Starting /dee2/code/volunteer_pipeline.sh SRR7169620 current disk space = 3053787668480 free memory = 1419818600 SRR7169620 SRAfilesize f2173cfd2ef9e3e70ff477574ba9419b SRR7169620.sra SRR7169620.sra file validated SRR7169620 is paired end SRR7169620 is conventional basespace SRR7169620 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169620_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.241 34.0 33.0 34.0 32.0 34.0 2 33.17 34.0 33.0 34.0 31.0 34.0 3 33.22625 34.0 33.0 34.0 31.0 34.0 4 33.4195 34.0 33.0 34.0 33.0 34.0 5 33.41175 34.0 33.0 34.0 33.0 34.0 6 36.933 38.0 37.0 38.0 36.0 38.0 7 37.278 38.0 38.0 38.0 37.0 38.0 8 37.377 38.0 38.0 38.0 37.0 38.0 9 37.40075 38.0 38.0 38.0 37.0 38.0 10-14 37.496950000000005 38.0 38.0 38.0 37.2 38.0 15-19 37.4212 38.0 38.0 38.0 37.0 38.0 20-24 37.37675 38.0 38.0 38.0 37.0 38.0 25-29 37.37525 38.0 38.0 38.0 37.0 38.0 30-34 37.28685 38.0 38.0 38.0 37.0 38.0 35-39 37.2076 38.0 38.0 38.0 36.6 38.0 40-44 36.92805 38.0 38.0 38.0 35.2 38.0 45-49 36.79335 38.0 38.0 38.0 34.8 38.0 50-54 36.63365 38.0 38.0 38.0 34.2 38.0 55-59 36.54280000000001 38.0 38.0 38.0 34.0 38.0 60-64 36.4811 38.0 37.8 38.0 34.0 38.0 65-69 36.35665 38.0 37.4 38.0 34.0 38.0 70-74 36.3497 38.0 37.4 38.0 33.8 38.0 75-79 36.15405 38.0 37.0 38.0 33.0 38.0 80-84 36.09649999999999 38.0 37.0 38.0 32.6 38.0 85-89 35.812400000000004 38.0 37.0 38.0 31.0 38.0 90-94 35.578950000000006 38.0 36.4 38.0 30.0 38.0 95-99 35.534749999999995 38.0 36.0 38.0 29.6 38.0 100-104 35.15385 38.0 36.0 38.0 28.8 38.0 105-109 34.978750000000005 38.0 35.8 38.0 28.2 38.0 110-114 34.53635 38.0 35.0 38.0 25.8 38.0 115-119 34.344550000000005 38.0 35.0 38.0 24.2 38.0 120-124 34.15 38.0 34.4 38.0 23.4 38.0 125-129 33.592400000000005 38.0 34.0 38.0 20.2 38.0 130-134 33.353300000000004 38.0 34.0 38.0 17.4 38.0 135-139 32.6595 37.8 33.0 38.0 15.0 38.0 140-144 32.356199999999994 37.4 33.0 38.0 14.2 38.0 145-149 30.989800000000002 36.0 31.0 38.0 8.8 38.0 150-151 26.872374999999998 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 2.0 12 1.0 13 5.0 14 0.0 15 3.0 16 6.0 17 6.0 18 4.0 19 8.0 20 11.0 21 17.0 22 15.0 23 10.0 24 21.0 25 16.0 26 28.0 27 34.0 28 43.0 29 51.0 30 77.0 31 94.0 32 109.0 33 160.0 34 254.0 35 426.0 36 1007.0 37 1592.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.482866043613704 12.512980269989615 7.995846313603323 34.008307372793354 2 24.525 13.275 31.775 30.425 3 21.2 17.675 26.25 34.875 4 23.05 26.3 23.875 26.775 5 22.925 31.624999999999996 23.75 21.7 6 20.175 34.675 24.3 20.849999999999998 7 15.0 27.725 40.5 16.775000000000002 8 17.45 25.974999999999998 31.05 25.525 9 17.075000000000003 24.625 33.225 25.074999999999996 10-14 19.56 30.220000000000002 27.485 22.735 15-19 20.375 28.53 27.589999999999996 23.505000000000003 20-24 20.005 29.154999999999998 27.68 23.16 25-29 19.78 28.89 27.229999999999997 24.099999999999998 30-34 20.275000000000002 28.244999999999997 27.735 23.745 35-39 20.349999999999998 28.194999999999997 27.63 23.825 40-44 19.445 29.134999999999998 27.715 23.705000000000002 45-49 19.915 28.605000000000004 27.405 24.075 50-54 19.735 29.475 27.155 23.635 55-59 19.945 29.625 27.07 23.36 60-64 20.095 28.715000000000003 27.48 23.71 65-69 20.369999999999997 28.655 27.275 23.7 70-74 20.18 28.895 27.67 23.255 75-79 19.919999999999998 28.315 27.889999999999997 23.875 80-84 20.035 28.73 28.025 23.21 85-89 20.315 28.365000000000002 27.605 23.715 90-94 20.03 28.765 27.655 23.549999999999997 95-99 20.150000000000002 28.560000000000002 27.01 24.279999999999998 100-104 20.425531914893615 29.13642052565707 27.093867334167708 23.3441802252816 105-109 20.95 28.055000000000003 27.29 23.705000000000002 110-114 20.485971943887776 28.852705410821645 26.96392785571142 23.697394789579157 115-119 20.82666132906325 28.29263410728583 27.44195356285028 23.43875100080064 120-124 20.262222889456037 28.834509332932996 26.952909973477457 23.950357804133514 125-129 21.200600300150075 28.329164582291146 27.093546773386695 23.376688344172088 130-134 20.93 28.395 27.16 23.515 135-139 20.775 28.299999999999997 27.405 23.52 140-144 20.979999999999997 28.575 26.97 23.474999999999998 145-149 20.835 28.235 27.245 23.685000000000002 150-151 21.587500000000002 27.375 27.437499999999996 23.599999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.5 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 1.5 20 1.0 21 1.0 22 1.5 23 1.0 24 2.0 25 4.5 26 5.0 27 5.5 28 9.0 29 15.0 30 21.5 31 24.5 32 28.0 33 40.0 34 52.0 35 67.0 36 85.5 37 103.0 38 120.5 39 163.0 40 198.5 41 218.0 42 238.5 43 252.5 44 256.0 45 268.5 46 286.0 47 264.5 48 240.5 49 216.0 50 169.0 51 138.0 52 124.0 53 93.5 54 68.0 55 51.5 56 36.0 57 33.5 58 29.5 59 15.5 60 9.5 61 8.0 62 6.0 63 5.0 64 5.5 65 4.0 66 2.0 67 1.5 68 1.0 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.6999999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.125 105-109 0.0 110-114 0.2 115-119 0.08 120-124 0.08499999999999999 125-129 0.05 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.025 0.0 0.0 0.0 82-83 0.16249999999999998 0.025 0.0 0.0 0.0 84-85 0.175 0.025 0.0 0.0 0.0 86-87 0.175 0.025 0.0 0.0 0.0 88-89 0.25 0.025 0.0 0.0 0.0 90-91 0.325 0.025 0.0 0.0 0.0 92-93 0.425 0.025 0.0 0.0 0.0 94-95 0.4875 0.025 0.0 0.0 0.0 96-97 0.6125 0.025 0.0 0.0 0.0 98-99 0.675 0.025 0.0 0.0 0.0 100-101 0.7875 0.025 0.0 0.0 0.0 102-103 0.85 0.025 0.0 0.0 0.0 104-105 1.0625 0.025 0.0 0.0 0.0 106-107 1.25 0.025 0.0 0.0 0.0 108-109 1.375 0.025 0.0 0.0 0.0 110-111 1.5375 0.025 0.0 0.0 0.0 112-113 1.7374999999999998 0.025 0.0 0.0 0.0 114-115 1.925 0.025 0.0 0.0 0.0 116-117 2.25 0.025 0.0 0.0 0.0 118-119 2.5125 0.025 0.0 0.0 0.0 120-121 2.6375 0.025 0.0 0.0 0.0 122-123 2.925 0.025 0.0 0.0 0.0 124-125 3.1 0.025 0.0 0.0 0.0 126-127 3.4875 0.025 0.0 0.0 0.0 128-129 3.7875 0.025 0.0 0.0 0.0 130-131 4.125 0.025 0.0 0.0 0.0 132-133 4.575 0.025 0.0 0.0 0.0 134-135 5.025 0.025 0.0 0.0 0.0 136-137 5.275 0.025 0.0 0.0 0.0 138-139 5.6625 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGGAAC 10 0.0063298983 148.6923 1 >>END_MODULE SRR7169620 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169620_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5575 33.0 33.0 34.0 32.0 34.0 2 32.86875 33.0 33.0 34.0 32.0 34.0 3 32.813 34.0 33.0 34.0 32.0 34.0 4 32.73 34.0 33.0 34.0 32.0 34.0 5 32.7225 34.0 33.0 34.0 32.0 34.0 6 36.879 38.0 38.0 38.0 36.0 38.0 7 36.84175 38.0 38.0 38.0 36.0 38.0 8 37.011 38.0 38.0 38.0 36.0 38.0 9 36.90925 38.0 38.0 38.0 36.0 38.0 10-14 36.844500000000004 38.0 38.0 38.0 36.0 38.0 15-19 36.856849999999994 38.0 38.0 38.0 36.0 38.0 20-24 36.8127 38.0 38.0 38.0 36.2 38.0 25-29 36.811949999999996 38.0 38.0 38.0 36.0 38.0 30-34 36.711 38.0 38.0 38.0 36.0 38.0 35-39 36.717949999999995 38.0 38.0 38.0 36.0 38.0 40-44 36.6826 38.0 38.0 38.0 36.0 38.0 45-49 36.6364 38.0 38.0 38.0 35.8 38.0 50-54 36.38985 38.0 38.0 38.0 35.0 38.0 55-59 36.1147 38.0 38.0 38.0 34.2 38.0 60-64 35.94755 38.0 38.0 38.0 33.8 38.0 65-69 35.62825 38.0 38.0 38.0 33.2 38.0 70-74 35.52855 38.0 38.0 38.0 32.6 38.0 75-79 35.37035 38.0 38.0 38.0 31.0 38.0 80-84 35.5912 38.0 38.0 38.0 32.0 38.0 85-89 35.6265 38.0 38.0 38.0 31.8 38.0 90-94 35.5883 38.0 38.0 38.0 32.2 38.0 95-99 35.43585 38.0 38.0 38.0 31.0 38.0 100-104 35.33165 38.0 37.6 38.0 30.2 38.0 105-109 35.1697 38.0 37.0 38.0 29.0 38.0 110-114 35.06275 38.0 37.0 38.0 28.6 38.0 115-119 34.8877 38.0 37.0 38.0 27.6 38.0 120-124 34.6487 38.0 36.2 38.0 26.6 38.0 125-129 34.3368 38.0 36.0 38.0 24.0 38.0 130-134 33.8916 38.0 35.6 38.0 20.2 38.0 135-139 33.2076 38.0 34.8 38.0 14.4 38.0 140-144 32.777649999999994 38.0 34.8 38.0 13.8 38.0 145-149 31.794150000000002 38.0 33.8 38.0 4.2 38.0 150-151 27.875375 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 8.0 4 5.0 5 2.0 6 2.0 7 2.0 8 4.0 9 2.0 10 2.0 11 4.0 12 18.0 13 16.0 14 18.0 15 6.0 16 5.0 17 9.0 18 9.0 19 8.0 20 14.0 21 21.0 22 17.0 23 13.0 24 26.0 25 26.0 26 31.0 27 32.0 28 43.0 29 48.0 30 58.0 31 64.0 32 76.0 33 101.0 34 138.0 35 184.0 36 488.0 37 2493.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.46860873932697 22.777498744349572 14.18884982420894 25.565042692114513 2 28.775000000000002 25.1 28.875 17.25 3 19.275000000000002 29.099999999999998 31.474999999999998 20.150000000000002 4 23.150000000000002 34.300000000000004 24.725 17.825 5 23.525 36.0 22.675 17.8 6 21.0 36.4 23.95 18.65 7 20.225 22.375 39.574999999999996 17.825 8 21.8 25.4 27.125 25.674999999999997 9 21.3 25.8 28.925 23.974999999999998 10-14 22.825 28.865000000000002 27.150000000000002 21.16 15-19 22.895 28.12 28.17 20.815 20-24 23.21 27.99 27.865000000000002 20.935000000000002 25-29 23.24 28.050000000000004 27.295 21.415 30-34 22.835 27.85 28.26 21.055 35-39 22.884999999999998 27.775 28.249999999999996 21.09 40-44 22.95 28.155 28.335 20.560000000000002 45-49 23.36 28.035 27.875 20.73 50-54 23.600521669341894 27.79895666131621 28.119983948635635 20.48053772070626 55-59 23.12753036437247 27.69736842105263 28.335020242914982 20.84008097165992 60-64 23.684880582573715 28.01853643631919 27.52457096297805 20.77201201812904 65-69 23.405563239588137 28.200399569694174 27.73423492648942 20.659802264228265 70-74 23.63291269108444 27.444341848773984 28.18303067610547 20.739714784036114 75-79 23.607617678763923 26.985267696730148 28.27883578871721 21.128278835788716 80-84 23.0828025477707 27.964331210191084 28.621656050955412 20.331210191082803 85-89 24.062246553122467 28.188361719383614 27.752433090024333 19.996958637469586 90-94 24.124493927125506 27.65688259109312 27.677125506072876 20.541497975708502 95-99 23.63949018814485 27.857576370625125 27.771596196641717 20.731337244588307 100-104 23.758632857790996 27.00509149568987 28.49221152391995 20.744064122599184 105-109 24.206549118387912 27.869017632241817 27.481108312342567 20.443324937027707 110-114 23.955291511428857 27.78169368643641 27.9125969187393 20.350417883395426 115-119 24.271210293526337 27.643747486932046 27.663852030558907 20.42119018898271 120-124 24.556822176467634 27.84613066840757 27.91643649876965 19.680610656355142 125-129 24.833702882483372 27.872404757105425 26.990526103608143 20.303366256803063 130-134 24.26437072676627 28.478095720435554 27.196758673081796 20.060774879716384 135-139 24.340729405763835 28.186687069625094 27.329762815608262 20.142820709002805 140-144 24.957841483979763 27.727528233430426 27.27783739588124 20.03679288670857 145-149 24.68920168498921 27.524915236823176 28.146511866844754 19.639371211342855 150-151 25.906334666494647 27.828667268739515 26.80944394271707 19.455554122048767 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.5 16 0.5 17 0.5 18 3.5 19 4.5 20 5.0 21 3.5 22 2.5 23 7.0 24 8.0 25 5.0 26 7.0 27 9.0 28 8.0 29 10.0 30 16.5 31 22.5 32 28.0 33 33.5 34 47.5 35 74.5 36 92.0 37 118.5 38 142.5 39 164.0 40 181.5 41 205.0 42 268.0 43 288.0 44 277.5 45 276.0 46 257.0 47 235.5 48 220.5 49 200.0 50 172.5 51 133.0 52 100.0 53 92.5 54 77.5 55 57.0 56 39.5 57 23.5 58 17.0 59 14.0 60 9.0 61 8.0 62 7.0 63 5.0 64 4.5 65 4.0 66 3.0 67 1.5 68 1.5 69 2.5 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.44999999999999996 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.32 55-59 1.2 60-64 1.815 65-69 2.395 70-74 2.53 75-79 2.595 80-84 1.875 85-89 1.3599999999999999 90-94 1.2 95-99 1.1400000000000001 100-104 0.815 105-109 0.75 110-114 0.69 115-119 0.52 120-124 0.43499999999999994 125-129 0.7799999999999999 130-134 1.275 135-139 1.975 140-144 2.155 145-149 2.67 150-151 3.1125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.7375 0.0 0.0 0.0 0.0 102-103 0.8 0.0 0.0 0.0 0.0 104-105 1.025 0.0 0.0 0.0 0.0 106-107 1.25 0.0 0.0 0.0 0.0 108-109 1.4125 0.0 0.0 0.0 0.0 110-111 1.5875 0.0 0.0 0.0 0.0 112-113 1.775 0.0 0.0 0.0 0.0 114-115 1.95 0.0 0.0 0.0 0.0 116-117 2.275 0.0 0.0 0.0 0.0 118-119 2.5375 0.0 0.0 0.0 0.0 120-121 2.65 0.0 0.0 0.0 0.0 122-123 2.925 0.0 0.0 0.0 0.0 124-125 3.1 0.0 0.0 0.0 0.0 126-127 3.4625000000000004 0.0 0.0 0.0 0.0 128-129 3.7875 0.0 0.0 0.0 0.0 130-131 4.1625 0.0 0.0 0.0 0.0 132-133 4.6125 0.0 0.0 0.0 0.0 134-135 5.025 0.0 0.0 0.0 0.0 136-137 5.2875 0.0 0.0 0.0 0.0 138-139 5.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAATCC 10 0.0069700265 144.02501 9 GGGGAAG 10 0.0069700265 144.02501 5 >>END_MODULE Read 1050628 spots for SRR7169620.sra Written 1050628 spots for SRR7169620.sra Read 1050628 spots for SRR7169620.sra Written 1050628 spots for SRR7169620.sra Read 1050628 spots for SRR7169620.sra Written 1050628 spots for SRR7169620.sra Read 1050628 spots for SRR7169620.sra Written 1050628 spots for SRR7169620.sra Read 1050628 spots for SRR7169620.sra Written 1050628 spots for SRR7169620.sra Read 1050628 spots for SRR7169620.sra Written 1050628 spots for SRR7169620.sra Read 1050628 spots for SRR7169620.sra Written 1050628 spots for SRR7169620.sra Read 1050628 spots for SRR7169620.sra Written 1050628 spots for SRR7169620.sra Read 1050628 spots for SRR7169620.sra Written 1050628 spots for SRR7169620.sra Read 1050628 spots for SRR7169620.sra Written 1050628 spots for SRR7169620.sra Read 1050628 spots for SRR7169620.sra Written 1050628 spots for SRR7169620.sra Read 1050628 spots for SRR7169620.sra Written 1050628 spots for SRR7169620.sra Read 1050628 spots for SRR7169620.sra Written 1050628 spots for SRR7169620.sra Read 1050637 spots for SRR7169620.sra Written 1050637 spots for SRR7169620.sra Read 1050628 spots for SRR7169620.sra Written 1050628 spots for SRR7169620.sra Read 1050628 spots for SRR7169620.sra Written 1050628 spots for SRR7169620.sra Read 1050628 spots for SRR7169620.sra Written 1050628 spots for SRR7169620.sra Read 1050628 spots for SRR7169620.sra Written 1050628 spots for SRR7169620.sra Read 1050628 spots for SRR7169620.sra Written 1050628 spots for SRR7169620.sra Read 1050628 spots for SRR7169620.sra Written 1050628 spots for SRR7169620.sra SRR ids: ['SRR7169620.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n0s28b_g SRR7169620.sra spots: 21012569 blocks: [[1, 1050628], [1050629, 2101256], [2101257, 3151884], [3151885, 4202512], [4202513, 5253140], [5253141, 6303768], [6303769, 7354396], [7354397, 8405024], [8405025, 9455652], [9455653, 10506280], [10506281, 11556908], [11556909, 12607536], [12607537, 13658164], [13658165, 14708792], [14708793, 15759420], [15759421, 16810048], [16810049, 17860676], [17860677, 18911304], [18911305, 19961932], [19961933, 21012569]] SRR7169620 file size 7098769 SRR7169620 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169620 SRR7169620_1.fastq SRR7169620_2.fastq Input file: SRR7169620_1.fastq Paired file: SRR7169620_2.fastq trimmed: SRR7169620-trimmed-pair1.fastq, SRR7169620-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:05:39 2025 >> started Tue Feb 11 10:06:16 2025 >> done (36.513s) 21012569 read pairs processed; of these: 25082 ( 0.12%) short read pairs filtered out after trimming by size control 23289 ( 0.11%) empty read pairs filtered out after trimming by size control 20964198 (99.77%) read pairs available; of these: 10887078 (51.93%) trimmed read pairs available after processing 10077120 (48.07%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 9 0.00% 20 7 0.00% 21 5 0.00% 22 2 0.00% 23 13 0.00% 24 9 0.00% 25 14 0.00% 26 10 0.00% 27 11 0.00% 28 26 0.00% 29 5 0.00% 30 12 0.00% 31 13 0.00% 32 17 0.00% 33 19 0.00% 34 22 0.00% 35 19 0.00% 36 33 0.00% 37 31 0.00% 38 34 0.00% 39 40 0.00% 40 32 0.00% 41 49 0.00% 42 51 0.00% 43 65 0.00% 44 69 0.00% 45 83 0.00% 46 91 0.00% 47 103 0.00% 48 108 0.00% 49 125 0.00% 50 131 0.00% 51 162 0.00% 52 199 0.00% 53 192 0.00% 54 211 0.00% 55 234 0.00% 56 222 0.00% 57 335 0.00% 58 328 0.00% 59 392 0.00% 60 447 0.00% 61 504 0.00% 62 588 0.00% 63 648 0.00% 64 698 0.00% 65 840 0.00% 66 906 0.00% 67 1034 0.00% 68 1268 0.01% 69 1625 0.01% 70 2150 0.01% 71 2138 0.01% 72 2303 0.01% 73 2627 0.01% 74 2972 0.01% 75 4075 0.02% 76 3453 0.02% 77 2590 0.01% 78 3076 0.01% 79 4534 0.02% 80 7152 0.03% 81 4052 0.02% 82 4598 0.02% 83 5402 0.03% 84 6792 0.03% 85 7861 0.04% 86 8918 0.04% 87 8954 0.04% 88 9208 0.04% 89 9900 0.05% 90 10707 0.05% 91 11593 0.06% 92 12577 0.06% 93 13772 0.07% 94 14583 0.07% 95 15948 0.08% 96 17104 0.08% 97 18695 0.09% 98 22031 0.11% 99 29142 0.14% 100 34193 0.16% 101 23841 0.11% 102 21488 0.10% 103 22732 0.11% 104 23561 0.11% 105 24777 0.12% 106 26130 0.12% 107 27141 0.13% 108 28052 0.13% 109 29127 0.14% 110 30500 0.15% 111 32223 0.15% 112 33529 0.16% 113 35410 0.17% 114 37090 0.18% 115 38785 0.19% 116 40671 0.19% 117 41957 0.20% 118 43928 0.21% 119 44780 0.21% 120 46590 0.22% 121 48715 0.23% 122 50363 0.24% 123 52749 0.25% 124 55753 0.27% 125 58256 0.28% 126 60768 0.29% 127 63281 0.30% 128 66176 0.32% 129 69217 0.33% 130 71970 0.34% 131 74961 0.36% 132 79364 0.38% 133 83961 0.40% 134 88660 0.42% 135 94149 0.45% 136 100883 0.48% 137 106835 0.51% 138 115682 0.55% 139 124928 0.60% 140 134789 0.64% 141 146068 0.70% 142 162521 0.78% 143 179104 0.85% 144 208789 1.00% 145 249171 1.19% 146 313369 1.49% 147 425228 2.03% 148 637332 3.04% 149 1195321 5.70% 150 4801207 22.90% 151 10077120 48.07% 20964198 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.76 fanout-score-rank=34 prefix-density=0.20 prefix-fanout=2.4 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.02 sequence-density-rank=43 fanout-score=189.50 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=14.4 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.82 fanout-score-rank=37 prefix-density=0.29 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.11 sequence-density-rank=16 fanout-score=242.57 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=29.7 sequence=AAGAAGAAGAAA SRR7169620 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:07:15 Started mapping on | Feb 11 10:07:15 Finished on | Feb 11 10:09:59 Mapping speed, Million of reads per hour | 460.19 Number of input reads | 20964198 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 19960935 Uniquely mapped reads % | 95.21% Average mapped length | 292.51 Number of splices: Total | 18632982 Number of splices: Annotated (sjdb) | 18309862 Number of splices: GT/AG | 18354337 Number of splices: GC/AG | 215633 Number of splices: AT/AC | 15408 Number of splices: Non-canonical | 47604 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 376587 % of reads mapped to multiple loci | 1.80% Number of reads mapped to too many loci | 31210 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.80% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 651305 651305 651305 N_multimapping 376587 376587 376587 N_noFeature 506163 19713177 640018 N_ambiguous 196595 1527 81475 UnstrandedReadsAssigned:19258177 PositiveStrandReadsAssigned:246231 NegativeStrandReadsAssigned:19239442 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7169620 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169620-trimmed-pair1.fastq SRR7169620-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,964,198 reads, 19,124,753 reads pseudoaligned [quant] estimated average fragment length: 243.38 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,173 rounds 52401 SRR7169620.ke.tsv 34699 SRR7169620.se.tsv 87100 total ==> SRR7169620.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1775.62 331 9.93529 Potri.005G024800.1.v4.1 1035 792.62 69 4.63966 Potri.004G059700.1.v4.1 961 718.685 3 0.222477 Potri.007G009000.2.v4.1 1416 1173.62 0 0 Potri.003G141000.2.v4.1 2943 2700.62 209.018 4.12499 Potri.016G087400.1.v4.1 270 81.0185 1282.79 843.868 Potri.015G069301.1.v4.1 564 327.076 0 0 Potri.010G195200.1.v4.1 1773 1530.62 62 2.15887 Potri.012G127500.1.v4.1 977 734.664 7794 565.424 ==> SRR7169620.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2134 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 340 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 18 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169620 completed mapping pipeline successfully