Starting /dee2/code/volunteer_pipeline.sh SRR7169622 current disk space = 3053047230464 free memory = 1430529696 SRR7169622 SRAfilesize f88c58a6147907d8303c2e3dae5a38cc SRR7169622.sra SRR7169622.sra file validated SRR7169622 is paired end SRR7169622 is conventional basespace SRR7169622 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169622_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.91 34.0 33.0 34.0 33.0 34.0 2 33.3655 34.0 34.0 34.0 33.0 34.0 3 33.40675 34.0 34.0 34.0 33.0 34.0 4 33.4635 34.0 34.0 34.0 33.0 34.0 5 33.46825 34.0 34.0 34.0 33.0 34.0 6 37.03325 38.0 37.0 38.0 36.0 38.0 7 37.33425 38.0 38.0 38.0 37.0 38.0 8 37.47575 38.0 38.0 38.0 37.0 38.0 9 37.406 38.0 38.0 38.0 37.0 38.0 10-14 37.40775 38.0 38.0 38.0 37.0 38.0 15-19 37.43435 38.0 38.0 38.0 37.0 38.0 20-24 37.4408 38.0 38.0 38.0 37.0 38.0 25-29 37.4353 38.0 38.0 38.0 37.0 38.0 30-34 37.405449999999995 38.0 38.0 38.0 37.0 38.0 35-39 37.21495 38.0 38.0 38.0 36.6 38.0 40-44 37.2833 38.0 38.0 38.0 36.8 38.0 45-49 37.206450000000004 38.0 38.0 38.0 36.4 38.0 50-54 37.138349999999996 38.0 38.0 38.0 36.0 38.0 55-59 37.08655 38.0 38.0 38.0 36.0 38.0 60-64 37.036199999999994 38.0 38.0 38.0 36.0 38.0 65-69 36.98155 38.0 38.0 38.0 36.0 38.0 70-74 36.953199999999995 38.0 38.0 38.0 35.8 38.0 75-79 36.87725 38.0 38.0 38.0 35.4 38.0 80-84 36.82225 38.0 38.0 38.0 35.2 38.0 85-89 36.71175 38.0 38.0 38.0 35.0 38.0 90-94 36.640750000000004 38.0 38.0 38.0 34.6 38.0 95-99 36.544799999999995 38.0 38.0 38.0 34.2 38.0 100-104 36.402249999999995 38.0 38.0 38.0 34.0 38.0 105-109 36.309549999999994 38.0 38.0 38.0 34.0 38.0 110-114 36.149 38.0 37.4 38.0 33.4 38.0 115-119 36.02185000000001 38.0 37.0 38.0 33.0 38.0 120-124 35.77075 38.0 37.0 38.0 31.6 38.0 125-129 35.6272 38.0 36.6 38.0 31.0 38.0 130-134 35.45705 38.0 36.0 38.0 31.0 38.0 135-139 35.09830000000001 38.0 35.8 38.0 29.4 38.0 140-144 34.76655000000001 38.0 35.6 38.0 28.0 38.0 145-149 34.005849999999995 38.0 35.0 38.0 23.8 38.0 150-151 31.054249999999996 36.5 31.5 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 2.0 13 1.0 14 0.0 15 2.0 16 2.0 17 0.0 18 1.0 19 4.0 20 3.0 21 7.0 22 5.0 23 3.0 24 8.0 25 20.0 26 15.0 27 28.0 28 31.0 29 42.0 30 38.0 31 48.0 32 77.0 33 88.0 34 132.0 35 226.0 36 586.0 37 2630.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.12579415501906 13.163913595933927 9.351969504447268 34.35832274459975 2 23.525 16.0 32.95 27.525 3 19.525000000000002 20.45 26.325 33.7 4 21.65 29.525000000000002 23.625 25.2 5 22.2 33.550000000000004 23.425 20.825 6 18.3 35.775 25.650000000000002 20.275000000000002 7 13.725000000000001 25.650000000000002 42.75 17.875 8 18.0 25.974999999999998 29.45 26.575 9 16.950000000000003 24.2 34.4 24.45 10-14 19.54 30.03 26.715 23.715 15-19 19.84 29.035 27.715 23.41 20-24 20.18 28.405 27.755000000000003 23.66 25-29 19.295 28.735 27.755000000000003 24.215 30-34 19.900000000000002 28.689999999999998 28.105000000000004 23.305 35-39 20.305 28.285 28.165000000000003 23.244999999999997 40-44 19.915 28.64 27.785 23.66 45-49 19.945 28.815 27.150000000000002 24.09 50-54 19.905 29.054999999999996 27.384999999999998 23.655 55-59 19.475 29.485 27.485 23.555 60-64 19.835 28.535 27.195000000000004 24.435000000000002 65-69 20.57 28.09 27.625 23.715 70-74 20.31 28.715000000000003 27.205000000000002 23.77 75-79 19.86 28.98 27.35 23.810000000000002 80-84 20.265 28.325 27.325 24.085 85-89 20.23 28.139999999999997 27.250000000000004 24.38 90-94 20.19 28.544999999999998 26.57 24.695 95-99 20.015 28.754999999999995 27.384999999999998 23.845 100-104 20.9 28.01 27.115000000000002 23.974999999999998 105-109 20.575 28.744999999999997 27.229999999999997 23.45 110-114 20.3 28.67 27.33 23.7 115-119 20.41 28.78 26.965 23.845 120-124 20.22 28.444999999999997 27.015 24.32 125-129 20.560000000000002 27.88 27.61 23.95 130-134 20.885 27.905 27.400000000000002 23.810000000000002 135-139 20.985 28.139999999999997 26.965 23.91 140-144 21.02 28.275 26.82 23.885 145-149 21.025 28.384999999999998 26.72 23.87 150-151 20.825 28.8375 26.5375 23.799999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 2.0 23 3.5 24 1.5 25 1.5 26 6.5 27 10.0 28 9.0 29 12.0 30 18.5 31 24.0 32 30.5 33 42.0 34 61.0 35 80.5 36 93.5 37 100.0 38 116.0 39 145.0 40 170.5 41 195.5 42 234.5 43 252.0 44 267.5 45 280.5 46 286.5 47 292.5 48 252.0 49 211.0 50 175.0 51 135.5 52 120.0 53 108.0 54 80.0 55 53.0 56 33.0 57 25.0 58 21.0 59 14.0 60 11.0 61 6.5 62 4.0 63 2.5 64 3.0 65 2.0 66 0.0 67 0.5 68 2.0 69 2.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62339944765253 99.2 2 0.35149384885764495 0.7000000000000001 3 0.0 0.0 4 0.025106703489831784 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.4875 0.0 0.0 0.0 0.0 88-89 0.575 0.0 0.0 0.0 0.0 90-91 0.7 0.0 0.0 0.0 0.0 92-93 0.8125 0.0 0.0 0.0 0.0 94-95 0.9 0.0 0.0 0.0 0.0 96-97 1.0499999999999998 0.0 0.0 0.0 0.0 98-99 1.125 0.0 0.0 0.0 0.0 100-101 1.25 0.0 0.0 0.0 0.0 102-103 1.3624999999999998 0.0 0.0 0.0 0.0 104-105 1.4375 0.0 0.0 0.0 0.0 106-107 1.575 0.0 0.0 0.0 0.0 108-109 1.7374999999999998 0.0 0.0 0.0 0.0 110-111 1.85 0.0 0.0 0.0 0.0 112-113 2.025 0.0 0.0 0.0 0.0 114-115 2.2875 0.0 0.0 0.0 0.0 116-117 2.4 0.0 0.0 0.0 0.0 118-119 2.5875 0.0 0.0 0.0 0.0 120-121 2.875 0.0 0.0 0.0 0.0 122-123 3.1500000000000004 0.0 0.0 0.0 0.0 124-125 3.4000000000000004 0.0 0.0 0.0 0.0 126-127 3.7249999999999996 0.0 0.0 0.0 0.0 128-129 4.1 0.0 0.0 0.0 0.0 130-131 4.6125 0.0 0.0 0.0 0.0 132-133 5.0625 0.0 0.0 0.0 0.0 134-135 5.4375 0.0 0.0 0.0 0.0 136-137 6.0875 0.0 0.0 0.0 0.0 138-139 6.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169622 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169622_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.87025 33.0 33.0 34.0 32.0 34.0 2 32.9375 33.0 33.0 34.0 32.0 34.0 3 32.88525 34.0 33.0 34.0 32.0 34.0 4 32.87725 34.0 33.0 34.0 32.0 34.0 5 32.9075 34.0 33.0 34.0 32.0 34.0 6 37.04075 38.0 38.0 38.0 37.0 38.0 7 37.05975 38.0 38.0 38.0 37.0 38.0 8 37.0425 38.0 38.0 38.0 37.0 38.0 9 37.037 38.0 38.0 38.0 37.0 38.0 10-14 37.07305 38.0 38.0 38.0 37.0 38.0 15-19 36.94324999999999 38.0 38.0 38.0 36.8 38.0 20-24 36.96095 38.0 38.0 38.0 36.4 38.0 25-29 36.92525 38.0 38.0 38.0 36.6 38.0 30-34 36.866499999999995 38.0 38.0 38.0 36.6 38.0 35-39 36.88805 38.0 38.0 38.0 36.2 38.0 40-44 36.84824999999999 38.0 38.0 38.0 36.0 38.0 45-49 36.85025 38.0 38.0 38.0 36.2 38.0 50-54 36.86665000000001 38.0 38.0 38.0 36.0 38.0 55-59 36.338 38.0 37.8 38.0 33.8 38.0 60-64 36.71785 38.0 38.0 38.0 35.8 38.0 65-69 36.6316 38.0 38.0 38.0 35.4 38.0 70-74 36.60215 38.0 38.0 38.0 35.0 38.0 75-79 36.52595 38.0 38.0 38.0 35.0 38.0 80-84 36.401650000000004 38.0 38.0 38.0 34.4 38.0 85-89 36.441449999999996 38.0 38.0 38.0 35.0 38.0 90-94 36.3489 38.0 38.0 38.0 34.0 38.0 95-99 36.220150000000004 38.0 38.0 38.0 34.0 38.0 100-104 36.1389 38.0 38.0 38.0 34.0 38.0 105-109 35.9276 38.0 38.0 38.0 33.2 38.0 110-114 35.8386 38.0 38.0 38.0 33.0 38.0 115-119 35.6354 38.0 37.2 38.0 32.2 38.0 120-124 35.4519 38.0 37.0 38.0 31.0 38.0 125-129 35.2365 38.0 36.6 38.0 29.8 38.0 130-134 34.703700000000005 38.0 36.0 38.0 27.4 38.0 135-139 34.4399 38.0 35.4 38.0 25.4 38.0 140-144 34.1399 38.0 35.0 38.0 23.4 38.0 145-149 33.56565 38.0 35.0 38.0 19.6 38.0 150-151 29.872625 36.5 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 5.0 4 4.0 5 2.0 6 2.0 7 1.0 8 0.0 9 2.0 10 3.0 11 4.0 12 1.0 13 4.0 14 3.0 15 3.0 16 7.0 17 3.0 18 6.0 19 5.0 20 8.0 21 7.0 22 12.0 23 8.0 24 14.0 25 19.0 26 28.0 27 25.0 28 29.0 29 30.0 30 37.0 31 63.0 32 64.0 33 94.0 34 115.0 35 219.0 36 501.0 37 2660.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.143501126972204 21.587778612572002 12.546957175056347 26.72176308539945 2 27.206619859578733 26.37913741223671 30.466399197592782 15.947843530591776 3 19.98495486459378 27.933801404212637 32.17151454363089 19.90972918756269 4 23.520561685055167 34.97993981945838 23.094282848545635 18.405215646940825 5 24.09729187562688 36.45937813440321 22.868605817452355 16.574724172517552 6 21.317635270541082 38.25150300601202 21.8436873747495 18.587174348697395 7 21.117234468937877 20.140280561122246 40.3807615230461 18.361723446893787 8 21.96343601302279 25.018782870022537 26.746806912096165 26.270974204858504 9 21.587778612572002 25.694966190833963 29.226145755071375 23.491109441522664 10-14 23.349363791203288 28.368900911732293 27.011321510870655 21.270413786193767 15-19 23.159002103997594 27.532311391644125 27.85292054904318 21.455765955315098 20-24 23.09619238476954 28.34669338677355 27.284569138276556 21.272545090180362 25-29 23.011022044088175 27.650300601202403 28.0561122244489 21.282565130260522 30-34 23.246492985971944 28.07615230460922 27.625250501002004 21.052104208416832 35-39 22.715430861723444 28.106212424849698 28.21142284569138 20.96693386773547 40-44 23.324316200781485 27.351968740607152 28.00320609157399 21.320508967037373 45-49 23.092721534839452 28.026849671893 27.95671993187397 20.923708861393578 50-54 23.075381918357124 28.044077134986228 28.37465564738292 20.50588529927373 55-59 23.461056849486603 28.114199849737037 27.92887553218132 20.49586776859504 60-64 23.06151071929473 27.81506712081747 28.341013824884794 20.782408335003005 65-69 23.705039575192867 27.913034766055507 27.697625488428013 20.684300170323617 70-74 23.250338159410852 27.29322178247583 28.435449125795305 21.02099093231802 75-79 23.309287646528404 28.29876765855125 27.767758741609054 20.62418595331129 80-84 23.637274549098198 27.735470941883765 28.286573146292586 20.34068136272545 85-89 23.336673346693388 28.486973947895795 27.064128256513026 21.112224448897795 90-94 23.53589499524072 27.904413606532742 28.149892289965432 20.409799108261108 95-99 23.581267217630856 27.978963185574756 28.094164788379665 20.345604808414723 100-104 24.06711745554721 28.00901577761082 27.468069120961687 20.455797645880292 105-109 24.236201542622457 27.832314935390162 27.33146348792948 20.6000200340579 110-114 24.465260732354857 27.596052697490357 27.63612683464409 20.302559735510695 115-119 24.14086764853221 27.67257789800621 27.89800621180242 20.28854824165915 120-124 23.951705826361405 28.099794599468964 27.64891538500075 20.29958418916888 125-129 24.091979359751512 27.90942337558239 27.548720004007816 20.449877260658283 130-134 24.10320641282565 27.585170340681366 27.625250501002004 20.68637274549098 135-139 24.9035619457943 27.969540604178146 27.27318270627724 19.853714743750313 140-144 24.24864756561811 27.820076137046684 27.108795832498494 20.82248046483671 145-149 25.05384422739795 27.533183070373152 27.327823691460058 20.085149010768845 150-151 24.296259226823473 28.0995871387464 27.248842737395222 20.355310897034904 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 7.0 1 3.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 1.0 20 1.0 21 0.5 22 0.0 23 0.5 24 1.0 25 1.5 26 2.0 27 4.5 28 8.0 29 8.0 30 10.5 31 20.5 32 29.5 33 38.5 34 48.0 35 61.5 36 75.5 37 93.5 38 126.5 39 163.0 40 191.5 41 215.5 42 242.5 43 273.0 44 287.0 45 298.5 46 291.0 47 269.5 48 245.5 49 207.0 50 169.5 51 136.0 52 122.5 53 97.0 54 66.0 55 51.0 56 38.0 57 27.0 58 21.0 59 13.0 60 6.0 61 5.0 62 4.5 63 3.0 64 3.5 65 4.0 66 3.0 67 1.5 68 0.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.3 3 0.3 4 0.3 5 0.3 6 0.2 7 0.2 8 0.17500000000000002 9 0.17500000000000002 10-14 0.19 15-19 0.19 20-24 0.2 25-29 0.2 30-34 0.2 35-39 0.2 40-44 0.19 45-49 0.185 50-54 0.17500000000000002 55-59 0.17500000000000002 60-64 0.18 65-69 0.19 70-74 0.19499999999999998 75-79 0.19 80-84 0.2 85-89 0.2 90-94 0.19499999999999998 95-99 0.17500000000000002 100-104 0.17500000000000002 105-109 0.16999999999999998 110-114 0.185 115-119 0.19 120-124 0.19499999999999998 125-129 0.19499999999999998 130-134 0.2 135-139 0.19499999999999998 140-144 0.18 145-149 0.17500000000000002 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57232704402516 98.95 2 0.37735849056603776 0.75 3 0.0 0.0 4 0.0 0.0 5 0.025157232704402514 0.125 6 0.0 0.0 7 0.025157232704402514 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit GTTACAAGCGCTAATCACTCGAAGCAGAAGCTTACTCATTTTAATTACTC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.675 0.0 0.0 0.0 0.0 92-93 0.7875000000000001 0.0 0.0 0.0 0.0 94-95 0.875 0.0 0.0 0.0 0.0 96-97 1.025 0.0 0.0 0.0 0.0 98-99 1.125 0.0 0.0 0.0 0.0 100-101 1.25 0.0 0.0 0.0 0.0 102-103 1.35 0.0 0.0 0.0 0.0 104-105 1.4125 0.0 0.0 0.0 0.0 106-107 1.5375 0.0 0.0 0.0 0.0 108-109 1.7125 0.0 0.0 0.0 0.0 110-111 1.8375 0.0 0.0 0.0 0.0 112-113 2.025 0.0 0.0 0.0 0.0 114-115 2.3125 0.0 0.0 0.0 0.0 116-117 2.425 0.0 0.0 0.0 0.0 118-119 2.6125 0.0 0.0 0.0 0.0 120-121 2.875 0.0 0.0 0.0 0.0 122-123 3.0999999999999996 0.0 0.0 0.0 0.0 124-125 3.325 0.0 0.0 0.0 0.0 126-127 3.6625 0.0 0.0 0.0 0.0 128-129 4.0375 0.0 0.0 0.0 0.0 130-131 4.55 0.0 0.0 0.0 0.0 132-133 5.0125 0.0 0.0 0.0 0.0 134-135 5.3875 0.0 0.0 0.0 0.0 136-137 5.9875 0.0 0.0 0.0 0.0 138-139 6.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAAAGA 10 0.006830828 145.0 7 >>END_MODULE Read 911868 spots for SRR7169622.sra Written 911868 spots for SRR7169622.sra Read 911868 spots for SRR7169622.sra Written 911868 spots for SRR7169622.sra Read 911868 spots for SRR7169622.sra Written 911868 spots for SRR7169622.sra Read 911868 spots for SRR7169622.sra Written 911868 spots for SRR7169622.sra Read 911868 spots for SRR7169622.sra Written 911868 spots for SRR7169622.sra Read 911868 spots for SRR7169622.sra Written 911868 spots for SRR7169622.sra Read 911868 spots for SRR7169622.sra Written 911868 spots for SRR7169622.sra Read 911868 spots for SRR7169622.sra Written 911868 spots for SRR7169622.sra Read 911868 spots for SRR7169622.sra Written 911868 spots for SRR7169622.sra Read 911868 spots for SRR7169622.sra Written 911868 spots for SRR7169622.sra Read 911873 spots for SRR7169622.sra Written 911873 spots for SRR7169622.sra Read 911868 spots for SRR7169622.sra Written 911868 spots for SRR7169622.sra Read 911868 spots for SRR7169622.sra Written 911868 spots for SRR7169622.sra Read 911868 spots for SRR7169622.sra Written 911868 spots for SRR7169622.sra Read 911868 spots for SRR7169622.sra Written 911868 spots for SRR7169622.sra Read 911868 spots for SRR7169622.sra Written 911868 spots for SRR7169622.sra Read 911868 spots for SRR7169622.sra Written 911868 spots for SRR7169622.sra Read 911868 spots for SRR7169622.sra Written 911868 spots for SRR7169622.sra Read 911868 spots for SRR7169622.sra Written 911868 spots for SRR7169622.sra Read 911868 spots for SRR7169622.sra Written 911868 spots for SRR7169622.sra SRR ids: ['SRR7169622.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hz3jedfg SRR7169622.sra spots: 18237365 blocks: [[1, 911868], [911869, 1823736], [1823737, 2735604], [2735605, 3647472], [3647473, 4559340], [4559341, 5471208], [5471209, 6383076], [6383077, 7294944], [7294945, 8206812], [8206813, 9118680], [9118681, 10030548], [10030549, 10942416], [10942417, 11854284], [11854285, 12766152], [12766153, 13678020], [13678021, 14589888], [14589889, 15501756], [15501757, 16413624], [16413625, 17325492], [17325493, 18237365]] SRR7169622 file size 6158344 SRR7169622 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169622 SRR7169622_1.fastq SRR7169622_2.fastq Input file: SRR7169622_1.fastq Paired file: SRR7169622_2.fastq trimmed: SRR7169622-trimmed-pair1.fastq, SRR7169622-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:38:40 2025 >> started Tue Feb 11 10:39:09 2025 >> done (28.075s) 18237365 read pairs processed; of these: 18017 ( 0.10%) short read pairs filtered out after trimming by size control 53149 ( 0.29%) empty read pairs filtered out after trimming by size control 18166199 (99.61%) read pairs available; of these: 7813649 (43.01%) trimmed read pairs available after processing 10352550 (56.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 7 0.00% 20 8 0.00% 21 10 0.00% 22 7 0.00% 23 7 0.00% 24 12 0.00% 25 14 0.00% 26 7 0.00% 27 13 0.00% 28 14 0.00% 29 14 0.00% 30 12 0.00% 31 23 0.00% 32 10 0.00% 33 5 0.00% 34 27 0.00% 35 13 0.00% 36 13 0.00% 37 26 0.00% 38 23 0.00% 39 24 0.00% 40 43 0.00% 41 29 0.00% 42 38 0.00% 43 37 0.00% 44 42 0.00% 45 37 0.00% 46 46 0.00% 47 69 0.00% 48 65 0.00% 49 65 0.00% 50 101 0.00% 51 109 0.00% 52 111 0.00% 53 101 0.00% 54 124 0.00% 55 134 0.00% 56 157 0.00% 57 174 0.00% 58 173 0.00% 59 250 0.00% 60 290 0.00% 61 331 0.00% 62 344 0.00% 63 432 0.00% 64 394 0.00% 65 516 0.00% 66 562 0.00% 67 609 0.00% 68 832 0.00% 69 1552 0.01% 70 1773 0.01% 71 1382 0.01% 72 1319 0.01% 73 1473 0.01% 74 1622 0.01% 75 1766 0.01% 76 1947 0.01% 77 2060 0.01% 78 2288 0.01% 79 2608 0.01% 80 3084 0.02% 81 3430 0.02% 82 4018 0.02% 83 4311 0.02% 84 5855 0.03% 85 6287 0.03% 86 6631 0.04% 87 6996 0.04% 88 7758 0.04% 89 8134 0.04% 90 8725 0.05% 91 9411 0.05% 92 10151 0.06% 93 11295 0.06% 94 11952 0.07% 95 12788 0.07% 96 13409 0.07% 97 13900 0.08% 98 14437 0.08% 99 15358 0.08% 100 16015 0.09% 101 17122 0.09% 102 18337 0.10% 103 19464 0.11% 104 20572 0.11% 105 21882 0.12% 106 22511 0.12% 107 23097 0.13% 108 23558 0.13% 109 24487 0.13% 110 25277 0.14% 111 26700 0.15% 112 27839 0.15% 113 29594 0.16% 114 31131 0.17% 115 32830 0.18% 116 33790 0.19% 117 35189 0.19% 118 35640 0.20% 119 36427 0.20% 120 37772 0.21% 121 38748 0.21% 122 40795 0.22% 123 43018 0.24% 124 44835 0.25% 125 47051 0.26% 126 48485 0.27% 127 50826 0.28% 128 51735 0.28% 129 53445 0.29% 130 55022 0.30% 131 57751 0.32% 132 60171 0.33% 133 63752 0.35% 134 67371 0.37% 135 71884 0.40% 136 75555 0.42% 137 79657 0.44% 138 84552 0.47% 139 88167 0.49% 140 93034 0.51% 141 99620 0.55% 142 108800 0.60% 143 120640 0.66% 144 137686 0.76% 145 160403 0.88% 146 194312 1.07% 147 256792 1.41% 148 377906 2.08% 149 709796 3.91% 150 3668375 20.19% 151 10352550 56.99% 18166199 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.71 fanout-score-rank=34 prefix-density=0.17 prefix-fanout=2.4 sequence=CTGGCCATTCAATGTGACATCCTCTTGAGTGGCTTTCAAAAGCCTGATAAAAACGCTGAACTGACCACCTTTTTCTAGGACTTTGGTGACATTGGTTGGACCGGGTGGTGCTGGGGCTGCAGCTGGTGACTGAGCTAGGGTTGGAGGGCAATGAAGAA criterion=fanout-score sequence-density=0.10 sequence-density-rank=18 fanout-score=253.02 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=28.0 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.57 fanout-score-rank=29 prefix-density=0.33 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=27 fanout-score=200.21 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=24.6 sequence=GAAGAAGAAGAAA SRR7169622 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:39:53 Started mapping on | Feb 11 10:39:53 Finished on | Feb 11 10:41:31 Mapping speed, Million of reads per hour | 667.33 Number of input reads | 18166199 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 17412797 Uniquely mapped reads % | 95.85% Average mapped length | 293.65 Number of splices: Total | 16799418 Number of splices: Annotated (sjdb) | 16520340 Number of splices: GT/AG | 16553905 Number of splices: GC/AG | 196294 Number of splices: AT/AC | 13886 Number of splices: Non-canonical | 35333 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 327097 % of reads mapped to multiple loci | 1.80% Number of reads mapped to too many loci | 21952 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.20% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 443372 443372 443372 N_multimapping 327097 327097 327097 N_noFeature 436098 17187513 569370 N_ambiguous 162756 1022 69960 UnstrandedReadsAssigned:16813943 PositiveStrandReadsAssigned:224262 NegativeStrandReadsAssigned:16773467 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169622 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169622-trimmed-pair1.fastq SRR7169622-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,166,199 reads, 16,668,466 reads pseudoaligned [quant] estimated average fragment length: 244.409 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,180 rounds 52401 SRR7169622.ke.tsv 34699 SRR7169622.se.tsv 87100 total ==> SRR7169622.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1774.59 285 9.74685 Potri.005G024800.1.v4.1 1035 791.591 16 1.2267 Potri.004G059700.1.v4.1 961 717.682 1 0.084564 Potri.007G009000.2.v4.1 1416 1172.59 0 0 Potri.003G141000.2.v4.1 2943 2699.59 301.028 6.76748 Potri.016G087400.1.v4.1 270 82.2329 1295 955.744 Potri.015G069301.1.v4.1 564 327.483 0 0 Potri.010G195200.1.v4.1 1773 1529.59 32 1.26967 Potri.012G127500.1.v4.1 977 733.648 5360 443.399 ==> SRR7169622.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1355 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 249 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169622 completed mapping pipeline successfully