Starting /dee2/code/volunteer_pipeline.sh SRR7169623 current disk space = 3052950970368 free memory = 1475688484 SRR7169623 SRAfilesize 9ee2bf35fc1248a33280bcb9f3541d8c SRR7169623.sra SRR7169623.sra file validated SRR7169623 is paired end SRR7169623 is conventional basespace SRR7169623 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169623_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.91575 34.0 33.0 34.0 33.0 34.0 2 33.394 34.0 34.0 34.0 33.0 34.0 3 33.4085 34.0 34.0 34.0 33.0 34.0 4 33.44725 34.0 34.0 34.0 33.0 34.0 5 33.486 34.0 34.0 34.0 33.0 34.0 6 37.0735 38.0 37.0 38.0 36.0 38.0 7 37.263 38.0 38.0 38.0 37.0 38.0 8 37.4725 38.0 38.0 38.0 37.0 38.0 9 37.46775 38.0 38.0 38.0 37.0 38.0 10-14 37.440650000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.49485 38.0 38.0 38.0 37.2 38.0 20-24 37.50085 38.0 38.0 38.0 37.0 38.0 25-29 37.44625 38.0 38.0 38.0 37.2 38.0 30-34 37.40715 38.0 38.0 38.0 37.0 38.0 35-39 37.29195 38.0 38.0 38.0 36.8 38.0 40-44 37.2443 38.0 38.0 38.0 36.8 38.0 45-49 37.1957 38.0 38.0 38.0 36.0 38.0 50-54 37.12405 38.0 38.0 38.0 36.0 38.0 55-59 37.092349999999996 38.0 38.0 38.0 36.0 38.0 60-64 37.01005 38.0 38.0 38.0 36.0 38.0 65-69 36.9871 38.0 38.0 38.0 36.0 38.0 70-74 36.882850000000005 38.0 38.0 38.0 35.6 38.0 75-79 36.87075 38.0 38.0 38.0 35.4 38.0 80-84 36.7521 38.0 38.0 38.0 34.8 38.0 85-89 36.759100000000004 38.0 38.0 38.0 35.0 38.0 90-94 36.64005 38.0 38.0 38.0 34.4 38.0 95-99 36.4935 38.0 38.0 38.0 34.2 38.0 100-104 36.34645 38.0 38.0 38.0 34.0 38.0 105-109 36.27995 38.0 37.8 38.0 33.8 38.0 110-114 36.1526 38.0 37.0 38.0 33.4 38.0 115-119 35.94465 38.0 37.0 38.0 32.6 38.0 120-124 35.79645000000001 38.0 36.8 38.0 32.2 38.0 125-129 35.5231 38.0 36.0 38.0 31.0 38.0 130-134 35.4419 38.0 36.0 38.0 31.0 38.0 135-139 35.049800000000005 38.0 35.6 38.0 28.6 38.0 140-144 34.728899999999996 38.0 35.2 38.0 27.8 38.0 145-149 34.0892 38.0 35.0 38.0 24.6 38.0 150-151 30.963749999999997 36.5 31.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 1.0 15 2.0 16 2.0 17 3.0 18 2.0 19 3.0 20 6.0 21 3.0 22 4.0 23 6.0 24 8.0 25 14.0 26 12.0 27 21.0 28 27.0 29 37.0 30 43.0 31 49.0 32 70.0 33 87.0 34 156.0 35 249.0 36 632.0 37 2560.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.989837398373986 13.440040650406504 9.832317073170731 36.73780487804878 2 24.625 13.950000000000001 31.724999999999998 29.7 3 19.2 17.224999999999998 25.4 38.175 4 22.975 25.974999999999998 23.974999999999998 27.075 5 22.625 29.725 24.4 23.25 6 20.025000000000002 33.550000000000004 24.9 21.525 7 14.000000000000002 27.500000000000004 41.55 16.950000000000003 8 17.4 27.1 30.95 24.55 9 16.650000000000002 25.25 33.25 24.85 10-14 19.495 30.154999999999998 27.165 23.185 15-19 19.345000000000002 28.515 27.875 24.265 20-24 19.93 29.18 26.96 23.93 25-29 19.82 28.89 27.255000000000003 24.035 30-34 20.05 29.005 27.495000000000005 23.45 35-39 19.580000000000002 28.754999999999995 27.595 24.07 40-44 19.46 28.660000000000004 27.77 24.11 45-49 19.830000000000002 28.34 27.884999999999998 23.945 50-54 20.105 29.005 27.48 23.41 55-59 20.375 28.88 26.740000000000002 24.005000000000003 60-64 19.62 28.904999999999998 27.495000000000005 23.98 65-69 20.119999999999997 28.455000000000002 27.700000000000003 23.724999999999998 70-74 19.935 28.765 27.865000000000002 23.435 75-79 20.165 28.65 27.27 23.915 80-84 20.165 28.485 27.015 24.335 85-89 20.395 28.42 27.355 23.830000000000002 90-94 20.294999999999998 28.660000000000004 27.055 23.990000000000002 95-99 20.395 28.015 27.744999999999997 23.845 100-104 20.1 28.33 27.35 24.22 105-109 20.435 28.189999999999998 27.089999999999996 24.285 110-114 20.68 28.535 27.24 23.544999999999998 115-119 20.525 28.915000000000003 26.974999999999998 23.585 120-124 20.285 28.365000000000002 27.435 23.915 125-129 20.985 27.97 27.18 23.865 130-134 21.37 28.515 27.145000000000003 22.97 135-139 20.685000000000002 28.560000000000002 26.88 23.875 140-144 21.255 27.485 27.41 23.849999999999998 145-149 20.685000000000002 27.944999999999997 27.255000000000003 24.115000000000002 150-151 21.425 28.0625 26.275 24.2375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 1.0 23 2.0 24 2.0 25 3.0 26 4.5 27 7.0 28 8.5 29 10.5 30 18.0 31 21.5 32 26.0 33 34.5 34 49.0 35 65.0 36 77.5 37 102.0 38 131.5 39 155.0 40 187.5 41 218.5 42 236.0 43 262.5 44 275.5 45 275.5 46 276.5 47 270.5 48 240.5 49 203.5 50 187.0 51 158.0 52 123.0 53 92.0 54 72.5 55 51.0 56 36.5 57 31.0 58 21.0 59 18.0 60 12.0 61 7.5 62 4.5 63 4.0 64 3.0 65 1.5 66 1.5 67 2.0 68 1.0 69 1.5 70 2.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54785229841748 99.075 2 0.42702838482793265 0.8500000000000001 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.475 0.0 0.0 0.0 0.0 102-103 0.525 0.0 0.0 0.0 0.0 104-105 0.6125 0.0 0.0 0.0 0.0 106-107 0.7 0.0 0.0 0.0 0.0 108-109 0.7875000000000001 0.0 0.0 0.0 0.0 110-111 0.8625 0.0 0.0 0.0 0.0 112-113 1.0375 0.0 0.0 0.0 0.0 114-115 1.2 0.0 0.0 0.0 0.0 116-117 1.3250000000000002 0.0 0.0 0.0 0.0 118-119 1.4500000000000002 0.0 0.0 0.0 0.0 120-121 1.5875 0.0 0.0 0.0 0.0 122-123 1.8 0.0 0.0 0.0 0.0 124-125 1.9625 0.0 0.0 0.0 0.0 126-127 2.2375 0.0 0.0 0.0 0.0 128-129 2.5125 0.0 0.0 0.0 0.0 130-131 2.7375 0.0 0.0 0.0 0.0 132-133 3.0625 0.0 0.0 0.0 0.0 134-135 3.3875 0.0 0.0 0.0 0.0 136-137 3.625 0.0 0.0 0.0 0.0 138-139 3.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169623 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169623_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.62975 33.0 33.0 34.0 32.0 34.0 2 32.77625 33.0 33.0 34.0 32.0 34.0 3 32.73575 34.0 33.0 34.0 32.0 34.0 4 32.6755 34.0 33.0 34.0 32.0 34.0 5 32.66925 34.0 33.0 34.0 32.0 34.0 6 36.77375 38.0 38.0 38.0 36.0 38.0 7 36.77575 38.0 38.0 38.0 36.0 38.0 8 36.7805 38.0 38.0 38.0 36.0 38.0 9 36.76275 38.0 38.0 38.0 36.0 38.0 10-14 36.826499999999996 38.0 38.0 38.0 36.0 38.0 15-19 36.762800000000006 38.0 38.0 38.0 36.0 38.0 20-24 36.685050000000004 38.0 38.0 38.0 35.8 38.0 25-29 36.684799999999996 38.0 38.0 38.0 35.8 38.0 30-34 36.599149999999995 38.0 38.0 38.0 35.8 38.0 35-39 36.602450000000005 38.0 38.0 38.0 35.6 38.0 40-44 36.587149999999994 38.0 38.0 38.0 36.0 38.0 45-49 36.6068 38.0 38.0 38.0 35.8 38.0 50-54 36.53165 38.0 38.0 38.0 35.0 38.0 55-59 35.9356 38.0 37.4 38.0 30.8 38.0 60-64 36.3496 38.0 38.0 38.0 34.4 38.0 65-69 36.316649999999996 38.0 38.0 38.0 34.2 38.0 70-74 36.2728 38.0 38.0 38.0 34.2 38.0 75-79 36.2205 38.0 38.0 38.0 34.0 38.0 80-84 36.04365 38.0 38.0 38.0 33.8 38.0 85-89 36.04195 38.0 38.0 38.0 33.8 38.0 90-94 35.90435 38.0 38.0 38.0 33.2 38.0 95-99 35.85185 38.0 38.0 38.0 33.0 38.0 100-104 35.7418 38.0 37.6 38.0 33.0 38.0 105-109 35.674249999999994 38.0 37.0 38.0 32.6 38.0 110-114 35.5215 38.0 37.0 38.0 31.0 38.0 115-119 35.242900000000006 38.0 37.0 38.0 29.4 38.0 120-124 35.002050000000004 38.0 36.0 38.0 28.2 38.0 125-129 34.77485 38.0 36.0 38.0 27.4 38.0 130-134 34.35355 38.0 35.0 38.0 24.6 38.0 135-139 34.16095 38.0 35.0 38.0 23.0 38.0 140-144 33.65215 38.0 35.0 38.0 19.6 38.0 145-149 33.00855 38.0 34.6 38.0 14.0 38.0 150-151 29.402 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 23.0 3 8.0 4 4.0 5 1.0 6 2.0 7 1.0 8 1.0 9 7.0 10 3.0 11 1.0 12 1.0 13 2.0 14 4.0 15 6.0 16 8.0 17 5.0 18 8.0 19 9.0 20 4.0 21 6.0 22 14.0 23 12.0 24 20.0 25 23.0 26 34.0 27 26.0 28 36.0 29 30.0 30 39.0 31 58.0 32 58.0 33 86.0 34 151.0 35 273.0 36 577.0 37 2459.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.81267217630854 22.33909341347358 14.55046331079389 27.29777109942399 2 28.141459744168547 27.48934035615751 26.93754702784048 17.431652871833457 3 20.91798344620015 28.141459744168547 30.950589415600703 19.9899673940306 4 23.551542513167796 33.48382242287434 24.278906445949335 18.685728618008525 5 23.676950087785304 35.816403310759966 21.97140707298721 18.53523952846752 6 20.86673346693387 37.07414829659319 23.672344689378757 18.386773547094187 7 20.741482965931866 23.021042084168336 36.24749498997996 19.98997995991984 8 21.782674011016525 26.99048572859289 26.61492238357536 24.611917876815223 9 21.23716503881793 25.31930879038317 30.02754820936639 23.415977961432507 10-14 23.306952514526145 29.232618713684634 25.781406531757163 21.679022240032058 15-19 23.24917342951608 28.33383428514177 27.086464282136056 21.33052800320609 20-24 22.679224487751114 28.71599619257552 27.092831020489953 21.51194829918341 25-29 22.996742671009773 28.62440491104986 27.762465547481835 20.61638687045853 30-34 23.016787772488097 28.64445001252819 27.196191430719118 21.142570784264596 35-39 23.143601563282896 27.6681030163343 27.653071450045097 21.535223970337707 40-44 23.322811764116437 28.57858610150809 27.376121048148704 20.722481086226765 45-49 24.035667768760646 27.832882476705738 26.90111211301473 21.230337641518886 50-54 23.365047571357035 28.437656484727093 27.351026539809713 20.84626940410616 55-59 23.64401262082436 27.345119447087697 28.021235037812392 20.98963289427555 60-64 23.650205349093458 28.253030151257136 27.401582690573978 20.69518180907543 65-69 23.773981866452935 27.646145368932523 27.911636527576018 20.66823623703852 70-74 23.05881174231039 27.68259693417493 28.213605851117123 21.044985472397556 75-79 23.381763527054108 27.590180360721444 27.83066132264529 21.197394789579157 80-84 23.57951698566991 28.058923739853693 27.13698767411564 21.224571600360758 85-89 24.07555867321375 28.139092093396133 27.162040284597655 20.623308948792467 90-94 24.004208627686758 27.180720476977804 27.862117340548124 20.952953554787314 95-99 23.302283653846153 27.87459935897436 27.779447115384613 21.043669871794872 100-104 24.00721117732485 27.57273774350243 27.562722219440133 20.857328859732586 105-109 23.383059671605928 27.6231477773328 27.37284741690028 21.620945134160994 110-114 23.80546929780627 27.717119102474207 27.516778523489933 20.96063307622959 115-119 23.79902820217402 28.18714622050794 27.500876621750237 20.5129489555678 120-124 23.47311989578636 28.41825742772684 27.06047397164187 21.048148704844934 125-129 24.202034373903896 28.070351255198677 27.303702961366938 20.42391140953049 130-134 24.69686341316765 27.457661088285402 27.217156027658078 20.62831947088887 135-139 24.515159107992986 27.4718115760461 27.59709346028564 20.41593585567527 140-144 24.64435984772591 28.095572029653376 26.878381085954718 20.381687036665998 145-149 25.00876358355451 27.722970604436874 27.647854173969655 19.62041163803896 150-151 23.961980990495245 27.313656828414207 27.37618809404702 21.34817408704352 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 5.0 1 2.5 2 0.5 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 1.5 20 1.0 21 1.5 22 1.5 23 1.0 24 2.0 25 1.0 26 2.0 27 4.5 28 5.5 29 5.5 30 5.5 31 9.5 32 14.5 33 22.0 34 41.5 35 60.0 36 74.0 37 96.5 38 128.0 39 161.0 40 185.0 41 216.5 42 244.5 43 265.5 44 299.0 45 293.0 46 288.5 47 286.5 48 242.5 49 210.0 50 189.5 51 159.5 52 125.5 53 87.0 54 66.0 55 53.0 56 37.0 57 31.0 58 19.5 59 12.5 60 8.0 61 6.5 62 4.5 63 2.5 64 2.0 65 1.0 66 2.0 67 2.0 68 1.5 69 1.5 70 2.0 71 1.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 1.0 95 0.5 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.325 3 0.325 4 0.325 5 0.325 6 0.2 7 0.2 8 0.15 9 0.17500000000000002 10-14 0.18 15-19 0.19 20-24 0.19499999999999998 25-29 0.22499999999999998 30-34 0.22499999999999998 35-39 0.21 40-44 0.20500000000000002 45-49 0.19 50-54 0.15 55-59 0.165 60-64 0.16999999999999998 65-69 0.185 70-74 0.19 75-79 0.2 80-84 0.21 85-89 0.21 90-94 0.20500000000000002 95-99 0.16 100-104 0.155 105-109 0.12 110-114 0.16999999999999998 115-119 0.185 120-124 0.20500000000000002 125-129 0.215 130-134 0.21 135-139 0.22499999999999998 140-144 0.18 145-149 0.155 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49685534591195 98.875 2 0.42767295597484273 0.8500000000000001 3 0.05031446540880503 0.15 4 0.0 0.0 5 0.025157232704402514 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.38749999999999996 0.0 0.0 0.0 0.0 100-101 0.44999999999999996 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.5875 0.0 0.0 0.0 0.0 106-107 0.675 0.0 0.0 0.0 0.0 108-109 0.7625 0.0 0.0 0.0 0.0 110-111 0.8625 0.0 0.0 0.0 0.0 112-113 1.025 0.0 0.0 0.0 0.0 114-115 1.175 0.0 0.0 0.0 0.0 116-117 1.3250000000000002 0.0 0.0 0.0 0.0 118-119 1.4 0.0 0.0 0.0 0.0 120-121 1.5625 0.0 0.0 0.0 0.0 122-123 1.7374999999999998 0.0 0.0 0.0 0.0 124-125 1.875 0.0 0.0 0.0 0.0 126-127 2.1375 0.0 0.0 0.0 0.0 128-129 2.4000000000000004 0.0 0.0 0.0 0.0 130-131 2.6125 0.0 0.0 0.0 0.0 132-133 2.9125 0.0 0.0 0.0 0.0 134-135 3.2125 0.0 0.0 0.0 0.0 136-137 3.45 0.0 0.0 0.0 0.0 138-139 3.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 863468 spots for SRR7169623.sra Written 863468 spots for SRR7169623.sra Read 863468 spots for SRR7169623.sra Written 863468 spots for SRR7169623.sra Read 863468 spots for SRR7169623.sra Written 863468 spots for SRR7169623.sra Read 863468 spots for SRR7169623.sra Written 863468 spots for SRR7169623.sra Read 863468 spots for SRR7169623.sra Written 863468 spots for SRR7169623.sra Read 863468 spots for SRR7169623.sra Written 863468 spots for SRR7169623.sra Read 863468 spots for SRR7169623.sra Written 863468 spots for SRR7169623.sra Read 863468 spots for SRR7169623.sra Written 863468 spots for SRR7169623.sra Read 863468 spots for SRR7169623.sra Written 863468 spots for SRR7169623.sra Read 863475 spots for SRR7169623.sra Written 863475 spots for SRR7169623.sra Read 863468 spots for SRR7169623.sra Written 863468 spots for SRR7169623.sra Read 863468 spots for SRR7169623.sra Written 863468 spots for SRR7169623.sra Read 863468 spots for SRR7169623.sra Written 863468 spots for SRR7169623.sra Read 863468 spots for SRR7169623.sra Written 863468 spots for SRR7169623.sra Read 863468 spots for SRR7169623.sra Written 863468 spots for SRR7169623.sra Read 863468 spots for SRR7169623.sra Written 863468 spots for SRR7169623.sra Read 863468 spots for SRR7169623.sra Written 863468 spots for SRR7169623.sra Read 863468 spots for SRR7169623.sra Written 863468 spots for SRR7169623.sra Read 863468 spots for SRR7169623.sra Written 863468 spots for SRR7169623.sra Read 863468 spots for SRR7169623.sra Written 863468 spots for SRR7169623.sra SRR ids: ['SRR7169623.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yi3s7n0l SRR7169623.sra spots: 17269367 blocks: [[1, 863468], [863469, 1726936], [1726937, 2590404], [2590405, 3453872], [3453873, 4317340], [4317341, 5180808], [5180809, 6044276], [6044277, 6907744], [6907745, 7771212], [7771213, 8634680], [8634681, 9498148], [9498149, 10361616], [10361617, 11225084], [11225085, 12088552], [12088553, 12952020], [12952021, 13815488], [13815489, 14678956], [14678957, 15542424], [15542425, 16405892], [16405893, 17269367]] SRR7169623 file size 5830321 SRR7169623 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169623 SRR7169623_1.fastq SRR7169623_2.fastq Input file: SRR7169623_1.fastq Paired file: SRR7169623_2.fastq trimmed: SRR7169623-trimmed-pair1.fastq, SRR7169623-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:48:51 2025 >> started Tue Feb 11 10:49:09 2025 >> done (18.469s) 17269367 read pairs processed; of these: 25611 ( 0.15%) short read pairs filtered out after trimming by size control 62378 ( 0.36%) empty read pairs filtered out after trimming by size control 17181378 (99.49%) read pairs available; of these: 7099813 (41.32%) trimmed read pairs available after processing 10081565 (58.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 7 0.00% 20 7 0.00% 21 4 0.00% 22 5 0.00% 23 5 0.00% 24 6 0.00% 25 5 0.00% 26 7 0.00% 27 7 0.00% 28 10 0.00% 29 9 0.00% 30 9 0.00% 31 7 0.00% 32 7 0.00% 33 4 0.00% 34 13 0.00% 35 7 0.00% 36 12 0.00% 37 10 0.00% 38 10 0.00% 39 19 0.00% 40 14 0.00% 41 12 0.00% 42 15 0.00% 43 21 0.00% 44 14 0.00% 45 18 0.00% 46 25 0.00% 47 45 0.00% 48 39 0.00% 49 38 0.00% 50 35 0.00% 51 49 0.00% 52 63 0.00% 53 56 0.00% 54 67 0.00% 55 82 0.00% 56 89 0.00% 57 99 0.00% 58 94 0.00% 59 124 0.00% 60 110 0.00% 61 142 0.00% 62 170 0.00% 63 189 0.00% 64 193 0.00% 65 241 0.00% 66 317 0.00% 67 394 0.00% 68 604 0.00% 69 1495 0.01% 70 1667 0.01% 71 814 0.00% 72 655 0.00% 73 632 0.00% 74 710 0.00% 75 800 0.00% 76 782 0.00% 77 995 0.01% 78 1043 0.01% 79 1125 0.01% 80 1315 0.01% 81 1346 0.01% 82 1706 0.01% 83 1973 0.01% 84 3252 0.02% 85 4070 0.02% 86 4156 0.02% 87 4354 0.03% 88 4530 0.03% 89 4902 0.03% 90 5021 0.03% 91 5483 0.03% 92 5641 0.03% 93 6175 0.04% 94 6495 0.04% 95 7052 0.04% 96 7491 0.04% 97 7749 0.05% 98 8223 0.05% 99 8668 0.05% 100 9253 0.05% 101 9962 0.06% 102 10491 0.06% 103 11185 0.07% 104 11929 0.07% 105 12763 0.07% 106 13676 0.08% 107 13850 0.08% 108 14587 0.08% 109 15546 0.09% 110 16027 0.09% 111 17015 0.10% 112 18113 0.11% 113 19056 0.11% 114 20310 0.12% 115 21233 0.12% 116 22307 0.13% 117 23719 0.14% 118 24542 0.14% 119 25369 0.15% 120 26775 0.16% 121 27522 0.16% 122 29140 0.17% 123 30724 0.18% 124 32656 0.19% 125 34228 0.20% 126 36192 0.21% 127 37994 0.22% 128 39472 0.23% 129 41339 0.24% 130 43344 0.25% 131 45482 0.26% 132 48211 0.28% 133 51164 0.30% 134 54767 0.32% 135 59204 0.34% 136 62243 0.36% 137 66509 0.39% 138 72137 0.42% 139 76620 0.45% 140 81243 0.47% 141 88192 0.51% 142 96765 0.56% 143 108267 0.63% 144 125464 0.73% 145 147378 0.86% 146 181431 1.06% 147 244447 1.42% 148 364077 2.12% 149 701070 4.08% 150 3600971 20.96% 151 10081565 58.68% 17181378 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=42 prefix-density=0.20 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=253.01 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=16.9 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=3.24 fanout-score-rank=31 prefix-density=0.25 prefix-fanout=2.7 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.14 sequence-density-rank=13 fanout-score=38.08 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=11.0 sequence=TGTTGGTGGTGG SRR7169623 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:49:54 Started mapping on | Feb 11 10:49:54 Finished on | Feb 11 10:51:26 Mapping speed, Million of reads per hour | 672.31 Number of input reads | 17181378 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 16380930 Uniquely mapped reads % | 95.34% Average mapped length | 295.52 Number of splices: Total | 15251447 Number of splices: Annotated (sjdb) | 14995997 Number of splices: GT/AG | 15038518 Number of splices: GC/AG | 171725 Number of splices: AT/AC | 13053 Number of splices: Non-canonical | 28151 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.86 Insertion rate per base | 0.02% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 288160 % of reads mapped to multiple loci | 1.68% Number of reads mapped to too many loci | 21776 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.82% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 534270 534270 534270 N_multimapping 288160 288160 288160 N_noFeature 367775 16185720 453063 N_ambiguous 179133 952 68487 UnstrandedReadsAssigned:15834022 PositiveStrandReadsAssigned:194258 NegativeStrandReadsAssigned:15859380 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169623 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169623-trimmed-pair1.fastq SRR7169623-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,181,378 reads, 15,760,961 reads pseudoaligned [quant] estimated average fragment length: 251.779 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,153 rounds 52401 SRR7169623.ke.tsv 34699 SRR7169623.se.tsv 87100 total ==> SRR7169623.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1767.22 297 10.4692 Potri.005G024800.1.v4.1 1035 784.221 32 2.54191 Potri.004G059700.1.v4.1 961 710.261 3 0.263119 Potri.007G009000.2.v4.1 1416 1165.22 0 0 Potri.003G141000.2.v4.1 2943 2692.22 296 6.84904 Potri.016G087400.1.v4.1 270 73.6873 1535.61 1298.19 Potri.015G069301.1.v4.1 564 318.408 0 0 Potri.010G195200.1.v4.1 1773 1522.22 25 1.02308 Potri.012G127500.1.v4.1 977 726.25 5630 482.916 ==> SRR7169623.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2575 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 320 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 23 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169623 completed mapping pipeline successfully