Starting /dee2/code/volunteer_pipeline.sh SRR7169621 current disk space = 3052864786432 free memory = 1475005872 SRR7169621 SRAfilesize 22af3bd3cc40d8ef6f79181f4bb08480 SRR7169621.sra SRR7169621.sra file validated SRR7169621 is paired end SRR7169621 is conventional basespace SRR7169621 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169621_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.07975 34.0 33.0 34.0 2.0 34.0 2 32.776 34.0 33.0 34.0 28.0 34.0 3 32.953 34.0 33.0 34.0 30.0 34.0 4 33.39825 34.0 33.0 34.0 33.0 34.0 5 33.365 34.0 33.0 34.0 33.0 34.0 6 36.96975 38.0 37.0 38.0 36.0 38.0 7 37.355 38.0 38.0 38.0 37.0 38.0 8 37.46475 38.0 38.0 38.0 37.0 38.0 9 37.547 38.0 38.0 38.0 38.0 38.0 10-14 37.593450000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.5837 38.0 38.0 38.0 38.0 38.0 20-24 37.58815 38.0 38.0 38.0 38.0 38.0 25-29 37.510400000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.43820000000001 38.0 38.0 38.0 38.0 38.0 35-39 37.45235 38.0 38.0 38.0 37.4 38.0 40-44 37.22235 38.0 38.0 38.0 36.6 38.0 45-49 37.0871 38.0 38.0 38.0 36.0 38.0 50-54 36.964150000000004 38.0 38.0 38.0 36.0 38.0 55-59 36.9588 38.0 38.0 38.0 36.0 38.0 60-64 36.90525 38.0 38.0 38.0 35.6 38.0 65-69 36.75175 38.0 38.0 38.0 35.0 38.0 70-74 36.60615 38.0 38.0 38.0 34.0 38.0 75-79 36.51005 38.0 38.0 38.0 34.2 38.0 80-84 36.366 38.0 38.0 38.0 34.0 38.0 85-89 36.246050000000004 38.0 38.0 38.0 33.8 38.0 90-94 36.0561 38.0 37.0 38.0 33.4 38.0 95-99 35.89229999999999 38.0 37.0 38.0 32.4 38.0 100-104 35.48695 38.0 37.0 38.0 30.2 38.0 105-109 35.32555 38.0 36.6 38.0 29.6 38.0 110-114 35.126549999999995 38.0 36.0 38.0 28.4 38.0 115-119 34.86595 38.0 35.8 38.0 27.6 38.0 120-124 34.3337 38.0 34.8 38.0 24.2 38.0 125-129 34.09585 38.0 34.8 38.0 23.0 38.0 130-134 33.816649999999996 38.0 34.0 38.0 21.4 38.0 135-139 33.518350000000005 38.0 34.2 38.0 19.0 38.0 140-144 32.94925 38.0 33.8 38.0 15.8 38.0 145-149 31.576649999999994 36.8 32.2 38.0 11.2 38.0 150-151 27.74825 35.0 16.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 2.0 11 1.0 12 2.0 13 1.0 14 1.0 15 1.0 16 4.0 17 7.0 18 14.0 19 11.0 20 14.0 21 3.0 22 13.0 23 9.0 24 16.0 25 23.0 26 24.0 27 31.0 28 38.0 29 37.0 30 41.0 31 64.0 32 82.0 33 140.0 34 174.0 35 354.0 36 930.0 37 1962.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.67712125455055 14.225707084850182 10.165219826379165 32.93195183422011 2 25.75 14.649999999999999 28.325 31.275 3 20.45 17.0 24.4 38.15 4 22.325 21.475 25.674999999999997 30.525000000000002 5 23.9 27.450000000000003 23.075000000000003 25.575 6 23.25 31.7 23.674999999999997 21.375 7 15.85 31.35 36.075 16.725 8 18.275 30.875000000000004 29.7 21.15 9 15.9 28.175 33.074999999999996 22.85 10-14 19.21 31.369999999999997 27.750000000000004 21.67 15-19 18.884999999999998 29.160000000000004 27.925 24.03 20-24 20.07 29.53 27.13 23.27 25-29 19.02 30.220000000000002 27.35 23.41 30-34 19.765 29.325000000000003 27.395000000000003 23.515 35-39 20.294999999999998 29.345 26.790000000000003 23.57 40-44 19.835 28.999999999999996 27.52 23.645 45-49 19.869999999999997 29.615000000000002 26.545 23.97 50-54 20.305 28.615000000000002 26.86 24.22 55-59 19.895 29.23 26.795 24.08 60-64 20.044999999999998 29.049999999999997 26.86 24.044999999999998 65-69 19.37 29.5 27.01 24.12 70-74 19.7 28.65 27.38 24.27 75-79 19.81 28.985 27.36 23.845 80-84 19.975 28.610000000000003 27.58 23.835 85-89 20.0 27.985 27.85 24.165 90-94 20.61 28.199999999999996 27.18 24.01 95-99 20.3 28.59 27.279999999999998 23.830000000000002 100-104 20.73 29.060000000000002 26.884999999999998 23.325000000000003 105-109 20.855 28.625 27.265 23.255 110-114 21.025 28.050000000000004 27.255000000000003 23.669999999999998 115-119 20.69 28.43 26.795 24.085 120-124 20.265 27.744999999999997 27.650000000000002 24.34 125-129 20.905 28.23 27.16 23.705000000000002 130-134 21.02 28.415000000000003 26.615 23.95 135-139 20.5 28.144999999999996 27.72 23.635 140-144 21.16 27.955000000000002 27.05 23.835 145-149 21.224999999999998 27.98 26.924999999999997 23.87 150-151 20.575 28.4 27.55 23.474999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 1.0 21 1.5 22 2.0 23 3.0 24 2.0 25 2.5 26 4.0 27 7.5 28 14.5 29 17.0 30 20.0 31 30.5 32 42.0 33 49.5 34 56.0 35 68.5 36 96.5 37 120.0 38 136.5 39 170.0 40 200.0 41 208.5 42 214.5 43 233.5 44 249.5 45 251.0 46 251.5 47 243.0 48 230.0 49 209.0 50 171.5 51 148.5 52 126.0 53 94.5 54 75.0 55 61.0 56 47.0 57 29.5 58 18.0 59 19.0 60 16.0 61 13.0 62 14.0 63 8.5 64 4.0 65 3.5 66 1.5 67 1.5 68 2.0 69 2.5 70 2.0 71 0.5 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 10.725 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44542475422233 98.625 2 0.45374338290899924 0.8999999999999999 3 0.07562389715149988 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025207965717166627 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGAATGATCTCGTATGC 10 0.25 TruSeq Adapter, Index 2 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.8125 0.0 0.0 0.0 0.0 108-109 0.9 0.0 0.0 0.0 0.0 110-111 1.025 0.0 0.0 0.0 0.0 112-113 1.1875 0.0 0.0 0.0 0.0 114-115 1.275 0.0 0.0 0.0 0.0 116-117 1.4 0.0 0.0 0.0 0.0 118-119 1.525 0.0 0.0 0.0 0.0 120-121 1.7000000000000002 0.0 0.0 0.0 0.0 122-123 1.9375 0.0 0.0 0.0 0.0 124-125 2.1625 0.0 0.0 0.0 0.0 126-127 2.3875 0.0 0.0 0.0 0.0 128-129 2.75 0.0 0.0 0.0 0.0 130-131 2.9875 0.0 0.0 0.0 0.0 132-133 3.4625 0.0 0.0 0.0 0.0 134-135 3.8625 0.0 0.0 0.0 0.0 136-137 4.05 0.0 0.0 0.0 0.0 138-139 4.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACCGTT 10 0.0051850425 158.80821 1 CGAGCTT 10 0.0051850425 158.80821 1 ACCGTTT 10 0.006843168 144.91249 2 >>END_MODULE SRR7169621 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169621_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.69425 33.0 33.0 34.0 32.0 34.0 2 32.79275 34.0 33.0 34.0 32.0 34.0 3 32.921 34.0 33.0 34.0 32.0 34.0 4 32.919 34.0 33.0 34.0 32.0 34.0 5 32.968 34.0 33.0 34.0 33.0 34.0 6 37.10675 38.0 38.0 38.0 37.0 38.0 7 37.0525 38.0 38.0 38.0 37.0 38.0 8 37.0995 38.0 38.0 38.0 37.0 38.0 9 37.03675 38.0 38.0 38.0 37.0 38.0 10-14 37.10189999999999 38.0 38.0 38.0 37.6 38.0 15-19 36.9758 38.0 38.0 38.0 37.0 38.0 20-24 36.9951 38.0 38.0 38.0 37.0 38.0 25-29 36.93685 38.0 38.0 38.0 37.0 38.0 30-34 36.861399999999996 38.0 38.0 38.0 36.8 38.0 35-39 36.9024 38.0 38.0 38.0 37.0 38.0 40-44 36.9234 38.0 38.0 38.0 37.0 38.0 45-49 36.75895 38.0 38.0 38.0 36.4 38.0 50-54 36.818349999999995 38.0 38.0 38.0 36.8 38.0 55-59 36.7783 38.0 38.0 38.0 36.2 38.0 60-64 36.69325 38.0 38.0 38.0 36.0 38.0 65-69 36.507799999999996 38.0 38.0 38.0 35.4 38.0 70-74 36.437200000000004 38.0 38.0 38.0 35.4 38.0 75-79 36.382349999999995 38.0 38.0 38.0 35.2 38.0 80-84 36.41760000000001 38.0 38.0 38.0 35.2 38.0 85-89 36.3138 38.0 38.0 38.0 34.8 38.0 90-94 36.136799999999994 38.0 38.0 38.0 34.0 38.0 95-99 36.0937 38.0 38.0 38.0 34.0 38.0 100-104 35.9977 38.0 38.0 38.0 34.0 38.0 105-109 35.83155 38.0 38.0 38.0 33.2 38.0 110-114 35.578950000000006 38.0 38.0 38.0 32.0 38.0 115-119 35.423500000000004 38.0 37.6 38.0 31.0 38.0 120-124 35.26950000000001 38.0 37.2 38.0 30.6 38.0 125-129 34.891949999999994 38.0 36.4 38.0 28.0 38.0 130-134 34.5665 38.0 36.0 38.0 25.2 38.0 135-139 34.23945 38.0 35.6 38.0 23.4 38.0 140-144 33.994200000000006 38.0 35.6 38.0 23.4 38.0 145-149 33.3875 38.0 33.6 38.0 18.2 38.0 150-151 29.282875 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 24.0 3 4.0 4 0.0 5 1.0 6 2.0 7 3.0 8 0.0 9 2.0 10 1.0 11 3.0 12 4.0 13 1.0 14 2.0 15 5.0 16 5.0 17 11.0 18 9.0 19 13.0 20 7.0 21 14.0 22 8.0 23 10.0 24 25.0 25 28.0 26 22.0 27 24.0 28 31.0 29 28.0 30 53.0 31 39.0 32 54.0 33 76.0 34 99.0 35 170.0 36 457.0 37 2765.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.72921376538558 23.21024868123587 13.438834463702587 25.62170308967596 2 29.621269124655132 28.191622774015553 25.68347128166541 16.503636819663907 3 20.722528850978424 29.804315102860006 28.92624184646262 20.546914199698946 4 22.974667669927264 34.612490594431904 24.128417356408328 18.284424379232505 5 26.13493855028844 33.96037120642087 21.996488587910708 17.908201655379983 6 22.016048144433302 37.21163490471414 22.367101303911735 18.405215646940825 7 21.013039117352054 23.67101303911735 35.75727181544634 19.55867602808425 8 24.022066198595788 26.278836509528585 25.20060180541625 24.49849548645938 9 22.417251755265795 26.00300902708124 28.58575727181545 22.993981945837515 10-14 24.401985858281932 28.91530013539943 25.65568426859235 21.027029737726295 15-19 24.22752808988764 28.130016051364365 27.05156500802568 20.590890850722314 20-24 24.13602848974269 28.7204694788584 26.513517580378192 20.629984451020718 25-29 24.20366190117883 28.597943315776277 26.39578630549285 20.802608477552045 30-34 24.129802387400943 28.403049453305247 27.033804794864082 20.43334336442973 35-39 24.161107488589057 28.01324171139088 26.468375382454735 21.35727541756533 40-44 24.12098109043487 27.68721472638812 27.586898731002655 20.60490545217435 45-49 24.16854778028593 27.273639327815403 27.273639327815403 21.284173564083268 50-54 24.196218086973968 28.083462908160705 27.080302954306063 20.64001605055926 55-59 23.6468522698771 28.17155756207675 27.178329571106097 21.003260596940056 60-64 24.18359668924003 28.13142713819915 27.43917732631051 20.245798846250313 65-69 24.21490920036119 27.977325173071133 27.234875087789707 20.572890538777965 70-74 24.66385711418824 28.28617298815974 26.79610676299418 20.253863134657838 75-79 24.26872710852441 27.866138176709647 27.555064974160853 20.310069740605087 80-84 23.956451936584386 27.824603652418222 27.142283764800325 21.07666064619707 85-89 23.626511464552706 28.11700366263609 27.504891876975567 20.751592995835633 90-94 24.290015052684396 28.048168590065224 26.668339187155045 20.993477170095336 95-99 24.159558454591068 27.902659307576517 27.415955845459106 20.521826392373306 100-104 24.800561938688475 27.815965079524357 26.97807435653003 20.40539862525714 105-109 23.982740454568262 27.99157091967287 27.153680196678543 20.872008429080328 110-114 24.258692489087352 27.896242035020823 27.284130249360295 20.560935226531534 115-119 24.661314601103864 27.641746111389864 27.425990968389364 20.27094831911691 120-124 24.6487354476114 27.84022480931353 27.212966680048172 20.298073063026898 125-129 24.46808510638298 27.80509835407467 27.177840224809312 20.54897631473304 130-134 25.01004016064257 28.32831325301205 26.67670682730924 19.984939759036145 135-139 24.623493975903614 28.052208835341364 27.25401606425703 20.070281124497992 140-144 24.401265250790782 27.574433900687858 28.036350856052618 19.987949992468746 145-149 25.67167177220911 27.921458343795507 26.73630291769196 19.670566966303422 150-151 25.206611570247933 27.573253193087904 27.372902579514154 19.847232657150013 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 11.0 1 6.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 1.5 22 2.0 23 1.5 24 2.0 25 2.5 26 1.5 27 1.5 28 3.5 29 5.5 30 6.5 31 10.0 32 16.0 33 20.5 34 27.5 35 41.0 36 64.0 37 83.5 38 122.0 39 156.5 40 184.0 41 219.0 42 238.5 43 257.0 44 274.5 45 269.5 46 299.0 47 297.5 48 241.5 49 203.0 50 182.5 51 173.0 52 146.5 53 113.0 54 78.5 55 60.5 56 45.5 57 32.5 58 24.5 59 19.0 60 13.0 61 8.0 62 7.0 63 9.5 64 6.5 65 4.0 66 3.0 67 0.5 68 1.0 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.475 2 0.325 3 0.35000000000000003 4 0.325 5 0.325 6 0.3 7 0.3 8 0.3 9 0.3 10-14 0.295 15-19 0.32 20-24 0.315 25-29 0.325 30-34 0.31 35-39 0.315 40-44 0.315 45-49 0.325 50-54 0.315 55-59 0.325 60-64 0.325 65-69 0.33 70-74 0.33999999999999997 75-79 0.345 80-84 0.33999999999999997 85-89 0.345 90-94 0.35000000000000003 95-99 0.35000000000000003 100-104 0.345 105-109 0.345 110-114 0.345 115-119 0.35000000000000003 120-124 0.36 125-129 0.36 130-134 0.4 135-139 0.4 140-144 0.415 145-149 0.43499999999999994 150-151 0.17500000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3173198482933 98.2 2 0.606826801517067 1.2 3 0.025284450063211124 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05056890012642225 0.525 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 11 0.27499999999999997 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 10 0.25 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.6 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.8375 0.0 0.0 0.0 0.0 108-109 0.9375 0.0 0.0 0.0 0.0 110-111 1.075 0.0 0.0 0.0 0.0 112-113 1.2374999999999998 0.0 0.0 0.0 0.0 114-115 1.3250000000000002 0.0 0.0 0.0 0.0 116-117 1.4500000000000002 0.0 0.0 0.0 0.0 118-119 1.575 0.0 0.0 0.0 0.0 120-121 1.7625 0.0 0.0 0.0 0.0 122-123 2.0125 0.0 0.0 0.0 0.0 124-125 2.2125 0.0 0.0 0.0 0.0 126-127 2.4375 0.0 0.0 0.0 0.0 128-129 2.7750000000000004 0.0 0.0 0.0 0.0 130-131 3.0625 0.0 0.0 0.0 0.0 132-133 3.5125 0.0 0.0 0.0 0.0 134-135 3.8875 0.0 0.0 0.0 0.0 136-137 4.125 0.0 0.0 0.0 0.0 138-139 4.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 981887 spots for SRR7169621.sra Written 981887 spots for SRR7169621.sra Read 981887 spots for SRR7169621.sra Written 981887 spots for SRR7169621.sra Read 981887 spots for SRR7169621.sra Written 981887 spots for SRR7169621.sra Read 981887 spots for SRR7169621.sra Written 981887 spots for SRR7169621.sra Read 981887 spots for SRR7169621.sra Written 981887 spots for SRR7169621.sra Read 981905 spots for SRR7169621.sra Written 981905 spots for SRR7169621.sra Read 981887 spots for SRR7169621.sra Written 981887 spots for SRR7169621.sra Read 981887 spots for SRR7169621.sra Written 981887 spots for SRR7169621.sra Read 981887 spots for SRR7169621.sra Written 981887 spots for SRR7169621.sra Read 981887 spots for SRR7169621.sra Written 981887 spots for SRR7169621.sra Read 981887 spots for SRR7169621.sra Written 981887 spots for SRR7169621.sra Read 981887 spots for SRR7169621.sra Written 981887 spots for SRR7169621.sra Read 981887 spots for SRR7169621.sra Written 981887 spots for SRR7169621.sra Read 981887 spots for SRR7169621.sra Written 981887 spots for SRR7169621.sra Read 981887 spots for SRR7169621.sra Written 981887 spots for SRR7169621.sra Read 981887 spots for SRR7169621.sra Written 981887 spots for SRR7169621.sra Read 981887 spots for SRR7169621.sra Written 981887 spots for SRR7169621.sra Read 981887 spots for SRR7169621.sra Written 981887 spots for SRR7169621.sra Read 981887 spots for SRR7169621.sra Written 981887 spots for SRR7169621.sra Read 981887 spots for SRR7169621.sra Written 981887 spots for SRR7169621.sra SRR ids: ['SRR7169621.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pdnwk_i_ SRR7169621.sra spots: 19637758 blocks: [[1, 981887], [981888, 1963774], [1963775, 2945661], [2945662, 3927548], [3927549, 4909435], [4909436, 5891322], [5891323, 6873209], [6873210, 7855096], [7855097, 8836983], [8836984, 9818870], [9818871, 10800757], [10800758, 11782644], [11782645, 12764531], [12764532, 13746418], [13746419, 14728305], [14728306, 15710192], [15710193, 16692079], [16692080, 17673966], [17673967, 18655853], [18655854, 19637758]] SRR7169621 file size 6632891 SRR7169621 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169621 SRR7169621_1.fastq SRR7169621_2.fastq Input file: SRR7169621_1.fastq Paired file: SRR7169621_2.fastq trimmed: SRR7169621-trimmed-pair1.fastq, SRR7169621-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:52:50 2025 >> started Tue Feb 11 10:53:13 2025 >> done (23.433s) 19637758 read pairs processed; of these: 26731 ( 0.14%) short read pairs filtered out after trimming by size control 161163 ( 0.82%) empty read pairs filtered out after trimming by size control 19449864 (99.04%) read pairs available; of these: 9372940 (48.19%) trimmed read pairs available after processing 10076924 (51.81%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 12 0.00% 20 16 0.00% 21 20 0.00% 22 15 0.00% 23 11 0.00% 24 16 0.00% 25 11 0.00% 26 17 0.00% 27 16 0.00% 28 12 0.00% 29 19 0.00% 30 27 0.00% 31 23 0.00% 32 27 0.00% 33 23 0.00% 34 22 0.00% 35 34 0.00% 36 24 0.00% 37 20 0.00% 38 37 0.00% 39 27 0.00% 40 38 0.00% 41 34 0.00% 42 44 0.00% 43 54 0.00% 44 68 0.00% 45 87 0.00% 46 88 0.00% 47 111 0.00% 48 110 0.00% 49 118 0.00% 50 139 0.00% 51 137 0.00% 52 150 0.00% 53 171 0.00% 54 188 0.00% 55 173 0.00% 56 207 0.00% 57 201 0.00% 58 233 0.00% 59 265 0.00% 60 290 0.00% 61 341 0.00% 62 391 0.00% 63 436 0.00% 64 428 0.00% 65 525 0.00% 66 699 0.00% 67 855 0.00% 68 952 0.00% 69 1831 0.01% 70 4081 0.02% 71 2413 0.01% 72 1721 0.01% 73 1528 0.01% 74 1563 0.01% 75 1675 0.01% 76 1736 0.01% 77 1823 0.01% 78 2052 0.01% 79 2235 0.01% 80 2580 0.01% 81 2873 0.01% 82 3327 0.02% 83 3737 0.02% 84 4963 0.03% 85 5748 0.03% 86 6214 0.03% 87 6733 0.03% 88 7443 0.04% 89 7855 0.04% 90 8490 0.04% 91 8396 0.04% 92 9226 0.05% 93 10040 0.05% 94 10022 0.05% 95 10905 0.06% 96 11525 0.06% 97 12033 0.06% 98 12419 0.06% 99 12881 0.07% 100 13870 0.07% 101 14577 0.07% 102 15677 0.08% 103 16485 0.08% 104 17403 0.09% 105 18686 0.10% 106 19121 0.10% 107 20275 0.10% 108 21193 0.11% 109 22129 0.11% 110 22983 0.12% 111 24080 0.12% 112 24977 0.13% 113 26798 0.14% 114 28065 0.14% 115 29657 0.15% 116 31094 0.16% 117 32673 0.17% 118 33544 0.17% 119 33875 0.17% 120 35940 0.18% 121 36652 0.19% 122 38691 0.20% 123 41513 0.21% 124 43591 0.22% 125 45261 0.23% 126 48044 0.25% 127 50601 0.26% 128 53015 0.27% 129 55455 0.29% 130 57920 0.30% 131 59825 0.31% 132 63458 0.33% 133 67297 0.35% 134 71125 0.37% 135 75606 0.39% 136 80247 0.41% 137 86539 0.44% 138 91342 0.47% 139 98133 0.50% 140 104733 0.54% 141 114714 0.59% 142 127061 0.65% 143 143533 0.74% 144 161675 0.83% 145 191114 0.98% 146 237242 1.22% 147 322761 1.66% 148 493069 2.54% 149 1001448 5.15% 150 4620134 23.75% 151 10076924 51.81% 19449864 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.75 fanout-score-rank=32 prefix-density=0.21 prefix-fanout=2.4 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.11 sequence-density-rank=14 fanout-score=110.62 fanout-score-rank=1 prefix-density=0.63 prefix-fanout=19.5 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=5.43 fanout-score-rank=19 prefix-density=0.50 prefix-fanout=3.4 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.02 sequence-density-rank=41 fanout-score=151.21 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=13.6 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCACGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTTCTCGAGAAGATCAAGGAGAAGTTACCTGGGTACCACCCCAAGACTGAAGAAGAGAA SRR7169621 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:54:03 Started mapping on | Feb 11 10:54:03 Finished on | Feb 11 10:57:29 Mapping speed, Million of reads per hour | 339.90 Number of input reads | 19449864 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 17980121 Uniquely mapped reads % | 92.44% Average mapped length | 294.44 Number of splices: Total | 16043455 Number of splices: Annotated (sjdb) | 15748886 Number of splices: GT/AG | 15805400 Number of splices: GC/AG | 187504 Number of splices: AT/AC | 14452 Number of splices: Non-canonical | 36099 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 344589 % of reads mapped to multiple loci | 1.77% Number of reads mapped to too many loci | 40377 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.50% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1144429 1144429 1144429 N_multimapping 344589 344589 344589 N_noFeature 418528 17747668 528221 N_ambiguous 195909 1379 72232 UnstrandedReadsAssigned:17365684 PositiveStrandReadsAssigned:231074 NegativeStrandReadsAssigned:17379668 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169621 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169621-trimmed-pair1.fastq SRR7169621-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,449,864 reads, 17,322,516 reads pseudoaligned [quant] estimated average fragment length: 237.78 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,220 rounds 52401 SRR7169621.ke.tsv 34699 SRR7169621.se.tsv 87100 total ==> SRR7169621.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1781.22 310 8.2719 Potri.005G024800.1.v4.1 1035 798.22 35 2.08404 Potri.004G059700.1.v4.1 961 724.235 6 0.393761 Potri.007G009000.2.v4.1 1416 1179.22 0 0 Potri.003G141000.2.v4.1 2943 2706.22 305.035 5.35733 Potri.016G087400.1.v4.1 270 75.9483 2128.53 1332.05 Potri.015G069301.1.v4.1 564 329.768 0 0 Potri.010G195200.1.v4.1 1773 1536.22 31 0.959112 Potri.012G127500.1.v4.1 977 740.23 9070 582.374 ==> SRR7169621.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1499 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 289 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169621 completed mapping pipeline successfully