Starting /dee2/code/volunteer_pipeline.sh SRR7169625 current disk space = 3051674017792 free memory = 1577662096 SRR7169625 SRAfilesize 91bd999e818983f0a61cda2f0628ab66 SRR7169625.sra SRR7169625.sra file validated SRR7169625 is paired end SRR7169625 is conventional basespace SRR7169625 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169625_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.668 34.0 33.0 34.0 32.0 34.0 2 33.26475 34.0 33.0 34.0 33.0 34.0 3 33.3025 34.0 34.0 34.0 33.0 34.0 4 33.372 34.0 34.0 34.0 33.0 34.0 5 33.36425 34.0 33.0 34.0 33.0 34.0 6 36.97 38.0 37.0 38.0 36.0 38.0 7 37.277 38.0 38.0 38.0 37.0 38.0 8 37.407 38.0 38.0 38.0 37.0 38.0 9 37.44975 38.0 38.0 38.0 37.0 38.0 10-14 37.4442 38.0 38.0 38.0 37.0 38.0 15-19 37.384499999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.3716 38.0 38.0 38.0 37.0 38.0 25-29 37.34355 38.0 38.0 38.0 37.0 38.0 30-34 37.331 38.0 38.0 38.0 37.0 38.0 35-39 37.24175 38.0 38.0 38.0 36.6 38.0 40-44 36.943999999999996 38.0 38.0 38.0 35.8 38.0 45-49 36.796 38.0 38.0 38.0 35.0 38.0 50-54 36.71035 38.0 38.0 38.0 34.6 38.0 55-59 36.64365 38.0 38.0 38.0 34.2 38.0 60-64 36.4945 38.0 38.0 38.0 34.0 38.0 65-69 36.4721 38.0 37.8 38.0 34.0 38.0 70-74 36.43150000000001 38.0 37.8 38.0 33.8 38.0 75-79 36.212450000000004 38.0 37.0 38.0 33.2 38.0 80-84 36.1147 38.0 37.0 38.0 33.0 38.0 85-89 35.97175 38.0 37.0 38.0 32.2 38.0 90-94 35.6778 38.0 37.0 38.0 31.0 38.0 95-99 35.686600000000006 38.0 37.0 38.0 31.0 38.0 100-104 35.31545 38.0 36.2 38.0 29.4 38.0 105-109 35.1352 38.0 36.0 38.0 29.0 38.0 110-114 34.6118 38.0 35.2 38.0 26.4 38.0 115-119 34.481399999999994 38.0 35.0 38.0 25.8 38.0 120-124 34.447 38.0 35.0 38.0 25.6 38.0 125-129 33.89205 38.0 34.0 38.0 22.6 38.0 130-134 33.6164 38.0 34.0 38.0 21.4 38.0 135-139 33.0303 38.0 34.0 38.0 15.0 38.0 140-144 32.5349 38.0 33.0 38.0 14.4 38.0 145-149 31.72585 36.8 32.8 38.0 11.2 38.0 150-151 27.875999999999998 35.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 0.0 11 0.0 12 2.0 13 4.0 14 0.0 15 0.0 16 4.0 17 8.0 18 3.0 19 13.0 20 14.0 21 14.0 22 20.0 23 11.0 24 22.0 25 19.0 26 23.0 27 38.0 28 48.0 29 52.0 30 45.0 31 78.0 32 99.0 33 146.0 34 214.0 35 377.0 36 936.0 37 1808.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.68511401486037 12.96438636945939 10.043556238790675 34.30694337688957 2 24.5 14.625 30.825000000000003 30.049999999999997 3 21.075 16.75 25.4 36.775000000000006 4 22.775000000000002 27.1 23.25 26.875 5 22.6 32.35 23.25 21.8 6 19.925 34.325 25.45 20.3 7 14.025000000000002 27.425 41.575 16.975 8 18.475 25.674999999999997 30.3 25.55 9 17.424999999999997 25.124999999999996 34.325 23.125 10-14 19.885 30.425 26.99 22.7 15-19 19.905 28.28 27.825 23.990000000000002 20-24 19.965 29.104999999999997 27.255000000000003 23.674999999999997 25-29 19.715 28.99 27.67 23.625 30-34 20.135 28.985 27.61 23.27 35-39 19.830000000000002 29.044999999999998 27.339999999999996 23.785 40-44 20.34 28.255000000000003 28.110000000000003 23.294999999999998 45-49 19.97 28.189999999999998 28.12 23.72 50-54 19.925 28.54 27.58 23.955000000000002 55-59 19.645000000000003 29.035 27.42 23.9 60-64 20.415 28.375 27.49 23.72 65-69 19.925 29.075 26.76 24.240000000000002 70-74 20.315 28.689999999999998 27.529999999999998 23.465 75-79 20.39 28.705000000000002 27.33 23.575 80-84 20.44 28.499999999999996 27.339999999999996 23.72 85-89 20.369999999999997 28.835 27.48 23.315 90-94 20.355 28.48 27.655 23.51 95-99 20.135 28.325 27.339999999999996 24.2 100-104 20.49997495115475 28.620810580632234 27.42848554681629 23.450728921396724 105-109 20.474999999999998 27.950000000000003 28.04 23.535 110-114 20.2768443753448 28.46180851597372 27.594162194693816 23.66718491398766 115-119 20.921151439299123 27.939924906132667 27.41927409261577 23.71964956195244 120-124 20.51063829787234 28.816020025031293 26.803504380475594 23.869837296620776 125-129 20.486632622409132 28.13657755081606 27.230399519375187 24.14639030739962 130-134 20.880000000000003 27.939999999999998 27.22 23.96 135-139 20.830000000000002 28.12 27.185 23.865 140-144 20.974999999999998 27.529999999999998 27.48 24.015 145-149 20.919999999999998 28.665000000000003 26.565 23.849999999999998 150-151 20.525 28.1375 26.6625 24.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 0.5 24 0.5 25 3.0 26 5.0 27 5.0 28 8.0 29 10.5 30 13.0 31 20.5 32 34.0 33 41.5 34 57.5 35 73.5 36 91.0 37 121.0 38 136.5 39 153.5 40 183.0 41 212.5 42 234.0 43 255.5 44 269.5 45 274.5 46 265.5 47 246.0 48 239.5 49 226.0 50 178.0 51 135.0 52 122.5 53 102.5 54 75.5 55 54.0 56 36.5 57 24.0 58 22.5 59 19.5 60 11.5 61 11.0 62 7.0 63 4.0 64 4.5 65 3.0 66 1.0 67 0.0 68 0.0 69 1.0 70 2.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.4250000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.19499999999999998 105-109 0.0 110-114 0.305 115-119 0.125 120-124 0.125 125-129 0.13 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.2125 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.425 0.0 0.0 0.0 0.0 102-103 0.525 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.925 0.0 0.0 0.0 0.0 110-111 1.1625 0.0 0.0 0.0 0.0 112-113 1.375 0.0 0.0 0.0 0.0 114-115 1.6 0.0 0.0 0.0 0.0 116-117 1.7125 0.0 0.0 0.0 0.0 118-119 1.8875000000000002 0.0 0.0 0.0 0.0 120-121 1.9500000000000002 0.0 0.0 0.0 0.0 122-123 1.9875 0.0 0.0 0.0 0.0 124-125 2.2125 0.0 0.0 0.0 0.0 126-127 2.375 0.0 0.0 0.0 0.0 128-129 2.6500000000000004 0.0 0.0 0.0 0.0 130-131 2.875 0.0 0.0 0.0 0.0 132-133 3.0375 0.0 0.0 0.0 0.0 134-135 3.325 0.0 0.0 0.0 0.0 136-137 3.6375 0.0 0.0 0.0 0.0 138-139 4.175000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169625 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169625_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.53325 33.0 33.0 34.0 32.0 34.0 2 32.8135 33.0 33.0 34.0 32.0 34.0 3 32.85725 34.0 33.0 34.0 32.0 34.0 4 32.85075 34.0 33.0 34.0 32.0 34.0 5 32.77575 34.0 33.0 34.0 32.0 34.0 6 36.869 38.0 38.0 38.0 36.0 38.0 7 37.0265 38.0 38.0 38.0 37.0 38.0 8 37.0255 38.0 38.0 38.0 37.0 38.0 9 37.0655 38.0 38.0 38.0 37.0 38.0 10-14 37.0024 38.0 38.0 38.0 36.6 38.0 15-19 36.89645 38.0 38.0 38.0 36.4 38.0 20-24 36.877399999999994 38.0 38.0 38.0 36.4 38.0 25-29 36.858349999999994 38.0 38.0 38.0 36.0 38.0 30-34 36.77545 38.0 38.0 38.0 36.0 38.0 35-39 36.7675 38.0 38.0 38.0 36.2 38.0 40-44 36.714099999999995 38.0 38.0 38.0 36.0 38.0 45-49 36.71975 38.0 38.0 38.0 36.0 38.0 50-54 36.4995 38.0 38.0 38.0 35.4 38.0 55-59 36.18425 38.0 38.0 38.0 34.8 38.0 60-64 36.014050000000005 38.0 38.0 38.0 34.2 38.0 65-69 35.81925 38.0 38.0 38.0 33.8 38.0 70-74 35.76 38.0 38.0 38.0 33.8 38.0 75-79 35.59835 38.0 38.0 38.0 33.2 38.0 80-84 35.7175 38.0 38.0 38.0 33.0 38.0 85-89 35.7037 38.0 38.0 38.0 32.6 38.0 90-94 35.6808 38.0 38.0 38.0 33.2 38.0 95-99 35.5201 38.0 38.0 38.0 31.4 38.0 100-104 35.336850000000005 38.0 38.0 38.0 29.8 38.0 105-109 35.2803 38.0 37.6 38.0 30.2 38.0 110-114 35.180099999999996 38.0 37.4 38.0 30.0 38.0 115-119 34.993050000000004 38.0 37.0 38.0 28.2 38.0 120-124 34.79195 38.0 37.0 38.0 27.2 38.0 125-129 34.4651 38.0 36.0 38.0 25.8 38.0 130-134 34.06335 38.0 35.8 38.0 23.0 38.0 135-139 33.54185 38.0 35.0 38.0 17.2 38.0 140-144 33.14345 38.0 35.0 38.0 14.2 38.0 145-149 32.2987 38.0 34.4 38.0 6.6 38.0 150-151 28.521124999999998 36.0 18.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 6.0 4 3.0 5 3.0 6 1.0 7 4.0 8 3.0 9 3.0 10 4.0 11 8.0 12 8.0 13 20.0 14 12.0 15 10.0 16 6.0 17 7.0 18 10.0 19 11.0 20 13.0 21 15.0 22 19.0 23 17.0 24 19.0 25 25.0 26 29.0 27 32.0 28 32.0 29 47.0 30 55.0 31 60.0 32 59.0 33 86.0 34 128.0 35 189.0 36 448.0 37 2600.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.19174635128334 22.546552591847004 13.688978359335682 26.57272269753397 2 29.125 26.25 27.85 16.775000000000002 3 20.974999999999998 27.975 30.2 20.849999999999998 4 24.275 32.375 23.275000000000002 20.075000000000003 5 25.525 35.025 21.9 17.549999999999997 6 21.5 37.15 22.725 18.625 7 20.7 22.175 38.025 19.1 8 23.35 24.875 26.775 25.0 9 22.025 25.35 31.125000000000004 21.5 10-14 23.695 28.735 26.505000000000003 21.065 15-19 23.415 27.439999999999998 27.68 21.465 20-24 23.515 28.144999999999996 27.47 20.87 25-29 23.24 28.27 27.584999999999997 20.905 30-34 23.26 28.125 27.794999999999998 20.82 35-39 23.555 28.249999999999996 27.43 20.765 40-44 23.330000000000002 28.24 27.529999999999998 20.9 45-49 23.275000000000002 28.355000000000004 27.98 20.39 50-54 23.369647070636077 28.199206787489334 27.95823083488127 20.472915306993322 55-59 23.610900449972192 27.49886242984984 28.408918549977248 20.481318570200717 60-64 23.418299989844623 27.881588301005383 28.389357164618666 20.310754544531328 65-69 23.747387736378002 27.182832968041186 28.564147000356797 20.505632295224018 70-74 23.553423818757015 27.83447290539851 27.492601285845495 21.11950198999898 75-79 23.802716225875624 27.734095782701928 28.035331359134076 20.427856632288368 80-84 23.67699339766379 27.369222955815136 28.20213306246826 20.75165058405282 85-89 24.15451599837991 28.103483191575535 27.33900364520049 20.402997164844066 90-94 24.084934277047523 27.730030333670374 27.75025278058645 20.434782608695652 95-99 23.686072367091164 28.365676167374165 27.546998180715587 20.40125328481908 100-104 23.9590684544813 28.147998790200624 27.371710857949388 20.521221897368687 105-109 23.88631324329772 27.615400120943356 28.310824430558355 20.187462205200564 110-114 24.267150196433967 27.178402337060543 27.666968872771232 20.88747859373426 115-119 24.519375943633616 27.413185707096126 27.53900352289884 20.528434826371413 120-124 24.128214159915462 28.113520857444772 27.192673476576257 20.5655915060635 125-129 24.238757814075417 27.913893930227868 27.455132083081267 20.392216172615445 130-134 24.64582068407205 27.82837482291034 26.98340416919652 20.542400323821088 135-139 24.67341025771362 28.424744573781325 27.118385604635797 19.78345956386926 140-144 23.75114457218435 28.43626004680028 27.17977413775562 20.63282124325974 145-149 24.637459150326798 28.21691176470588 27.02716503267974 20.11846405228758 150-151 24.634709048961806 27.390412714688537 28.18508074852602 19.789797487823634 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.5 18 2.5 19 2.5 20 2.0 21 3.5 22 3.5 23 3.5 24 7.0 25 8.5 26 7.0 27 6.0 28 10.5 29 12.0 30 12.0 31 20.0 32 24.5 33 26.0 34 39.5 35 59.5 36 78.5 37 104.5 38 129.5 39 155.0 40 197.0 41 220.0 42 252.0 43 280.5 44 268.0 45 279.5 46 272.5 47 256.5 48 249.0 49 220.5 50 187.0 51 146.5 52 104.0 53 88.5 54 74.5 55 49.0 56 38.0 57 25.5 58 18.5 59 15.0 60 9.0 61 7.0 62 7.0 63 5.0 64 2.5 65 2.5 66 2.5 67 1.0 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.65 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.40499999999999997 55-59 1.105 60-64 1.53 65-69 1.905 70-74 2.01 75-79 2.07 80-84 1.55 85-89 1.24 90-94 1.0999999999999999 95-99 1.06 100-104 0.8099999999999999 105-109 0.7799999999999999 110-114 0.73 115-119 0.65 120-124 0.635 125-129 0.8200000000000001 130-134 1.18 135-139 1.635 140-144 1.71 145-149 2.08 150-151 2.475 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.2125 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.425 0.0 0.0 0.0 0.0 102-103 0.525 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.8999999999999999 0.0 0.0 0.0 0.0 110-111 1.1375 0.0 0.0 0.0 0.0 112-113 1.325 0.0 0.0 0.0 0.0 114-115 1.575 0.0 0.0 0.0 0.0 116-117 1.6875 0.0 0.0 0.0 0.0 118-119 1.8875 0.0 0.0 0.0 0.0 120-121 1.975 0.0 0.0 0.0 0.0 122-123 2.0125 0.0 0.0 0.0 0.0 124-125 2.2375 0.0 0.0 0.0 0.0 126-127 2.375 0.0 0.0 0.0 0.0 128-129 2.6500000000000004 0.0 0.0 0.0 0.0 130-131 2.9125 0.0 0.0 0.0 0.0 132-133 3.125 0.0 0.0 0.0 0.0 134-135 3.4125 0.0 0.0 0.0 0.0 136-137 3.725 0.0 0.0 0.0 0.0 138-139 4.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATGTGT 10 0.00675075 145.52565 1 GGCCGTG 10 0.0072887 141.8875 8 GCCGTGG 10 0.0072887 141.8875 9 >>END_MODULE Read 745936 spots for SRR7169625.sra Written 745936 spots for SRR7169625.sra Read 745936 spots for SRR7169625.sra Written 745936 spots for SRR7169625.sra Read 745936 spots for SRR7169625.sra Written 745936 spots for SRR7169625.sra Read 745936 spots for SRR7169625.sra Written 745936 spots for SRR7169625.sra Read 745936 spots for SRR7169625.sra Written 745936 spots for SRR7169625.sra Read 745936 spots for SRR7169625.sra Written 745936 spots for SRR7169625.sra Read 745936 spots for SRR7169625.sra Written 745936 spots for SRR7169625.sra Read 745936 spots for SRR7169625.sra Written 745936 spots for SRR7169625.sra Read 745936 spots for SRR7169625.sra Written 745936 spots for SRR7169625.sra Read 745936 spots for SRR7169625.sra Written 745936 spots for SRR7169625.sra Read 745952 spots for SRR7169625.sra Written 745952 spots for SRR7169625.sra Read 745936 spots for SRR7169625.sra Written 745936 spots for SRR7169625.sra Read 745936 spots for SRR7169625.sra Written 745936 spots for SRR7169625.sra Read 745936 spots for SRR7169625.sra Written 745936 spots for SRR7169625.sra Read 745936 spots for SRR7169625.sra Written 745936 spots for SRR7169625.sra Read 745936 spots for SRR7169625.sra Written 745936 spots for SRR7169625.sra Read 745936 spots for SRR7169625.sra Written 745936 spots for SRR7169625.sra Read 745936 spots for SRR7169625.sra Written 745936 spots for SRR7169625.sra Read 745936 spots for SRR7169625.sra Written 745936 spots for SRR7169625.sra Read 745936 spots for SRR7169625.sra Written 745936 spots for SRR7169625.sra SRR ids: ['SRR7169625.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g45xo9f2 SRR7169625.sra spots: 14918736 blocks: [[1, 745936], [745937, 1491872], [1491873, 2237808], [2237809, 2983744], [2983745, 3729680], [3729681, 4475616], [4475617, 5221552], [5221553, 5967488], [5967489, 6713424], [6713425, 7459360], [7459361, 8205296], [8205297, 8951232], [8951233, 9697168], [9697169, 10443104], [10443105, 11189040], [11189041, 11934976], [11934977, 12680912], [12680913, 13426848], [13426849, 14172784], [14172785, 14918736]] SRR7169625 file size 5033769 SRR7169625 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169625 SRR7169625_1.fastq SRR7169625_2.fastq Input file: SRR7169625_1.fastq Paired file: SRR7169625_2.fastq trimmed: SRR7169625-trimmed-pair1.fastq, SRR7169625-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 11:35:13 2025 >> started Tue Feb 11 11:35:29 2025 >> done (16.227s) 14918736 read pairs processed; of these: 17484 ( 0.12%) short read pairs filtered out after trimming by size control 17596 ( 0.12%) empty read pairs filtered out after trimming by size control 14883656 (99.76%) read pairs available; of these: 7168008 (48.16%) trimmed read pairs available after processing 7715648 (51.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 10 0.00% 20 5 0.00% 21 2 0.00% 22 4 0.00% 23 9 0.00% 24 5 0.00% 25 2 0.00% 26 5 0.00% 27 14 0.00% 28 11 0.00% 29 6 0.00% 30 13 0.00% 31 7 0.00% 32 13 0.00% 33 15 0.00% 34 12 0.00% 35 14 0.00% 36 34 0.00% 37 15 0.00% 38 24 0.00% 39 20 0.00% 40 34 0.00% 41 23 0.00% 42 24 0.00% 43 34 0.00% 44 37 0.00% 45 34 0.00% 46 44 0.00% 47 71 0.00% 48 67 0.00% 49 70 0.00% 50 67 0.00% 51 85 0.00% 52 88 0.00% 53 97 0.00% 54 108 0.00% 55 147 0.00% 56 126 0.00% 57 162 0.00% 58 174 0.00% 59 211 0.00% 60 224 0.00% 61 264 0.00% 62 284 0.00% 63 348 0.00% 64 389 0.00% 65 461 0.00% 66 451 0.00% 67 615 0.00% 68 699 0.00% 69 1109 0.01% 70 1245 0.01% 71 1120 0.01% 72 1259 0.01% 73 1405 0.01% 74 1679 0.01% 75 2419 0.02% 76 1929 0.01% 77 1241 0.01% 78 1489 0.01% 79 2522 0.02% 80 4420 0.03% 81 1869 0.01% 82 2217 0.01% 83 2460 0.02% 84 3304 0.02% 85 4218 0.03% 86 4635 0.03% 87 4885 0.03% 88 4816 0.03% 89 4987 0.03% 90 5323 0.04% 91 5879 0.04% 92 6258 0.04% 93 6951 0.05% 94 7391 0.05% 95 8081 0.05% 96 8892 0.06% 97 10178 0.07% 98 11895 0.08% 99 16927 0.11% 100 20618 0.14% 101 13539 0.09% 102 10929 0.07% 103 11307 0.08% 104 11759 0.08% 105 12788 0.09% 106 13658 0.09% 107 14021 0.09% 108 14510 0.10% 109 15285 0.10% 110 15949 0.11% 111 16868 0.11% 112 17966 0.12% 113 19194 0.13% 114 19759 0.13% 115 21047 0.14% 116 22064 0.15% 117 23059 0.15% 118 24067 0.16% 119 24791 0.17% 120 25986 0.17% 121 27162 0.18% 122 28653 0.19% 123 30377 0.20% 124 32005 0.22% 125 33573 0.23% 126 35664 0.24% 127 37658 0.25% 128 39249 0.26% 129 41526 0.28% 130 43604 0.29% 131 45532 0.31% 132 48234 0.32% 133 51458 0.35% 134 54678 0.37% 135 58308 0.39% 136 62582 0.42% 137 67479 0.45% 138 72892 0.49% 139 79523 0.53% 140 85657 0.58% 141 93732 0.63% 142 103764 0.70% 143 114640 0.77% 144 134181 0.90% 145 160212 1.08% 146 201405 1.35% 147 273449 1.84% 148 409782 2.75% 149 784167 5.27% 150 3399014 22.84% 151 7715648 51.84% 14883656 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=2.95 fanout-score-rank=35 prefix-density=0.16 prefix-fanout=2.6 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.09 sequence-density-rank=18 fanout-score=289.27 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=29.8 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.70 fanout-score-rank=41 prefix-density=0.32 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=11 fanout-score=287.07 fanout-score-rank=1 prefix-density=0.98 prefix-fanout=30.1 sequence=AAGAAGAAGAAA SRR7169625 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 11:36:25 Started mapping on | Feb 11 11:36:25 Finished on | Feb 11 11:37:51 Mapping speed, Million of reads per hour | 623.04 Number of input reads | 14883656 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 14145683 Uniquely mapped reads % | 95.04% Average mapped length | 294.14 Number of splices: Total | 13287447 Number of splices: Annotated (sjdb) | 13053533 Number of splices: GT/AG | 13083425 Number of splices: GC/AG | 157860 Number of splices: AT/AC | 11409 Number of splices: Non-canonical | 34753 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 260839 % of reads mapped to multiple loci | 1.75% Number of reads mapped to too many loci | 20368 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.04% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 494711 494711 494711 N_multimapping 260839 260839 260839 N_noFeature 322958 13977934 404504 N_ambiguous 145458 821 58743 UnstrandedReadsAssigned:13677267 PositiveStrandReadsAssigned:166928 NegativeStrandReadsAssigned:13682436 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169625 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169625-trimmed-pair1.fastq SRR7169625-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,883,656 reads, 13,605,962 reads pseudoaligned [quant] estimated average fragment length: 248.845 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,146 rounds 52401 SRR7169625.ke.tsv 34699 SRR7169625.se.tsv 87100 total ==> SRR7169625.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1770.16 218 8.44811 Potri.005G024800.1.v4.1 1035 787.155 32 2.78871 Potri.004G059700.1.v4.1 961 713.193 3 0.288555 Potri.007G009000.2.v4.1 1416 1168.16 0 0 Potri.003G141000.2.v4.1 2943 2695.16 241.032 6.13486 Potri.016G087400.1.v4.1 270 75.7616 1351 1223.27 Potri.015G069301.1.v4.1 564 321.872 0 0 Potri.010G195200.1.v4.1 1773 1525.16 27 1.21441 Potri.012G127500.1.v4.1 977 729.168 6000 564.466 ==> SRR7169625.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1179 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 223 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169625 completed mapping pipeline successfully