.96704999999999 38.0 38.0 38.0 36.0 38.0 85-89 36.868399999999994 38.0 38.0 38.0 35.6 38.0 90-94 36.82065 38.0 38.0 38.0 35.8 38.0 95-99 36.6717 38.0 38.0 38.0 34.6 38.0 100-104 36.5458 38.0 38.0 38.0 34.2 38.0 105-109 36.5142 38.0 38.0 38.0 34.0 38.0 110-114 36.306000000000004 38.0 38.0 38.0 34.0 38.0 115-119 36.18795 38.0 37.8 38.0 33.8 38.0 120-124 36.1168 38.0 37.8 38.0 33.4 38.0 125-129 35.85979999999999 38.0 37.0 38.0 32.6 38.0 130-134 35.677949999999996 38.0 36.8 38.0 31.6 38.0 135-139 35.416199999999996 38.0 36.0 38.0 31.0 38.0 140-144 35.0806 38.0 36.0 38.0 30.0 38.0 145-149 34.38985 38.0 35.2 38.0 27.0 38.0 150-151 31.59825 36.5 31.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 1.0 14 1.0 15 0.0 16 2.0 17 3.0 18 4.0 19 4.0 20 5.0 21 6.0 22 4.0 23 5.0 24 9.0 25 10.0 26 19.0 27 23.0 28 19.0 29 30.0 30 33.0 31 48.0 32 65.0 33 79.0 34 125.0 35 187.0 36 493.0 37 2822.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.84985980117257 14.14733622227887 7.290339026255417 35.712464950293146 2 23.9 13.55 34.849999999999994 27.700000000000003 3 19.875 19.675 28.075 32.375 4 21.925 27.700000000000003 24.05 26.325 5 21.025 34.2 24.7 20.075000000000003 6 19.025 36.05 24.4 20.525 7 13.600000000000001 27.450000000000003 41.099999999999994 17.849999999999998 8 17.224999999999998 25.974999999999998 29.849999999999998 26.950000000000003 9 16.650000000000002 24.075 34.075 25.2 10-14 19.57 30.44 27.235 22.755 15-19 19.564999999999998 29.09 27.37 23.974999999999998 20-24 19.869999999999997 28.785 27.950000000000003 23.395 25-29 19.885 29.53 26.735 23.849999999999998 30-34 19.794999999999998 29.62 27.229999999999997 23.355 35-39 19.683857735981192 28.978040118053123 27.53238957530889 23.805712570656794 40-44 19.395 29.025000000000002 27.779999999999998 23.799999999999997 45-49 20.375 28.26 27.305 24.060000000000002 50-54 20.015 29.220000000000002 27.29 23.474999999999998 55-59 19.925 29.270000000000003 26.919999999999998 23.885 60-64 19.509999999999998 29.28 27.605 23.605 65-69 19.875 28.725 27.705000000000002 23.695 70-74 19.830000000000002 29.189999999999998 27.04 23.94 75-79 20.32 28.98 27.589999999999996 23.11 80-84 20.200000000000003 28.955 27.52 23.325000000000003 85-89 20.54 28.985 27.67 22.805 90-94 20.23 28.73 27.16 23.880000000000003 95-99 20.995 28.799999999999997 27.365000000000002 22.84 100-104 20.25 28.884999999999998 27.295 23.57 105-109 20.53 28.82 27.0 23.65 110-114 20.765 27.96 28.18 23.095 115-119 20.54 28.54 27.18 23.74 120-124 20.705000000000002 28.845 26.634999999999998 23.815 125-129 20.885 28.325 27.045 23.745 130-134 21.68 28.050000000000004 26.905 23.365 135-139 20.53 28.68 27.075 23.715 140-144 21.255 28.32 26.57 23.855 145-149 21.08 28.449999999999996 26.715 23.755000000000003 150-151 22.225 27.8125 25.974999999999998 23.9875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 2.0 19 1.5 20 0.5 21 1.0 22 2.5 23 3.0 24 3.5 25 3.5 26 4.0 27 8.0 28 9.5 29 12.5 30 21.0 31 29.5 32 37.0 33 45.0 34 58.5 35 74.5 36 90.0 37 109.5 38 123.0 39 149.0 40 192.0 41 227.5 42 257.0 43 264.0 44 264.0 45 276.5 46 278.5 47 257.0 48 221.5 49 190.0 50 168.5 51 139.5 52 118.5 53 100.0 54 73.0 55 53.0 56 32.0 57 23.5 58 22.0 59 12.5 60 8.5 61 8.5 62 6.0 63 3.5 64 1.5 65 3.0 66 3.0 67 2.5 68 2.0 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.925 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.045 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.42500000000000004 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 0.8999999999999999 0.0 0.0 0.0 0.0 102-103 1.05 0.0 0.0 0.0 0.0 104-105 1.225 0.0 0.0 0.0 0.0 106-107 1.3875 0.0 0.0 0.0 0.0 108-109 1.5875 0.0 0.0 0.0 0.0 110-111 1.7125 0.0 0.0 0.0 0.0 112-113 1.9625000000000001 0.0 0.0 0.0 0.0 114-115 2.2625 0.0 0.0 0.0 0.0 116-117 2.5 0.0 0.0 0.0 0.0 118-119 2.7375 0.0 0.0 0.0 0.0 120-121 3.0125 0.0 0.0 0.0 0.0 122-123 3.3875 0.0 0.0 0.0 0.0 124-125 3.9250000000000003 0.0 0.0 0.0 0.0 126-127 4.35 0.0 0.0 0.0 0.0 128-129 4.5875 0.0 0.0 0.0 0.0 130-131 4.800000000000001 0.0 0.0 0.0 0.0 132-133 5.075 0.0 0.0 0.0 0.0 134-135 5.4875 0.0 0.0 0.0 0.0 136-137 5.975 0.0 0.0 0.0 0.0 138-139 6.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACGATA 10 0.006830828 145.0 9 GTGGTCA 10 0.006830828 145.0 8 CATACCA 10 0.006830828 145.0 4 >>END_MODULE SRR7169618 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169618_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.95775 33.0 33.0 34.0 32.0 34.0 2 33.06975 34.0 33.0 34.0 32.0 34.0 3 33.11 34.0 33.0 34.0 33.0 34.0 4 33.12425 34.0 33.0 34.0 33.0 34.0 5 33.06525 34.0 33.0 34.0 33.0 34.0 6 37.1835 38.0 38.0 38.0 37.0 38.0 7 37.196 38.0 38.0 38.0 37.0 38.0 8 37.16575 38.0 38.0 38.0 37.0 38.0 9 37.179 38.0 38.0 38.0 37.0 38.0 10-14 37.13375 38.0 38.0 38.0 37.0 38.0 15-19 37.101099999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.010349999999995 38.0 38.0 38.0 37.0 38.0 25-29 36.9816 38.0 38.0 38.0 36.8 38.0 30-34 36.93035 38.0 38.0 38.0 36.2 38.0 35-39 36.9001 38.0 38.0 38.0 36.0 38.0 40-44 36.93605 38.0 38.0 38.0 36.0 38.0 45-49 36.9439 38.0 38.0 38.0 36.2 38.0 50-54 36.95185 38.0 38.0 38.0 36.4 38.0 55-59 36.6668 38.0 38.0 38.0 35.0 38.0 60-64 36.796749999999996 38.0 38.0 38.0 36.0 38.0 65-69 36.7684 38.0 38.0 38.0 35.8 38.0 70-74 36.6734 38.0 38.0 38.0 35.2 38.0 75-79 36.65515 38.0 38.0 38.0 35.4 38.0 80-84 36.50705000000001 38.0 38.0 38.0 34.8 38.0 85-89 36.3941 38.0 38.0 38.0 34.2 38.0 90-94 36.306900000000006 38.0 38.0 38.0 34.0 38.0 95-99 36.28985 38.0 38.0 38.0 34.0 38.0 100-104 36.1169 38.0 38.0 38.0 33.8 38.0 105-109 36.07705 38.0 38.0 38.0 34.0 38.0 110-114 35.908049999999996 38.0 37.8 38.0 33.2 38.0 115-119 35.76655000000001 38.0 37.4 38.0 32.6 38.0 120-124 35.5083 38.0 37.0 38.0 31.0 38.0 125-129 35.21965 38.0 36.4 38.0 29.8 38.0 130-134 35.081050000000005 38.0 36.0 38.0 28.6 38.0 135-139 34.6662 38.0 35.8 38.0 27.6 38.0 140-144 34.1565 38.0 35.0 38.0 23.4 38.0 145-149 33.4913 38.0 35.0 38.0 19.0 38.0 150-151 29.773625 36.5 28.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 12.0 4 1.0 5 2.0 6 0.0 7 0.0 8 1.0 9 0.0 10 1.0 11 1.0 12 2.0 13 1.0 14 4.0 15 2.0 16 5.0 17 4.0 18 9.0 19 7.0 20 5.0 21 10.0 22 8.0 23 11.0 24 15.0 25 20.0 26 20.0 27 28.0 28 29.0 29 36.0 30 28.0 31 55.0 32 75.0 33 83.0 34 136.0 35 203.0 36 526.0 37 2654.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.225 23.45 10.25 25.074999999999996 2 27.500000000000004 26.325 29.425 16.75 3 18.575 29.099999999999998 32.35 19.975 4 22.475 34.8 24.375 18.35 5 25.05 35.6 21.275 18.075 6 19.503634996239658 39.53371772374029 23.614941087991976 17.347706192028078 7 19.28284854563691 21.639919759277834 39.317953861584755 19.7592778335005 8 20.857357733767863 24.818250188017046 27.751316119328152 26.57307595888694 9 21.43394334419654 24.74304336926548 29.731762346452744 24.091250940085235 10-14 23.222344799919767 28.94895196068599 26.923076923076923 20.90562631631732 15-19 23.0306373163516 27.859399287970714 27.729027729027727 21.380935666649954 20-24 23.06805074971165 27.96248934356351 27.817060327967503 21.152399578757333 25-29 23.217330257747467 28.146625213118043 27.87583993581386 20.76020459332063 30-34 23.239719157472415 27.748244734202608 27.948846539618856 21.063189568706118 35-39 23.464219447369743 27.661601725089014 28.0577704227471 20.816408404794142 40-44 22.843963096670677 28.26915363016446 27.68251103088648 21.20437224227838 45-49 22.69012884142979 28.184689426981503 28.224795708627866 20.900386022960845 50-54 23.379618025966213 27.655521580029074 28.111684796230385 20.853175597774325 55-59 23.81573011178505 27.485086971778035 28.492656273497417 20.206526642939497 60-64 23.452148192710684 27.512909209404924 28.239835564245254 20.795107033639145 65-69 23.4320950518875 27.302351230761516 28.45540682809445 20.81014688925653 70-74 23.975933817999497 27.71621960391075 27.56079217849085 20.747054399598895 75-79 23.594885936324893 27.360240661820008 28.478315367259967 20.566558034595136 80-84 23.03680673954468 27.810650887573964 28.723297562932505 20.42924480994885 85-89 23.482492224340323 27.791712651750778 28.08768937493729 20.638105748971604 90-94 23.736208625877634 27.833500501504517 27.83851554663992 20.591775325977935 95-99 23.344196540486337 27.44046126848834 28.799197793933317 20.416144397092005 100-104 23.85201523962302 28.373771806697413 27.51654301183076 20.257669941848807 105-109 23.358395989974937 28.100250626566414 28.39598997493734 20.145363408521302 110-114 24.363344696210145 26.8748746741528 28.438941247242834 20.322839382394225 115-119 24.128941695493054 27.979144733543894 28.084423722865594 19.80748984809746 120-124 23.79687186685382 27.712051333467013 27.83236414678163 20.658712652897535 125-129 24.606437380928504 27.830141381730673 27.739897723854405 19.823523513486414 130-134 24.24044921287476 28.456833450315855 27.33881479995989 19.963902536849492 135-139 24.934817488969113 27.8529883674288 27.115924588848777 20.09626955475331 140-144 24.593944255063164 27.621816723481054 27.53158211349509 20.2526569079607 145-149 24.6265664160401 28.37593984962406 27.2531328320802 19.74436090225564 150-151 25.3566958698373 28.147684605757195 27.384230287859822 19.11138923654568 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.5 2 3.0 3 2.5 4 1.5 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 1.0 22 1.0 23 1.0 24 2.0 25 1.5 26 1.5 27 4.5 28 5.0 29 5.5 30 8.0 31 14.5 32 22.5 33 32.5 34 51.5 35 67.0 36 86.0 37 104.0 38 132.0 39 172.5 40 182.5 41 212.0 42 262.5 43 292.0 44 292.0 45 276.5 46 280.0 47 271.5 48 241.0 49 196.0 50 167.5 51 148.0 52 110.0 53 94.0 54 76.5 55 49.5 56 34.5 57 25.5 58 19.0 59 10.5 60 9.5 61 7.5 62 4.0 63 2.0 64 0.5 65 1.0 66 2.0 67 2.5 68 1.5 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.27499999999999997 7 0.3 8 0.27499999999999997 9 0.27499999999999997 10-14 0.29 15-19 0.28500000000000003 20-24 0.295 25-29 0.29 30-34 0.3 35-39 0.295 40-44 0.27999999999999997 45-49 0.265 50-54 0.255 55-59 0.255 60-64 0.265 65-69 0.265 70-74 0.27499999999999997 75-79 0.27499999999999997 80-84 0.29 85-89 0.33 90-94 0.3 95-99 0.27499999999999997 100-104 0.26 105-109 0.25 110-114 0.26 115-119 0.265 120-124 0.26 125-129 0.27 130-134 0.27 135-139 0.27999999999999997 140-144 0.26 145-149 0.25 150-151 0.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74924774322969 99.45 2 0.22567703109327986 0.44999999999999996 3 0.0 0.0 4 0.025075225677031094 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.42500000000000004 0.0 0.0 0.0 0.0 92-93 0.5375 0.0 0.0 0.0 0.0 94-95 0.65 0.0 0.0 0.0 0.0 96-97 0.725 0.0 0.0 0.0 0.0 98-99 0.825 0.0 0.0 0.0 0.0 100-101 0.925 0.0 0.0 0.0 0.0 102-103 1.075 0.0 0.0 0.0 0.0 104-105 1.25 0.0 0.0 0.0 0.0 106-107 1.3875 0.0 0.0 0.0 0.0 108-109 1.5875 0.0 0.0 0.0 0.0 110-111 1.7125 0.0 0.0 0.0 0.0 112-113 1.9625000000000001 0.0 0.0 0.0 0.0 114-115 2.25 0.0 0.0 0.0 0.0 116-117 2.5 0.0 0.0 0.0 0.0 118-119 2.7375 0.0 0.0 0.0 0.0 120-121 3.0375 0.0 0.0 0.0 0.0 122-123 3.4125 0.0 0.0 0.0 0.0 124-125 3.95 0.0 0.0 0.0 0.0 126-127 4.375 0.0 0.0 0.0 0.0 128-129 4.6375 0.0 0.0 0.0 0.0 130-131 4.8125 0.0 0.0 0.0 0.0 132-133 5.05 0.0 0.0 0.0 0.0 134-135 5.475 0.0 0.0 0.0 0.0 136-137 5.9375 0.0 0.0 0.0 0.0 138-139 6.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTGTTT 10 0.006830828 145.0 9 >>END_MODULE Read 918881 spots for SRR7169618.sra Written 918881 spots for SRR7169618.sra Read 918881 spots for SRR7169618.sra Written 918881 spots for SRR7169618.sra Read 918881 spots for SRR7169618.sra Written 918881 spots for SRR7169618.sra Read 918881 spots for SRR7169618.sra Written 918881 spots for SRR7169618.sra Read 918881 spots for SRR7169618.sra Written 918881 spots for SRR7169618.sra Read 918881 spots for SRR7169618.sra Written 918881 spots for SRR7169618.sra Read 918881 spots for SRR7169618.sra Written 918881 spots for SRR7169618.sra Read 918881 spots for SRR7169618.sra Written 918881 spots for SRR7169618.sra Read 918881 spots for SRR7169618.sra Written 918881 spots for SRR7169618.sra Read 918897 spots for SRR7169618.sra Written 918897 spots for SRR7169618.sra Read 918881 spots for SRR7169618.sra Written 918881 spots for SRR7169618.sra Read 918881 spots for SRR7169618.sra Written 918881 spots for SRR7169618.sra Read 918881 spots for SRR7169618.sra Written 918881 spots for SRR7169618.sra Read 918881 spots for SRR7169618.sra Written 918881 spots for SRR7169618.sra Read 918881 spots for SRR7169618.sra Written 918881 spots for SRR7169618.sra Read 918881 spots for SRR7169618.sra Written 918881 spots for SRR7169618.sra Read 918881 spots for SRR7169618.sra Written 918881 spots for SRR7169618.sra Read 918881 spots for SRR7169618.sra Written 918881 spots for SRR7169618.sra Read 918881 spots for SRR7169618.sra Written 918881 spots for SRR7169618.sra Read 918881 spots for SRR7169618.sra Written 918881 spots for SRR7169618.sra SRR ids: ['SRR7169618.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tna38x_j SRR7169618.sra spots: 18377636 blocks: [[1, 918881], [918882, 1837762], [1837763, 2756643], [2756644, 3675524], [3675525, 4594405], [4594406, 5513286], [5513287, 6432167], [6432168, 7351048], [7351049, 8269929], [8269930, 9188810], [9188811, 10107691], [10107692, 11026572], [11026573, 11945453], [11945454, 12864334], [12864335, 13783215], [13783216, 14702096], [14702097, 15620977], [15620978, 16539858], [16539859, 17458739], [17458740, 18377636]] SRR7169618 file size 6205877 SRR7169618 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169618 SRR7169618_1.fastq SRR7169618_2.fastq Input file: SRR7169618_1.fastq Paired file: SRR7169618_2.fastq trimmed: SRR7169618-trimmed-pair1.fastq, SRR7169618-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:44:23 2025 >> started Tue Feb 11 10:44:42 2025 >> done (19.441s) 18377636 read pairs processed; of these: 37524 ( 0.20%) short read pairs filtered out after trimming by size control 37530 ( 0.20%) empty read pairs filtered out after trimming by size control 18302582 (99.59%) read pairs available; of these: 8780521 (47.97%) trimmed read pairs available after processing 9522061 (52.03%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 2 0.00% 20 6 0.00% 21 8 0.00% 22 11 0.00% 23 9 0.00% 24 10 0.00% 25 5 0.00% 26 8 0.00% 27 9 0.00% 28 8 0.00% 29 17 0.00% 30 12 0.00% 31 11 0.00% 32 11 0.00% 33 16 0.00% 34 17 0.00% 35 20 0.00% 36 17 0.00% 37 23 0.00% 38 26 0.00% 39 30 0.00% 40 21 0.00% 41 20 0.00% 42 28 0.00% 43 37 0.00% 44 29 0.00% 45 42 0.00% 46 65 0.00% 47 57 0.00% 48 87 0.00% 49 78 0.00% 50 94 0.00% 51 120 0.00% 52 156 0.00% 53 119 0.00% 54 141 0.00% 55 169 0.00% 56 151 0.00% 57 187 0.00% 58 232 0.00% 59 274 0.00% 60 336 0.00% 61 359 0.00% 62 374 0.00% 63 439 0.00% 64 467 0.00% 65 525 0.00% 66 578 0.00% 67 645 0.00% 68 743 0.00% 69 1130 0.01% 70 1154 0.01% 71 1197 0.01% 72 1398 0.01% 73 1460 0.01% 74 1637 0.01% 75 1846 0.01% 76 1999 0.01% 77 2178 0.01% 78 2340 0.01% 79 2740 0.01% 80 3017 0.02% 81 3532 0.02% 82 3955 0.02% 83 4572 0.02% 84 5800 0.03% 85 6551 0.04% 86 6857 0.04% 87 7235 0.04% 88 7649 0.04% 89 8267 0.05% 90 9023 0.05% 91 9792 0.05% 92 10781 0.06% 93 11806 0.06% 94 12464 0.07% 95 13047 0.07% 96 13702 0.07% 97 14429 0.08% 98 14800 0.08% 99 15619 0.09% 100 16524 0.09% 101 17991 0.10% 102 19131 0.10% 103 20460 0.11% 104 21847 0.12% 105 22804 0.12% 106 23585 0.13% 107 24366 0.13% 108 24634 0.13% 109 25834 0.14% 110 26612 0.15% 111 27907 0.15% 112 29197 0.16% 113 31278 0.17% 114 32923 0.18% 115 34713 0.19% 116 35277 0.19% 117 36458 0.20% 118 36884 0.20% 119 37218 0.20% 120 38983 0.21% 121 40243 0.22% 122 42479 0.23% 123 44974 0.25% 124 47282 0.26% 125 49143 0.27% 126 51639 0.28% 127 52760 0.29% 128 54387 0.30% 129 56130 0.31% 130 58438 0.32% 131 61207 0.33% 132 64662 0.35% 133 68426 0.37% 134 72583 0.40% 135 77191 0.42% 136 81881 0.45% 137 86246 0.47% 138 91795 0.50% 139 97892 0.53% 140 104554 0.57% 141 112478 0.61% 142 123319 0.67% 143 137538 0.75% 144 157623 0.86% 145 185600 1.01% 146 224057 1.22% 147 301611 1.65% 148 456543 2.49% 149 898361 4.91% 150 4086019 22.32% 151 9522061 52.03% 18302582 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.78 fanout-score-rank=34 prefix-density=0.24 prefix-fanout=2.4 sequence=CTGGCCATTCAATGTGACATCCTCTTGAGTGGCTTTCAAAAGCCTGATAAAAACGCTGAACTGACCACCTTTTTCTAGGACTTTGGTGACATTGGTTGGACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=290.87 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=19.8 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTT criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.62 fanout-score-rank=36 prefix-density=0.28 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.05 sequence-density-rank=40 fanout-score=67.92 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=8.2 sequence=TCTTCCTCTCTATAATTTTCTAGGGTTTAGCAATGTCTGCCGAGGTTGAGTACAGGTGCTTTGTTGG SRR7169618 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:45:25 Started mapping on | Feb 11 10:45:25 Finished on | Feb 11 10:47:04 Mapping speed, Million of reads per hour | 665.55 Number of input reads | 18302582 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 17382505 Uniquely mapped reads % | 94.97% Average mapped length | 293.13 Number of splices: Total | 16105057 Number of splices: Annotated (sjdb) | 15813694 Number of splices: GT/AG | 15867066 Number of splices: GC/AG | 187915 Number of splices: AT/AC | 13836 Number of splices: Non-canonical | 36240 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.56 Insertion rate per base | 0.02% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 308627 % of reads mapped to multiple loci | 1.69% Number of reads mapped to too many loci | 27054 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.15% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 628884 628884 628884 N_multimapping 308627 308627 308627 N_noFeature 511996 17168306 607066 N_ambiguous 191753 955 71995 UnstrandedReadsAssigned:16678756 PositiveStrandReadsAssigned:213244 NegativeStrandReadsAssigned:16703444 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169618 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169618-trimmed-pair1.fastq SRR7169618-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,302,582 reads, 16,614,257 reads pseudoaligned [quant] estimated average fragment length: 241.664 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,127 rounds 52401 SRR7169618.ke.tsv 34699 SRR7169618.se.tsv 87100 total ==> SRR7169618.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.34 351.493 11.8933 Potri.005G024800.1.v4.1 1035 794.336 36 2.72555 Potri.004G059700.1.v4.1 961 720.394 3 0.250442 Potri.007G009000.2.v4.1 1416 1175.34 0 0 Potri.003G141000.2.v4.1 2943 2702.34 326 7.25495 Potri.016G087400.1.v4.1 270 82.3984 1370.1 999.977 Potri.015G069301.1.v4.1 564 329.146 0 0 Potri.010G195200.1.v4.1 1773 1532.34 10 0.392466 Potri.012G127500.1.v4.1 977 736.352 8566 699.598 ==> SRR7169618.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1328 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 263 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 16 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169618 completed mapping pipeline successfully