Starting /dee2/code/volunteer_pipeline.sh SRR7169624 current disk space = 3053320945664 free memory = 1413817712 SRR7169624 SRAfilesize f6ca0443c0e37803297782ec3471ff06 SRR7169624.sra SRR7169624.sra file validated SRR7169624 is paired end SRR7169624 is conventional basespace SRR7169624 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169624_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.42575 34.0 33.0 34.0 32.0 34.0 2 33.1735 34.0 33.0 34.0 32.0 34.0 3 33.178 34.0 33.0 34.0 31.0 34.0 4 33.33675 34.0 33.0 34.0 33.0 34.0 5 33.22975 34.0 33.0 34.0 33.0 34.0 6 36.67125 38.0 37.0 38.0 34.0 38.0 7 36.99975 38.0 38.0 38.0 35.0 38.0 8 37.136 38.0 38.0 38.0 36.0 38.0 9 37.16225 38.0 38.0 38.0 36.0 38.0 10-14 37.255900000000004 38.0 38.0 38.0 36.8 38.0 15-19 37.2337 38.0 38.0 38.0 36.8 38.0 20-24 37.221050000000005 38.0 38.0 38.0 36.4 38.0 25-29 37.137299999999996 38.0 38.0 38.0 36.0 38.0 30-34 37.06275000000001 38.0 38.0 38.0 36.0 38.0 35-39 36.982800000000005 38.0 38.0 38.0 35.8 38.0 40-44 36.74185 38.0 38.0 38.0 34.6 38.0 45-49 36.5313 38.0 38.0 38.0 34.0 38.0 50-54 36.49235 38.0 37.8 38.0 34.0 38.0 55-59 36.36385 38.0 37.2 38.0 33.8 38.0 60-64 36.1982 38.0 37.2 38.0 33.4 38.0 65-69 36.088499999999996 38.0 37.0 38.0 33.0 38.0 70-74 35.985350000000004 38.0 37.0 38.0 32.4 38.0 75-79 35.7121 38.0 37.0 38.0 30.8 38.0 80-84 35.7472 38.0 37.0 38.0 31.0 38.0 85-89 35.66395 38.0 36.8 38.0 30.6 38.0 90-94 35.39905 38.0 36.0 38.0 29.4 38.0 95-99 35.116150000000005 38.0 36.0 38.0 28.6 38.0 100-104 34.797650000000004 38.0 35.6 38.0 27.6 38.0 105-109 34.7346 38.0 35.4 38.0 27.0 38.0 110-114 34.18205 38.0 34.8 38.0 23.0 38.0 115-119 33.9477 38.0 34.0 38.0 22.2 38.0 120-124 33.64115 38.0 34.0 38.0 19.4 38.0 125-129 33.3019 38.0 33.8 38.0 15.0 38.0 130-134 32.804 38.0 33.2 38.0 15.0 38.0 135-139 32.5106 37.4 33.0 38.0 14.8 38.0 140-144 31.888749999999998 36.6 31.8 38.0 14.0 38.0 145-149 30.256999999999998 35.8 28.6 38.0 6.4 38.0 150-151 26.725 34.5 15.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 3.0 10 2.0 11 1.0 12 5.0 13 2.0 14 6.0 15 5.0 16 6.0 17 10.0 18 6.0 19 15.0 20 17.0 21 6.0 22 11.0 23 23.0 24 23.0 25 19.0 26 34.0 27 36.0 28 49.0 29 50.0 30 76.0 31 97.0 32 128.0 33 184.0 34 263.0 35 460.0 36 1013.0 37 1449.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.54875225109339 12.528942629277076 10.367892976588628 35.554412143040906 2 24.099999999999998 13.850000000000001 30.825000000000003 31.225 3 20.1 17.325 25.974999999999998 36.6 4 24.2 25.525 23.599999999999998 26.674999999999997 5 23.325000000000003 30.825000000000003 23.75 22.1 6 19.925 33.900000000000006 25.0 21.175 7 14.625 28.725 39.25 17.4 8 18.525 27.425 29.2 24.85 9 17.025000000000002 25.15 34.0 23.825 10-14 19.725 29.909999999999997 27.42 22.945 15-19 19.61 28.935 27.66 23.794999999999998 20-24 19.89 28.92 27.529999999999998 23.66 25-29 19.82 28.96 27.224999999999998 23.995 30-34 19.765 28.54 27.37 24.325 35-39 19.985 28.634999999999998 27.1 24.279999999999998 40-44 19.725 28.67 27.815 23.79 45-49 20.185 28.310000000000002 27.96 23.544999999999998 50-54 19.830000000000002 28.355000000000004 27.63 24.185000000000002 55-59 19.455 28.310000000000002 28.04 24.195 60-64 20.32 27.925 27.43 24.325 65-69 19.885 28.060000000000002 27.505000000000003 24.55 70-74 19.794999999999998 28.27 27.779999999999998 24.154999999999998 75-79 19.61 28.93 27.439999999999998 24.02 80-84 19.994999999999997 28.955 27.025 24.025 85-89 20.585 28.32 27.145000000000003 23.95 90-94 20.044999999999998 29.054999999999996 27.465 23.435 95-99 19.900000000000002 28.194999999999997 27.584999999999997 24.32 100-104 20.334233963774643 27.85950165115581 28.229760832582805 23.57650355248674 105-109 20.62 27.985 27.48 23.915 110-114 20.620931397095642 28.808212318477715 27.290936404606907 23.27991987981973 115-119 20.843970566151075 28.70300845972869 26.700705811683434 23.7523151624368 120-124 20.24417091964375 28.374862403682577 27.619333533473434 23.76163314320024 125-129 20.372130245585954 27.81473515730506 28.254889211223926 23.55824538588506 130-134 20.66 28.24 27.560000000000002 23.54 135-139 20.41 28.425 27.275 23.89 140-144 20.395 28.139999999999997 27.12 24.345 145-149 21.115000000000002 28.134999999999998 26.825 23.925 150-151 19.787499999999998 28.0875 27.187499999999996 24.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 1.0 24 0.5 25 1.0 26 4.5 27 5.5 28 7.0 29 14.0 30 14.5 31 15.5 32 27.5 33 46.0 34 56.5 35 71.0 36 86.5 37 103.5 38 123.0 39 144.0 40 176.5 41 206.0 42 236.0 43 263.5 44 285.5 45 273.5 46 265.5 47 261.0 48 231.5 49 211.0 50 187.0 51 161.5 52 127.0 53 97.5 54 81.0 55 54.0 56 33.0 57 28.5 58 24.5 59 17.0 60 10.0 61 10.5 62 8.5 63 3.5 64 4.0 65 4.5 66 3.0 67 2.0 68 2.5 69 0.5 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.825 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.06999999999999999 105-109 0.0 110-114 0.15 115-119 0.11499999999999999 120-124 0.06999999999999999 125-129 0.034999999999999996 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.32499999999999996 0.0 0.0 0.0 0.0 104-105 0.3875 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.4875 0.0 0.0 0.0 0.0 112-113 0.5375000000000001 0.0 0.0 0.0 0.0 114-115 0.65 0.0 0.0 0.0 0.0 116-117 0.7749999999999999 0.0 0.0 0.0 0.0 118-119 0.9375 0.0 0.0 0.0 0.0 120-121 1.0499999999999998 0.0 0.0 0.0 0.0 122-123 1.1625 0.0 0.0 0.0 0.0 124-125 1.35 0.0 0.0 0.0 0.0 126-127 1.475 0.0 0.0 0.0 0.0 128-129 1.5375 0.0 0.0 0.0 0.0 130-131 1.7125 0.0 0.0 0.0 0.0 132-133 1.925 0.0 0.0 0.0 0.0 134-135 2.075 0.0 0.0 0.0 0.0 136-137 2.3625 0.0 0.0 0.0 0.0 138-139 2.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTAGGA 10 0.006832588 144.9875 7 ATTTTAA 10 0.006832588 144.9875 4 CTCTCAG 20 0.0059376103 28.9975 15-19 >>END_MODULE SRR7169624 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169624_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.352 33.0 33.0 34.0 32.0 34.0 2 32.74225 33.0 33.0 34.0 32.0 34.0 3 32.7435 33.0 33.0 34.0 32.0 34.0 4 32.593 34.0 33.0 34.0 32.0 34.0 5 32.546 34.0 33.0 34.0 32.0 34.0 6 36.72625 38.0 38.0 38.0 36.0 38.0 7 36.88175 38.0 38.0 38.0 36.0 38.0 8 36.7735 38.0 38.0 38.0 36.0 38.0 9 36.8515 38.0 38.0 38.0 36.0 38.0 10-14 36.76375 38.0 38.0 38.0 35.8 38.0 15-19 36.7132 38.0 38.0 38.0 36.0 38.0 20-24 36.71659999999999 38.0 38.0 38.0 36.0 38.0 25-29 36.707049999999995 38.0 38.0 38.0 36.0 38.0 30-34 36.63535 38.0 38.0 38.0 35.8 38.0 35-39 36.62779999999999 38.0 38.0 38.0 35.6 38.0 40-44 36.4822 38.0 38.0 38.0 35.0 38.0 45-49 36.46485 38.0 38.0 38.0 34.8 38.0 50-54 36.2074 38.0 38.0 38.0 34.6 38.0 55-59 35.90715 38.0 38.0 38.0 34.0 38.0 60-64 35.6389 38.0 38.0 38.0 33.0 38.0 65-69 35.52995 38.0 38.0 38.0 32.6 38.0 70-74 35.27305 38.0 38.0 38.0 31.0 38.0 75-79 35.20825 38.0 38.0 38.0 29.8 38.0 80-84 35.36825 38.0 38.0 38.0 31.2 38.0 85-89 35.31335 38.0 38.0 38.0 30.6 38.0 90-94 35.2232 38.0 37.6 38.0 30.2 38.0 95-99 35.048500000000004 38.0 37.4 38.0 28.8 38.0 100-104 34.8586 38.0 37.0 38.0 28.0 38.0 105-109 34.6295 38.0 36.8 38.0 26.4 38.0 110-114 34.552800000000005 38.0 36.6 38.0 25.8 38.0 115-119 34.4412 38.0 36.2 38.0 25.2 38.0 120-124 34.1017 38.0 36.0 38.0 22.2 38.0 125-129 33.9639 38.0 35.6 38.0 21.8 38.0 130-134 33.619299999999996 38.0 35.0 38.0 17.4 38.0 135-139 33.065000000000005 38.0 35.0 38.0 14.2 38.0 140-144 32.65304999999999 38.0 34.6 38.0 13.6 38.0 145-149 31.52975 38.0 33.2 38.0 2.0 38.0 150-151 27.929875 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 6.0 4 3.0 5 7.0 6 3.0 7 4.0 8 1.0 9 3.0 10 4.0 11 3.0 12 9.0 13 35.0 14 30.0 15 5.0 16 4.0 17 6.0 18 8.0 19 5.0 20 11.0 21 10.0 22 24.0 23 15.0 24 22.0 25 30.0 26 24.0 27 41.0 28 39.0 29 43.0 30 51.0 31 74.0 32 91.0 33 101.0 34 156.0 35 246.0 36 519.0 37 2349.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.68683812405446 22.894604135148764 15.330307614725164 25.08825012607161 2 29.049999999999997 26.474999999999998 26.55 17.925 3 21.025 28.7 30.525000000000002 19.75 4 23.625 33.0 23.775 19.6 5 24.175 34.75 22.675 18.4 6 21.4 37.525 22.1 18.975 7 20.849999999999998 22.825 36.75 19.575 8 23.0 26.275 26.55 24.175 9 21.975 24.675 29.525000000000002 23.825 10-14 23.464692938587717 28.910782156431285 26.5753150630126 21.049209841968395 15-19 23.305 28.395 26.889999999999997 21.41 20-24 23.064999999999998 27.839999999999996 28.060000000000002 21.035 25-29 23.52 27.72 27.634999999999998 21.125 30-34 23.165 28.455000000000002 27.565 20.815 35-39 23.285 28.33 27.944999999999997 20.44 40-44 23.325000000000003 28.470000000000002 27.35 20.855 45-49 23.775 27.694999999999997 27.71 20.82 50-54 23.478829327164842 28.080056321029872 28.12531429146133 20.31580006034396 55-59 23.504338559902575 27.25427513066423 28.258994265996858 20.98239204343634 60-64 23.723968966925277 28.496325030624746 27.24581461821152 20.533891384238466 65-69 23.985031781833094 27.563051055977034 27.563051055977034 20.888866106212838 70-74 24.10925146318924 27.934079474278672 27.492555703871034 20.464113358661056 75-79 23.58350028252941 27.487543021523603 28.211845687573845 20.71711100837314 80-84 23.89972429286225 27.851526600633104 27.62687634024303 20.621872766261614 85-89 24.145299145299145 28.01180301180301 27.904965404965402 19.93793243793244 90-94 24.5584652862363 27.050345107592367 27.826837190418193 20.564352415753145 95-99 24.177272957760763 27.924547436742557 27.736930175954566 20.161249429542114 100-104 24.584683954619123 27.583063209076176 27.572933549432737 20.25931928687196 105-109 24.088699878493316 27.61239368165249 27.242810854597003 21.05609558525719 110-114 24.121898216000403 28.260979430939503 27.70000505382322 19.91711729923687 115-119 24.399858492949917 28.30646383989488 27.326022135745692 19.967655531409513 120-124 24.621899576527525 27.616454930429523 27.621496269409157 20.140149223633795 125-129 24.34267186787578 27.590050154516437 27.894016920816654 20.173261056791127 130-134 24.624136529865908 28.509752133279154 27.0723283218204 19.79378301503454 135-139 24.25633960916373 27.991224042042962 27.05750293382315 20.69493341497015 140-144 24.08863473909936 28.377412437455323 27.28479526192178 20.249157561523536 145-149 24.892197125256672 28.480492813141684 27.089322381930188 19.53798767967146 150-151 24.47398993158642 28.591712921130764 26.965276881373434 19.969020265909386 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.5 19 2.0 20 3.5 21 4.0 22 9.5 23 10.0 24 6.5 25 9.0 26 8.5 27 9.5 28 13.0 29 12.0 30 13.5 31 17.5 32 20.0 33 25.5 34 36.5 35 63.5 36 86.0 37 107.5 38 133.0 39 151.0 40 170.0 41 214.5 42 249.5 43 262.5 44 276.0 45 267.5 46 279.5 47 283.0 48 247.5 49 212.5 50 178.5 51 149.5 52 118.0 53 90.5 54 65.0 55 45.0 56 35.5 57 25.5 58 19.5 59 14.5 60 13.0 61 9.5 62 6.5 63 6.0 64 4.0 65 2.5 66 2.5 67 1.5 68 0.5 69 1.0 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8500000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.02 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.5700000000000001 55-59 1.465 60-64 2.04 65-69 2.46 70-74 2.6100000000000003 75-79 2.665 80-84 2.07 85-89 1.72 90-94 1.48 95-99 1.395 100-104 1.28 105-109 1.24 110-114 1.065 115-119 1.065 120-124 0.8200000000000001 125-129 1.3050000000000002 130-134 1.5599999999999998 135-139 2.005 140-144 2.07 145-149 2.6 150-151 3.1625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.30000000000000004 0.0 0.0 0.0 0.0 104-105 0.3625 0.0 0.0 0.0 0.0 106-107 0.4125 0.0 0.0 0.0 0.0 108-109 0.44999999999999996 0.0 0.0 0.0 0.0 110-111 0.4875 0.0 0.0 0.0 0.0 112-113 0.5375000000000001 0.0 0.0 0.0 0.0 114-115 0.65 0.0 0.0 0.0 0.0 116-117 0.7749999999999999 0.0 0.0 0.0 0.0 118-119 0.95 0.0 0.0 0.0 0.0 120-121 1.0499999999999998 0.0 0.0 0.0 0.0 122-123 1.1625 0.0 0.0 0.0 0.0 124-125 1.35 0.0 0.0 0.0 0.0 126-127 1.4874999999999998 0.0 0.0 0.0 0.0 128-129 1.5625 0.0 0.0 0.0 0.0 130-131 1.7374999999999998 0.0 0.0 0.0 0.0 132-133 1.95 0.0 0.0 0.0 0.0 134-135 2.1125 0.0 0.0 0.0 0.0 136-137 2.3625 0.0 0.0 0.0 0.0 138-139 2.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 916711 spots for SRR7169624.sra Written 916711 spots for SRR7169624.sra Read 916711 spots for SRR7169624.sra Written 916711 spots for SRR7169624.sra Read 916711 spots for SRR7169624.sra Written 916711 spots for SRR7169624.sra Read 916711 spots for SRR7169624.sra Written 916711 spots for SRR7169624.sra Read 916711 spots for SRR7169624.sra Written 916711 spots for SRR7169624.sra Read 916711 spots for SRR7169624.sra Written 916711 spots for SRR7169624.sra Read 916711 spots for SRR7169624.sra Written 916711 spots for SRR7169624.sra Read 916711 spots for SRR7169624.sra Written 916711 spots for SRR7169624.sra Read 916711 spots for SRR7169624.sra Written 916711 spots for SRR7169624.sra Read 916711 spots for SRR7169624.sra Written 916711 spots for SRR7169624.sra Read 916711 spots for SRR7169624.sra Written 916711 spots for SRR7169624.sra Read 916711 spots for SRR7169624.sra Written 916711 spots for SRR7169624.sra Read 916711 spots for SRR7169624.sra Written 916711 spots for SRR7169624.sra Read 916711 spots for SRR7169624.sra Written 916711 spots for SRR7169624.sra Read 916711 spots for SRR7169624.sra Written 916711 spots for SRR7169624.sra Read 916711 spots for SRR7169624.sra Written 916711 spots for SRR7169624.sra Read 916711 spots for SRR7169624.sra Written 916711 spots for SRR7169624.sra Read 916726 spots for SRR7169624.sra Written 916726 spots for SRR7169624.sra Read 916711 spots for SRR7169624.sra Written 916711 spots for SRR7169624.sra Read 916711 spots for SRR7169624.sra Written 916711 spots for SRR7169624.sra SRR ids: ['SRR7169624.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0rqmp34_ SRR7169624.sra spots: 18334235 blocks: [[1, 916711], [916712, 1833422], [1833423, 2750133], [2750134, 3666844], [3666845, 4583555], [4583556, 5500266], [5500267, 6416977], [6416978, 7333688], [7333689, 8250399], [8250400, 9167110], [9167111, 10083821], [10083822, 11000532], [11000533, 11917243], [11917244, 12833954], [12833955, 13750665], [13750666, 14667376], [14667377, 15584087], [15584088, 16500798], [16500799, 17417509], [17417510, 18334235]] SRR7169624 file size 6191170 SRR7169624 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169624 SRR7169624_1.fastq SRR7169624_2.fastq Input file: SRR7169624_1.fastq Paired file: SRR7169624_2.fastq trimmed: SRR7169624-trimmed-pair1.fastq, SRR7169624-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:25:48 2025 >> started Tue Feb 11 10:26:20 2025 >> done (31.180s) 18334235 read pairs processed; of these: 31526 ( 0.17%) short read pairs filtered out after trimming by size control 37656 ( 0.21%) empty read pairs filtered out after trimming by size control 18265053 (99.62%) read pairs available; of these: 9677614 (52.98%) trimmed read pairs available after processing 8587439 (47.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 6 0.00% 21 3 0.00% 22 10 0.00% 23 5 0.00% 24 9 0.00% 25 5 0.00% 26 4 0.00% 27 6 0.00% 28 11 0.00% 29 9 0.00% 30 19 0.00% 31 16 0.00% 32 22 0.00% 33 19 0.00% 34 14 0.00% 35 15 0.00% 36 25 0.00% 37 31 0.00% 38 26 0.00% 39 25 0.00% 40 38 0.00% 41 40 0.00% 42 50 0.00% 43 40 0.00% 44 41 0.00% 45 48 0.00% 46 59 0.00% 47 64 0.00% 48 61 0.00% 49 90 0.00% 50 106 0.00% 51 88 0.00% 52 115 0.00% 53 129 0.00% 54 151 0.00% 55 145 0.00% 56 166 0.00% 57 188 0.00% 58 238 0.00% 59 228 0.00% 60 276 0.00% 61 291 0.00% 62 356 0.00% 63 388 0.00% 64 398 0.00% 65 468 0.00% 66 509 0.00% 67 654 0.00% 68 793 0.00% 69 896 0.00% 70 992 0.01% 71 1029 0.01% 72 1180 0.01% 73 1349 0.01% 74 1609 0.01% 75 1919 0.01% 76 1718 0.01% 77 1279 0.01% 78 1851 0.01% 79 3062 0.02% 80 5014 0.03% 81 1830 0.01% 82 2205 0.01% 83 2465 0.01% 84 3685 0.02% 85 4653 0.03% 86 5104 0.03% 87 5213 0.03% 88 5260 0.03% 89 5521 0.03% 90 5772 0.03% 91 6095 0.03% 92 6626 0.04% 93 7047 0.04% 94 7729 0.04% 95 8412 0.05% 96 9155 0.05% 97 10237 0.06% 98 12079 0.07% 99 16329 0.09% 100 19459 0.11% 101 13679 0.07% 102 11668 0.06% 103 11634 0.06% 104 12261 0.07% 105 13204 0.07% 106 13796 0.08% 107 14667 0.08% 108 15239 0.08% 109 16151 0.09% 110 16914 0.09% 111 17824 0.10% 112 19022 0.10% 113 20176 0.11% 114 21478 0.12% 115 22833 0.13% 116 24250 0.13% 117 25045 0.14% 118 26268 0.14% 119 27312 0.15% 120 28739 0.16% 121 30080 0.16% 122 32727 0.18% 123 33918 0.19% 124 36201 0.20% 125 38685 0.21% 126 41192 0.23% 127 43075 0.24% 128 46050 0.25% 129 48643 0.27% 130 51664 0.28% 131 54815 0.30% 132 59086 0.32% 133 63344 0.35% 134 68248 0.37% 135 74142 0.41% 136 80134 0.44% 137 87753 0.48% 138 96673 0.53% 139 107595 0.59% 140 118758 0.65% 141 130558 0.71% 142 147416 0.81% 143 169570 0.93% 144 200969 1.10% 145 246301 1.35% 146 310355 1.70% 147 426129 2.33% 148 643885 3.53% 149 1190161 6.52% 150 4454048 24.39% 151 8587439 47.02% 18265053 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=42 prefix-density=0.14 prefix-fanout=2.1 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.09 sequence-density-rank=13 fanout-score=276.07 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=29.2 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=34 prefix-density=0.33 prefix-fanout=2.2 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=12 fanout-score=272.39 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=29.7 sequence=AAGAAGAAGAAA SRR7169624 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:27:16 Started mapping on | Feb 11 10:27:16 Finished on | Feb 11 10:30:04 Mapping speed, Million of reads per hour | 391.39 Number of input reads | 18265053 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 16872013 Uniquely mapped reads % | 92.37% Average mapped length | 294.36 Number of splices: Total | 16338797 Number of splices: Annotated (sjdb) | 16059129 Number of splices: GT/AG | 16084944 Number of splices: GC/AG | 199709 Number of splices: AT/AC | 13399 Number of splices: Non-canonical | 40745 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 331146 % of reads mapped to multiple loci | 1.81% Number of reads mapped to too many loci | 262776 % of reads mapped to too many loci | 1.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.13% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1088551 1088551 1088551 N_multimapping 331146 331146 331146 N_noFeature 384466 16694013 471574 N_ambiguous 160093 1049 68485 UnstrandedReadsAssigned:16327454 PositiveStrandReadsAssigned:176951 NegativeStrandReadsAssigned:16331954 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169624 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169624-trimmed-pair1.fastq SRR7169624-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,265,053 reads, 16,423,932 reads pseudoaligned [quant] estimated average fragment length: 262.435 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,170 rounds 52401 SRR7169624.ke.tsv 34699 SRR7169624.se.tsv 87100 total ==> SRR7169624.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1756.57 273 9.02293 Potri.005G024800.1.v4.1 1035 773.565 48 3.60241 Potri.004G059700.1.v4.1 961 699.609 1 0.0829839 Potri.007G009000.2.v4.1 1416 1154.57 0 0 Potri.003G141000.2.v4.1 2943 2681.57 397.122 8.59776 Potri.016G087400.1.v4.1 270 69.3934 1595 1334.42 Potri.015G069301.1.v4.1 564 308.476 0 0 Potri.010G195200.1.v4.1 1773 1511.57 35 1.34428 Potri.012G127500.1.v4.1 977 715.584 10637 862.994 ==> SRR7169624.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1539 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 273 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169624 completed mapping pipeline successfully