Starting /dee2/code/volunteer_pipeline.sh SRR7169619 current disk space = 3053312356352 free memory = 1062960624 SRR7169619 SRAfilesize 9f3987c1664d012106e7b65781205078 SRR7169619.sra SRR7169619.sra file validated SRR7169619 is paired end SRR7169619 is conventional basespace SRR7169619 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169619_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.024 34.0 33.0 34.0 33.0 34.0 2 33.4145 34.0 34.0 34.0 33.0 34.0 3 33.442 34.0 34.0 34.0 33.0 34.0 4 33.53075 34.0 34.0 34.0 33.0 34.0 5 33.50675 34.0 34.0 34.0 33.0 34.0 6 37.07625 38.0 37.0 38.0 36.0 38.0 7 37.296 38.0 38.0 38.0 37.0 38.0 8 37.48925 38.0 38.0 38.0 37.0 38.0 9 37.56875 38.0 38.0 38.0 38.0 38.0 10-14 37.516200000000005 38.0 38.0 38.0 37.8 38.0 15-19 37.528499999999994 38.0 38.0 38.0 38.0 38.0 20-24 37.5582 38.0 38.0 38.0 38.0 38.0 25-29 37.532450000000004 38.0 38.0 38.0 37.8 38.0 30-34 37.52175 38.0 38.0 38.0 38.0 38.0 35-39 37.342549999999996 38.0 38.0 38.0 37.0 38.0 40-44 37.314949999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.279650000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.260600000000004 38.0 38.0 38.0 36.8 38.0 55-59 37.189750000000004 38.0 38.0 38.0 36.4 38.0 60-64 37.1715 38.0 38.0 38.0 36.6 38.0 65-69 37.15325 38.0 38.0 38.0 36.0 38.0 70-74 37.0749 38.0 38.0 38.0 36.0 38.0 75-79 37.045500000000004 38.0 38.0 38.0 36.0 38.0 80-84 36.96084999999999 38.0 38.0 38.0 36.0 38.0 85-89 36.836400000000005 38.0 38.0 38.0 35.6 38.0 90-94 36.7568 38.0 38.0 38.0 35.0 38.0 95-99 36.67184999999999 38.0 38.0 38.0 34.8 38.0 100-104 36.5633 38.0 38.0 38.0 34.4 38.0 105-109 36.46705 38.0 38.0 38.0 34.0 38.0 110-114 36.4091 38.0 38.0 38.0 34.0 38.0 115-119 36.211200000000005 38.0 38.0 38.0 33.8 38.0 120-124 35.9898 38.0 37.2 38.0 33.2 38.0 125-129 35.88905 38.0 37.0 38.0 33.0 38.0 130-134 35.70495 38.0 37.0 38.0 31.8 38.0 135-139 35.466449999999995 38.0 36.2 38.0 31.0 38.0 140-144 35.17635 38.0 36.0 38.0 31.0 38.0 145-149 34.391 38.0 35.2 38.0 26.6 38.0 150-151 31.70025 37.0 32.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 2.0 13 0.0 14 0.0 15 1.0 16 1.0 17 1.0 18 3.0 19 1.0 20 4.0 21 8.0 22 7.0 23 4.0 24 12.0 25 10.0 26 13.0 27 24.0 28 16.0 29 36.0 30 36.0 31 57.0 32 63.0 33 72.0 34 107.0 35 211.0 36 495.0 37 2815.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.964467005076145 12.868020304568528 9.568527918781726 36.598984771573605 2 24.75 13.55 31.85 29.849999999999998 3 20.849999999999998 18.3 25.474999999999998 35.375 4 22.325 26.950000000000003 23.325000000000003 27.400000000000002 5 21.8 31.900000000000002 23.75 22.55 6 20.375 33.775 24.474999999999998 21.375 7 14.35 26.575 40.925 18.15 8 17.0 26.1 31.125000000000004 25.775 9 17.45 25.974999999999998 32.824999999999996 23.75 10-14 19.71 29.544999999999998 27.63 23.115 15-19 20.18 28.194999999999997 27.544999999999998 24.08 20-24 20.29 28.815 27.0 23.895 25-29 19.919999999999998 28.854999999999997 27.295 23.93 30-34 19.915 28.76 27.439999999999998 23.885 35-39 19.695 28.4 27.639999999999997 24.265 40-44 20.275000000000002 28.925 26.99 23.810000000000002 45-49 19.675 28.415000000000003 27.555000000000003 24.355 50-54 19.905 28.4 27.525 24.169999999999998 55-59 19.869999999999997 28.465 27.18 24.485 60-64 19.6 28.215 27.839999999999996 24.345 65-69 19.89 28.754999999999995 27.089999999999996 24.265 70-74 20.119999999999997 28.38 26.979999999999997 24.52 75-79 20.225 28.07 27.12 24.585 80-84 20.64 28.610000000000003 26.875 23.875 85-89 20.395 29.060000000000002 26.534999999999997 24.01 90-94 20.369999999999997 27.744999999999997 27.58 24.305 95-99 20.19 28.155 27.229999999999997 24.425 100-104 20.955 28.18 27.1 23.765 105-109 21.0 27.985 26.72 24.295 110-114 20.415 28.13 27.07 24.385 115-119 20.765 27.85 27.155 24.23 120-124 20.724999999999998 28.244999999999997 26.840000000000003 24.19 125-129 20.835 28.205000000000002 26.645000000000003 24.315 130-134 21.240000000000002 27.815 27.015 23.93 135-139 21.240000000000002 28.075 26.69 23.995 140-144 21.66 27.865000000000002 26.474999999999998 24.0 145-149 20.955 27.99 26.765 24.29 150-151 21.7875 27.6625 25.9875 24.5625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 0.5 24 1.5 25 3.5 26 5.0 27 7.5 28 9.0 29 11.0 30 19.5 31 32.0 32 41.5 33 39.5 34 45.0 35 55.0 36 73.5 37 99.5 38 117.5 39 144.0 40 176.0 41 197.0 42 217.0 43 247.5 44 269.0 45 268.5 46 255.5 47 257.0 48 256.0 49 242.5 50 195.5 51 144.0 52 130.5 53 103.5 54 67.5 55 54.0 56 54.5 57 47.0 58 31.5 59 18.0 60 11.5 61 8.5 62 5.5 63 6.5 64 6.5 65 4.5 66 4.5 67 3.5 68 2.5 69 2.5 70 2.5 71 1.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42152917505031 98.825 2 0.5533199195171026 1.0999999999999999 3 0.025150905432595575 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0125 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.07500000000000001 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.42500000000000004 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.825 0.0 0.0 0.0 0.0 100-101 0.9125000000000001 0.0 0.0 0.0 0.0 102-103 1.0499999999999998 0.0 0.0 0.0 0.0 104-105 1.325 0.0 0.0 0.0 0.0 106-107 1.5625 0.0 0.0 0.0 0.0 108-109 1.775 0.0 0.0 0.0 0.0 110-111 1.9375 0.0 0.0 0.0 0.0 112-113 2.0999999999999996 0.0 0.0 0.0 0.0 114-115 2.2625 0.0 0.0 0.0 0.0 116-117 2.5375 0.0 0.0 0.0 0.0 118-119 2.7625 0.0 0.0 0.0 0.0 120-121 3.1625 0.0 0.0 0.0 0.0 122-123 3.625 0.0 0.0 0.0 0.0 124-125 3.925 0.0 0.0 0.0 0.0 126-127 4.375 0.0 0.0 0.0 0.0 128-129 4.8125 0.0 0.0 0.0 0.0 130-131 5.1875 0.0 0.0 0.0 0.0 132-133 5.5125 0.0 0.0 0.0 0.0 134-135 6.0125 0.0 0.0 0.0 0.0 136-137 6.550000000000001 0.0 0.0 0.0 0.0 138-139 7.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGAAAT 10 0.006832588 144.9875 6 TCACAAA 10 0.006832588 144.9875 145 >>END_MODULE SRR7169619 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169619_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.77575 33.0 33.0 34.0 32.0 34.0 2 32.889 34.0 33.0 34.0 32.0 34.0 3 32.917 34.0 33.0 34.0 32.0 34.0 4 32.9135 34.0 33.0 34.0 32.0 34.0 5 32.96075 34.0 33.0 34.0 32.0 34.0 6 37.00625 38.0 38.0 38.0 37.0 38.0 7 37.10125 38.0 38.0 38.0 37.0 38.0 8 37.00925 38.0 38.0 38.0 37.0 38.0 9 37.05725 38.0 38.0 38.0 37.0 38.0 10-14 37.0638 38.0 38.0 38.0 37.0 38.0 15-19 36.9894 38.0 38.0 38.0 37.0 38.0 20-24 36.95865 38.0 38.0 38.0 36.8 38.0 25-29 36.94105 38.0 38.0 38.0 36.6 38.0 30-34 36.87985 38.0 38.0 38.0 36.6 38.0 35-39 36.8959 38.0 38.0 38.0 36.4 38.0 40-44 36.924099999999996 38.0 38.0 38.0 36.4 38.0 45-49 36.827299999999994 38.0 38.0 38.0 36.4 38.0 50-54 36.84815 38.0 38.0 38.0 36.0 38.0 55-59 36.353750000000005 38.0 37.8 38.0 33.8 38.0 60-64 36.7279 38.0 38.0 38.0 36.0 38.0 65-69 36.704950000000004 38.0 38.0 38.0 36.0 38.0 70-74 36.63165 38.0 38.0 38.0 35.8 38.0 75-79 36.52895 38.0 38.0 38.0 35.4 38.0 80-84 36.38785 38.0 38.0 38.0 34.6 38.0 85-89 36.34565 38.0 38.0 38.0 34.4 38.0 90-94 36.20155 38.0 38.0 38.0 34.0 38.0 95-99 36.21115 38.0 38.0 38.0 34.0 38.0 100-104 36.091449999999995 38.0 38.0 38.0 34.0 38.0 105-109 35.98715 38.0 38.0 38.0 34.0 38.0 110-114 35.83470000000001 38.0 38.0 38.0 33.0 38.0 115-119 35.69695 38.0 38.0 38.0 32.6 38.0 120-124 35.486450000000005 38.0 37.0 38.0 31.0 38.0 125-129 35.27815 38.0 37.0 38.0 30.6 38.0 130-134 34.8091 38.0 36.0 38.0 27.8 38.0 135-139 34.66330000000001 38.0 36.0 38.0 27.2 38.0 140-144 34.26915 38.0 35.0 38.0 25.2 38.0 145-149 33.621050000000004 38.0 35.0 38.0 20.0 38.0 150-151 30.097250000000003 36.5 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 2.0 4 3.0 5 2.0 6 1.0 7 1.0 8 2.0 9 4.0 10 4.0 11 4.0 12 2.0 13 3.0 14 6.0 15 5.0 16 4.0 17 3.0 18 6.0 19 7.0 20 1.0 21 9.0 22 10.0 23 14.0 24 16.0 25 23.0 26 13.0 27 30.0 28 31.0 29 33.0 30 31.0 31 58.0 32 66.0 33 80.0 34 108.0 35 168.0 36 496.0 37 2738.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.272841051314145 23.60450563204005 13.191489361702127 24.93116395494368 2 28.07017543859649 28.596491228070175 26.71679197994987 16.61654135338346 3 20.626566416040102 30.576441102756892 30.250626566416038 18.546365914786968 4 24.411027568922307 33.68421052631579 23.107769423558896 18.796992481203006 5 23.684210526315788 37.59398496240601 20.927318295739347 17.794486215538846 6 21.051314142678347 37.37171464330413 22.803504380475594 18.773466833541928 7 20.801001251564454 22.478097622027533 36.2953692115144 20.425531914893615 8 22.778473091364205 26.057571964956196 26.783479349186486 24.380475594493117 9 22.22778473091364 26.48310387984981 28.71088861076345 22.57822277847309 10-14 24.340425531914896 28.270337922403005 25.60200250312891 21.78723404255319 15-19 24.35043804755945 27.3441802252816 27.25907384230288 21.04630788485607 20-24 23.85481852315394 27.714643304130167 26.81351689612015 21.617021276595743 25-29 23.88986232790989 27.25907384230288 27.173967459324157 21.67709637046308 30-34 23.509386733416772 27.819774718397998 27.314142678347935 21.356695869837296 35-39 23.69461827284105 27.684605757196497 27.17897371714643 21.441802252816018 40-44 23.73585661359768 28.216681686192054 26.965054570942225 21.08240712926805 45-49 24.32540675844806 28.34543178973717 26.543178973717147 20.785982478097623 50-54 24.035043804755947 28.000000000000004 26.92866082603254 21.036295369211512 55-59 24.175219023779725 27.699624530663332 27.434292866082604 20.690863579474343 60-64 23.799749687108886 27.914893617021274 27.27909887359199 21.006257822277846 65-69 24.705882352941178 27.2540675844806 27.18898623279099 20.851063829787233 70-74 24.340425531914896 27.99499374217772 27.183979974968707 20.480600750938674 75-79 24.20525657071339 27.459324155193993 26.79849812265332 21.536921151439298 80-84 24.847301491939522 27.8862521277661 26.980074096325225 20.286372283969158 85-89 24.585732165206508 27.629536921151438 26.913642052565706 20.871088861076345 90-94 24.30037546933667 26.868585732165208 27.94993742177722 20.8811013767209 95-99 24.811013767209012 27.724655819774718 27.28911138923655 20.175219023779725 100-104 24.61954345214257 28.023628354024833 27.282739287144576 20.074088906688026 105-109 24.373154496771935 27.511135578799863 27.526149842350232 20.589560082077973 110-114 24.20525657071339 27.934918648310386 27.198998748435542 20.660826032540676 115-119 24.270337922403005 27.52941176470588 27.294117647058826 20.906132665832292 120-124 24.715894868585732 27.519399249061326 27.23404255319149 20.530663329161452 125-129 25.386733416770962 27.53441802252816 26.673341677096367 20.405506883604506 130-134 24.991239048811014 27.729662077596995 26.68335419274093 20.595744680851062 135-139 25.56195244055069 27.459324155193993 27.13892365456821 19.83979974968711 140-144 24.81602002503129 27.489361702127656 26.90863579474343 20.785982478097623 145-149 25.291614518147686 28.245306633291616 26.673341677096367 19.78973717146433 150-151 25.987993996998497 27.263631815907953 26.138069034517258 20.610305152576288 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 5.0 1 2.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 1.5 25 2.5 26 3.5 27 3.0 28 2.5 29 3.5 30 5.0 31 7.5 32 10.5 33 17.5 34 26.0 35 42.0 36 59.0 37 69.5 38 98.5 39 138.5 40 174.0 41 203.5 42 242.0 43 282.5 44 297.0 45 284.0 46 288.5 47 301.5 48 271.5 49 236.0 50 192.0 51 158.0 52 137.5 53 110.0 54 86.5 55 62.5 56 46.5 57 34.0 58 23.0 59 18.5 60 16.0 61 9.5 62 6.5 63 8.0 64 6.0 65 1.5 66 1.5 67 3.0 68 2.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.25 3 0.25 4 0.25 5 0.25 6 0.125 7 0.125 8 0.125 9 0.125 10-14 0.125 15-19 0.125 20-24 0.125 25-29 0.125 30-34 0.125 35-39 0.125 40-44 0.13 45-49 0.125 50-54 0.125 55-59 0.125 60-64 0.125 65-69 0.125 70-74 0.125 75-79 0.125 80-84 0.13 85-89 0.125 90-94 0.125 95-99 0.125 100-104 0.12 105-109 0.095 110-114 0.125 115-119 0.125 120-124 0.125 125-129 0.125 130-134 0.125 135-139 0.125 140-144 0.125 145-149 0.125 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47169811320755 98.85000000000001 2 0.4779874213836478 0.95 3 0.025157232704402514 0.075 4 0.0 0.0 5 0.025157232704402514 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0125 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.07500000000000001 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.75 0.0 0.0 0.0 0.0 100-101 0.85 0.0 0.0 0.0 0.0 102-103 1.0 0.0 0.0 0.0 0.0 104-105 1.2375 0.0 0.0 0.0 0.0 106-107 1.425 0.0 0.0 0.0 0.0 108-109 1.6125 0.0 0.0 0.0 0.0 110-111 1.7625 0.0 0.0 0.0 0.0 112-113 1.9375 0.0 0.0 0.0 0.0 114-115 2.1125 0.0 0.0 0.0 0.0 116-117 2.3875 0.0 0.0 0.0 0.0 118-119 2.6125 0.0 0.0 0.0 0.0 120-121 3.05 0.0 0.0 0.0 0.0 122-123 3.5250000000000004 0.0 0.0 0.0 0.0 124-125 3.825 0.0 0.0 0.0 0.0 126-127 4.25 0.0 0.0 0.0 0.0 128-129 4.6625 0.0 0.0 0.0 0.0 130-131 5.012499999999999 0.0 0.0 0.0 0.0 132-133 5.3375 0.0 0.0 0.0 0.0 134-135 5.8375 0.0 0.0 0.0 0.0 136-137 6.4 0.0 0.0 0.0 0.0 138-139 6.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 784030 spots for SRR7169619.sra Written 784030 spots for SRR7169619.sra Read 784030 spots for SRR7169619.sra Written 784030 spots for SRR7169619.sra Read 784030 spots for SRR7169619.sra Written 784030 spots for SRR7169619.sra Read 784030 spots for SRR7169619.sra Written 784030 spots for SRR7169619.sra Read 784030 spots for SRR7169619.sra Written 784030 spots for SRR7169619.sra Read 784030 spots for SRR7169619.sra Written 784030 spots for SRR7169619.sra Read 784030 spots for SRR7169619.sra Written 784030 spots for SRR7169619.sra Read 784030 spots for SRR7169619.sra Written 784030 spots for SRR7169619.sra Read 784030 spots for SRR7169619.sra Written 784030 spots for SRR7169619.sra Read 784049 spots for SRR7169619.sra Written 784049 spots for SRR7169619.sra Read 784030 spots for SRR7169619.sra Written 784030 spots for SRR7169619.sra Read 784030 spots for SRR7169619.sra Written 784030 spots for SRR7169619.sra Read 784030 spots for SRR7169619.sra Written 784030 spots for SRR7169619.sra Read 784030 spots for SRR7169619.sra Written 784030 spots for SRR7169619.sra Read 784030 spots for SRR7169619.sra Written 784030 spots for SRR7169619.sra Read 784030 spots for SRR7169619.sra Written 784030 spots for SRR7169619.sra Read 784030 spots for SRR7169619.sra Written 784030 spots for SRR7169619.sra Read 784030 spots for SRR7169619.sra Written 784030 spots for SRR7169619.sra Read 784030 spots for SRR7169619.sra Written 784030 spots for SRR7169619.sra Read 784030 spots for SRR7169619.sra Written 784030 spots for SRR7169619.sra SRR ids: ['SRR7169619.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e2wnk7or SRR7169619.sra spots: 15680619 blocks: [[1, 784030], [784031, 1568060], [1568061, 2352090], [2352091, 3136120], [3136121, 3920150], [3920151, 4704180], [4704181, 5488210], [5488211, 6272240], [6272241, 7056270], [7056271, 7840300], [7840301, 8624330], [8624331, 9408360], [9408361, 10192390], [10192391, 10976420], [10976421, 11760450], [11760451, 12544480], [12544481, 13328510], [13328511, 14112540], [14112541, 14896570], [14896571, 15680619]] SRR7169619 file size 5291946 SRR7169619 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169619 SRR7169619_1.fastq SRR7169619_2.fastq Input file: SRR7169619_1.fastq Paired file: SRR7169619_2.fastq trimmed: SRR7169619-trimmed-pair1.fastq, SRR7169619-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:23:26 2025 >> started Tue Feb 11 10:23:44 2025 >> done (17.785s) 15680619 read pairs processed; of these: 17982 ( 0.11%) short read pairs filtered out after trimming by size control 58308 ( 0.37%) empty read pairs filtered out after trimming by size control 15604329 (99.51%) read pairs available; of these: 6557320 (42.02%) trimmed read pairs available after processing 9047009 (57.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 9 0.00% 20 5 0.00% 21 3 0.00% 22 2 0.00% 23 9 0.00% 24 9 0.00% 25 13 0.00% 26 10 0.00% 27 24 0.00% 28 10 0.00% 29 9 0.00% 30 13 0.00% 31 15 0.00% 32 17 0.00% 33 13 0.00% 34 16 0.00% 35 17 0.00% 36 20 0.00% 37 17 0.00% 38 21 0.00% 39 26 0.00% 40 20 0.00% 41 29 0.00% 42 21 0.00% 43 18 0.00% 44 28 0.00% 45 40 0.00% 46 31 0.00% 47 47 0.00% 48 49 0.00% 49 47 0.00% 50 71 0.00% 51 88 0.00% 52 82 0.00% 53 95 0.00% 54 94 0.00% 55 113 0.00% 56 106 0.00% 57 143 0.00% 58 155 0.00% 59 167 0.00% 60 194 0.00% 61 216 0.00% 62 258 0.00% 63 270 0.00% 64 328 0.00% 65 422 0.00% 66 503 0.00% 67 591 0.00% 68 937 0.01% 69 2373 0.02% 70 2553 0.02% 71 1160 0.01% 72 1002 0.01% 73 990 0.01% 74 1061 0.01% 75 1194 0.01% 76 1395 0.01% 77 1475 0.01% 78 1622 0.01% 79 1898 0.01% 80 2026 0.01% 81 2413 0.02% 82 2706 0.02% 83 3227 0.02% 84 4190 0.03% 85 5017 0.03% 86 5251 0.03% 87 5875 0.04% 88 6338 0.04% 89 6640 0.04% 90 7094 0.05% 91 7471 0.05% 92 8119 0.05% 93 8733 0.06% 94 9551 0.06% 95 10145 0.07% 96 10754 0.07% 97 11068 0.07% 98 11796 0.08% 99 12401 0.08% 100 13184 0.08% 101 13841 0.09% 102 15213 0.10% 103 16051 0.10% 104 17074 0.11% 105 18198 0.12% 106 19152 0.12% 107 19721 0.13% 108 20295 0.13% 109 21252 0.14% 110 22473 0.14% 111 23280 0.15% 112 24853 0.16% 113 26420 0.17% 114 27819 0.18% 115 29052 0.19% 116 30571 0.20% 117 31544 0.20% 118 32284 0.21% 119 33107 0.21% 120 34188 0.22% 121 35494 0.23% 122 36884 0.24% 123 38994 0.25% 124 41508 0.27% 125 43196 0.28% 126 45112 0.29% 127 46549 0.30% 128 47992 0.31% 129 49427 0.32% 130 51066 0.33% 131 53239 0.34% 132 55806 0.36% 133 58686 0.38% 134 62109 0.40% 135 65457 0.42% 136 69024 0.44% 137 72188 0.46% 138 76189 0.49% 139 79397 0.51% 140 82586 0.53% 141 87809 0.56% 142 95033 0.61% 143 104360 0.67% 144 117263 0.75% 145 135429 0.87% 146 160149 1.03% 147 206850 1.33% 148 295977 1.90% 149 551760 3.54% 150 3039228 19.48% 151 9047009 57.98% 15604329 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=42 prefix-density=0.24 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGC criterion=fanout-score sequence-density=0.05 sequence-density-rank=38 fanout-score=105.71 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=15.6 sequence=TTCTTCAAGAATTTTAAGCAGTGTGCGTCGCTCCAATCATGGCATATCCACTTCATGAAAACGGCATCTGCTTTGGGCACGCTAACAAACATGTCCCCACCAACATGCTCCACACCGGGATAAGATGGGGCATCCTCAATGACGTGGGGCAGATCAAAGTTAATGCCCTTAATTGAAGGGTATTTAGAGACGATGGTGTTAACGACAGCTCCAGTCCCACCACCAACA criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=44 prefix-density=0.24 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=45 fanout-score=135.04 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=9.6 sequence=GAGTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAACAGGAAGAAGCTTGCTTCTTTGCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCC SRR7169619 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:24:29 Started mapping on | Feb 11 10:24:29 Finished on | Feb 11 10:26:02 Mapping speed, Million of reads per hour | 604.04 Number of input reads | 15604329 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 14810180 Uniquely mapped reads % | 94.91% Average mapped length | 293.77 Number of splices: Total | 13494398 Number of splices: Annotated (sjdb) | 13267707 Number of splices: GT/AG | 13297691 Number of splices: GC/AG | 157409 Number of splices: AT/AC | 11542 Number of splices: Non-canonical | 27756 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 275007 % of reads mapped to multiple loci | 1.76% Number of reads mapped to too many loci | 19450 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.16% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 534939 534939 534939 N_multimapping 275007 275007 275007 N_noFeature 285574 14634697 360091 N_ambiguous 160341 1161 58455 UnstrandedReadsAssigned:14364265 PositiveStrandReadsAssigned:174322 NegativeStrandReadsAssigned:14391634 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169619 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169619-trimmed-pair1.fastq SRR7169619-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,604,329 reads, 14,320,490 reads pseudoaligned [quant] estimated average fragment length: 230.045 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,114 rounds 52401 SRR7169619.ke.tsv 34699 SRR7169619.se.tsv 87100 total ==> SRR7169619.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1788.96 182 6.2358 Potri.005G024800.1.v4.1 1035 805.955 44 3.34628 Potri.004G059700.1.v4.1 961 731.979 0 0 Potri.007G009000.2.v4.1 1416 1186.96 0 0 Potri.003G141000.2.v4.1 2943 2713.96 245.067 5.53481 Potri.016G087400.1.v4.1 270 82.9614 1438 1062.44 Potri.015G069301.1.v4.1 564 338.056 0 0 Potri.010G195200.1.v4.1 1773 1543.96 31 1.23069 Potri.012G127500.1.v4.1 977 747.973 7066 579.04 ==> SRR7169619.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1148 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 313 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169619 completed mapping pipeline successfully