Starting /dee2/code/volunteer_pipeline.sh SRR7169626 current disk space = 3052639272960 free memory = 1229372208 SRR7169626 SRAfilesize 4c99ae460d8892781bb2eea55f65f8a1 SRR7169626.sra SRR7169626.sra file validated SRR7169626 is paired end SRR7169626 is conventional basespace SRR7169626 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169626_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8775 34.0 33.0 34.0 33.0 34.0 2 33.38775 34.0 34.0 34.0 33.0 34.0 3 33.483 34.0 34.0 34.0 33.0 34.0 4 33.55075 34.0 34.0 34.0 33.0 34.0 5 33.5635 34.0 34.0 34.0 33.0 34.0 6 37.0155 38.0 37.0 38.0 36.0 38.0 7 37.34725 38.0 38.0 38.0 37.0 38.0 8 37.4335 38.0 38.0 38.0 37.0 38.0 9 37.53 38.0 38.0 38.0 38.0 38.0 10-14 37.4823 38.0 38.0 38.0 37.2 38.0 15-19 37.4605 38.0 38.0 38.0 37.0 38.0 20-24 37.4799 38.0 38.0 38.0 37.2 38.0 25-29 37.460950000000004 38.0 38.0 38.0 37.2 38.0 30-34 37.43815000000001 38.0 38.0 38.0 37.0 38.0 35-39 37.19415 38.0 38.0 38.0 36.4 38.0 40-44 37.26955 38.0 38.0 38.0 37.0 38.0 45-49 37.2337 38.0 38.0 38.0 36.6 38.0 50-54 37.10605 38.0 38.0 38.0 36.0 38.0 55-59 37.0995 38.0 38.0 38.0 36.0 38.0 60-64 37.053000000000004 38.0 38.0 38.0 36.0 38.0 65-69 37.02695 38.0 38.0 38.0 36.0 38.0 70-74 36.95895 38.0 38.0 38.0 35.8 38.0 75-79 36.932900000000004 38.0 38.0 38.0 35.4 38.0 80-84 36.83235 38.0 38.0 38.0 35.0 38.0 85-89 36.7988 38.0 38.0 38.0 35.0 38.0 90-94 36.7319 38.0 38.0 38.0 34.8 38.0 95-99 36.57234999999999 38.0 38.0 38.0 34.4 38.0 100-104 36.443 38.0 38.0 38.0 34.0 38.0 105-109 36.36535 38.0 38.0 38.0 34.0 38.0 110-114 36.20265 38.0 37.2 38.0 33.4 38.0 115-119 35.9123 38.0 37.0 38.0 32.6 38.0 120-124 35.7678 38.0 36.8 38.0 31.4 38.0 125-129 35.64375 38.0 36.2 38.0 31.0 38.0 130-134 35.43065 38.0 36.0 38.0 30.6 38.0 135-139 35.177049999999994 38.0 36.0 38.0 29.6 38.0 140-144 34.6154 38.0 35.0 38.0 27.4 38.0 145-149 33.89565 38.0 35.0 38.0 23.4 38.0 150-151 30.766125000000002 36.5 31.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 2.0 12 1.0 13 0.0 14 0.0 15 0.0 16 2.0 17 1.0 18 1.0 19 1.0 20 5.0 21 2.0 22 14.0 23 7.0 24 8.0 25 10.0 26 22.0 27 22.0 28 26.0 29 27.0 30 40.0 31 54.0 32 71.0 33 87.0 34 135.0 35 253.0 36 651.0 37 2557.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.06369426751592 13.044585987261145 8.636942675159236 36.254777070063696 2 23.775 14.124999999999998 32.05 30.049999999999997 3 20.200000000000003 16.825000000000003 25.55 37.425000000000004 4 22.075 26.674999999999997 23.575 27.675 5 23.575 30.4 24.075 21.95 6 20.025000000000002 34.2 23.95 21.825 7 14.124999999999998 28.425 39.65 17.8 8 17.599999999999998 27.55 30.049999999999997 24.8 9 16.900000000000002 25.8 33.125 24.175 10-14 19.49 30.135 26.935 23.44 15-19 19.485 28.64 28.02 23.855 20-24 19.485 28.685 27.49 24.34 25-29 19.08 29.37 27.139999999999997 24.41 30-34 20.015 29.23 27.1 23.655 35-39 19.741909668383933 29.775421397489122 26.544290501675587 23.93837843245136 40-44 19.580000000000002 29.325000000000003 26.88 24.215 45-49 20.07 29.160000000000004 27.13 23.64 50-54 19.794999999999998 28.865000000000002 27.21 24.13 55-59 20.205000000000002 28.875 27.060000000000002 23.86 60-64 19.61 28.98 27.61 23.799999999999997 65-69 19.49 28.325 27.83 24.355 70-74 20.085 28.625 26.924999999999997 24.365000000000002 75-79 19.89 29.044999999999998 27.139999999999997 23.925 80-84 20.865000000000002 28.76 26.695 23.68 85-89 20.005 28.395 27.42 24.18 90-94 19.885 28.57 27.275 24.27 95-99 20.335 29.110000000000003 26.69 23.865 100-104 20.25 28.560000000000002 27.185 24.005000000000003 105-109 20.385 27.865000000000002 26.945000000000004 24.805 110-114 19.74 28.64 27.265 24.355 115-119 20.685000000000002 27.744999999999997 27.805000000000003 23.765 120-124 20.75 28.470000000000002 27.185 23.595 125-129 20.565 28.07 27.474999999999998 23.89 130-134 20.93 28.235 26.86 23.974999999999998 135-139 20.830000000000002 27.750000000000004 27.845 23.575 140-144 20.630000000000003 28.634999999999998 26.955000000000002 23.78 145-149 21.63 27.825 26.590000000000003 23.955000000000002 150-151 21.512500000000003 27.6125 26.724999999999998 24.15 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 2.0 24 1.5 25 1.5 26 2.5 27 3.5 28 9.5 29 13.5 30 15.5 31 21.0 32 32.0 33 41.5 34 52.0 35 72.5 36 95.0 37 101.0 38 128.5 39 164.5 40 175.0 41 205.0 42 250.0 43 256.0 44 248.5 45 263.5 46 271.0 47 255.5 48 240.0 49 206.0 50 174.5 51 158.5 52 131.5 53 111.5 54 84.5 55 55.5 56 37.0 57 37.5 58 28.5 59 10.5 60 6.5 61 7.5 62 9.0 63 6.0 64 3.0 65 3.0 66 2.0 67 1.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.875 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.034999999999999996 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.36250000000000004 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.55 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.7 0.0 0.0 0.0 0.0 108-109 0.7875 0.0 0.0 0.0 0.0 110-111 0.975 0.0 0.0 0.0 0.0 112-113 1.0499999999999998 0.0 0.0 0.0 0.0 114-115 1.2375 0.0 0.0 0.0 0.0 116-117 1.5125 0.0 0.0 0.0 0.0 118-119 1.75 0.0 0.0 0.0 0.0 120-121 2.075 0.0 0.0 0.0 0.0 122-123 2.2750000000000004 0.0 0.0 0.0 0.0 124-125 2.5 0.0 0.0 0.0 0.0 126-127 2.7625 0.0 0.0 0.0 0.0 128-129 3.1624999999999996 0.0 0.0 0.0 0.0 130-131 3.55 0.0 0.0 0.0 0.0 132-133 4.0125 0.0 0.0 0.0 0.0 134-135 4.3375 0.0 0.0 0.0 0.0 136-137 4.7875 0.0 0.0 0.0 0.0 138-139 5.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCATAC 10 0.006577216 146.82278 1 >>END_MODULE SRR7169626 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169626_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.99275 33.0 33.0 34.0 32.0 34.0 2 33.061 34.0 33.0 34.0 32.0 34.0 3 33.1045 34.0 33.0 34.0 33.0 34.0 4 33.12675 34.0 33.0 34.0 33.0 34.0 5 33.0385 34.0 33.0 34.0 33.0 34.0 6 37.26625 38.0 38.0 38.0 37.0 38.0 7 37.35475 38.0 38.0 38.0 37.0 38.0 8 37.2785 38.0 38.0 38.0 37.0 38.0 9 37.215 38.0 38.0 38.0 37.0 38.0 10-14 37.21255 38.0 38.0 38.0 37.0 38.0 15-19 37.14015 38.0 38.0 38.0 37.0 38.0 20-24 37.10235 38.0 38.0 38.0 37.0 38.0 25-29 37.1153 38.0 38.0 38.0 37.0 38.0 30-34 37.040549999999996 38.0 38.0 38.0 36.8 38.0 35-39 36.96785 38.0 38.0 38.0 36.6 38.0 40-44 36.9873 38.0 38.0 38.0 36.8 38.0 45-49 37.0432 38.0 38.0 38.0 37.0 38.0 50-54 37.02785 38.0 38.0 38.0 36.8 38.0 55-59 36.7982 38.0 38.0 38.0 35.8 38.0 60-64 36.9045 38.0 38.0 38.0 36.0 38.0 65-69 36.85875 38.0 38.0 38.0 36.0 38.0 70-74 36.76854999999999 38.0 38.0 38.0 36.0 38.0 75-79 36.6897 38.0 38.0 38.0 35.6 38.0 80-84 36.61005 38.0 38.0 38.0 35.2 38.0 85-89 36.468 38.0 38.0 38.0 34.8 38.0 90-94 36.440450000000006 38.0 38.0 38.0 34.6 38.0 95-99 36.40185 38.0 38.0 38.0 34.4 38.0 100-104 36.33845 38.0 38.0 38.0 34.2 38.0 105-109 36.218599999999995 38.0 38.0 38.0 34.0 38.0 110-114 36.064 38.0 38.0 38.0 34.0 38.0 115-119 35.89015 38.0 38.0 38.0 33.2 38.0 120-124 35.7032 38.0 37.4 38.0 32.0 38.0 125-129 35.278299999999994 38.0 36.8 38.0 30.6 38.0 130-134 35.19525 38.0 36.2 38.0 30.4 38.0 135-139 34.756150000000005 38.0 36.0 38.0 28.0 38.0 140-144 34.275400000000005 38.0 35.0 38.0 24.8 38.0 145-149 33.8229 38.0 35.2 38.0 22.0 38.0 150-151 30.186 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 10.0 4 1.0 5 2.0 6 0.0 7 2.0 8 2.0 9 2.0 10 1.0 11 2.0 12 3.0 13 2.0 14 3.0 15 3.0 16 6.0 17 6.0 18 4.0 19 3.0 20 8.0 21 8.0 22 5.0 23 13.0 24 9.0 25 18.0 26 21.0 27 21.0 28 26.0 29 33.0 30 32.0 31 56.0 32 66.0 33 78.0 34 128.0 35 187.0 36 484.0 37 2752.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.625 21.9 14.149999999999999 27.325 2 29.475 25.974999999999998 27.900000000000002 16.650000000000002 3 21.4 27.975 32.0 18.625 4 24.55 33.7 22.85 18.9 5 23.95 36.199999999999996 21.8 18.05 6 21.65206508135169 37.246558197747184 23.028785982478098 18.072590738423028 7 19.57936905358037 22.658988482724084 38.332498748122184 19.42914371557336 8 22.5531914893617 24.90613266583229 27.384230287859822 25.15644555694618 9 21.076345431789736 26.082603254067582 30.137672090112638 22.703379224030037 10-14 24.329060684958943 28.334668535950332 26.416983777288205 20.919287001802523 15-19 23.810954240512665 27.901271653149095 27.400620807049165 20.88715329928908 20-24 23.261402893906773 28.568567566214387 26.976418164522105 21.19361137535673 25-29 23.517925095133187 28.114360104145803 27.443420789104746 20.92429401161626 30-34 23.328826798858344 28.31605828451254 27.3997296079315 20.95538530869761 35-39 23.43546610593772 28.582156803845 27.1302693501552 20.85210774006208 40-44 23.71964956195244 28.11013767209011 27.173967459324157 20.99624530663329 45-49 23.963963963963963 28.10810810810811 27.312312312312315 20.615615615615614 50-54 24.245759743833492 28.443488267373795 26.96752889378096 20.34322309501176 55-59 23.596517562293606 28.184729310517366 27.444210947663368 20.774542179525668 60-64 23.742555427656274 27.751363795605826 28.196786947600224 20.30929382913768 65-69 23.233233233233232 27.52752752752753 28.433433433433436 20.805805805805804 70-74 24.267908094308453 27.70686289232617 27.63177654302448 20.393452470340893 75-79 23.653384060873048 27.397877452943533 28.504205046055265 20.444533440128154 80-84 23.491713813648428 27.987783507735443 27.842587493115705 20.677915185500424 85-89 24.127397466072413 28.01842856427463 27.557714457408984 20.296459512243977 90-94 23.83575363044567 27.936905358037055 27.806710065097644 20.420630946419628 95-99 24.553236221654902 27.36647144215848 27.74690894528708 20.333383390899535 100-104 24.87238514663197 27.42968671804624 27.31458312481233 20.38334501050946 105-109 23.92816048826855 27.785281905047775 27.765270898994448 20.521286707689228 110-114 23.79522594205074 27.76860331281589 28.284041435219937 20.152129309913427 115-119 24.02161945751176 27.78500650585527 27.900110099089183 20.29326393754379 120-124 24.587128415574018 27.734961465318786 27.569812831548397 20.108097287558802 125-129 24.79603583762951 28.30972521147205 27.113469142599726 19.780769808298714 130-134 24.434434434434436 27.982982982982985 27.117117117117118 20.465465465465467 135-139 25.136420525657073 28.355444305381727 26.413016270337923 20.09511889862328 140-144 25.2076869182264 28.000200180162143 26.714042638374536 20.078070263236913 145-149 25.427713856928463 27.973986993496748 26.738369184592298 19.85992996498249 150-151 25.331332833208304 27.04426106526632 27.881970492623154 19.742435608902227 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 1.5 24 1.0 25 1.5 26 1.5 27 1.5 28 4.0 29 6.0 30 5.5 31 7.5 32 17.5 33 31.0 34 38.0 35 41.5 36 57.5 37 88.0 38 125.0 39 158.0 40 188.5 41 228.0 42 262.5 43 286.5 44 309.0 45 310.5 46 301.0 47 277.0 48 244.5 49 223.5 50 191.0 51 150.0 52 112.0 53 82.0 54 61.5 55 50.0 56 36.5 57 27.0 58 21.0 59 14.0 60 10.5 61 7.0 62 3.5 63 1.0 64 2.5 65 2.0 66 0.5 67 1.0 68 1.0 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.125 7 0.15 8 0.125 9 0.125 10-14 0.13999999999999999 15-19 0.13 20-24 0.135 25-29 0.13999999999999999 30-34 0.145 35-39 0.13 40-44 0.125 45-49 0.1 50-54 0.065 55-59 0.06999999999999999 60-64 0.095 65-69 0.1 70-74 0.11499999999999999 75-79 0.12 80-84 0.135 85-89 0.155 90-94 0.15 95-99 0.11499999999999999 100-104 0.09 105-109 0.055 110-114 0.08499999999999999 115-119 0.09 120-124 0.09 125-129 0.105 130-134 0.1 135-139 0.125 140-144 0.09 145-149 0.05 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42152917505031 98.825 2 0.5533199195171026 1.0999999999999999 3 0.025150905432595575 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.38749999999999996 0.0 0.0 0.0 0.0 100-101 0.4625 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.75 0.0 0.0 0.0 0.0 108-109 0.825 0.0 0.0 0.0 0.0 110-111 1.025 0.0 0.0 0.0 0.0 112-113 1.1 0.0 0.0 0.0 0.0 114-115 1.3125 0.0 0.0 0.0 0.0 116-117 1.5875 0.0 0.0 0.0 0.0 118-119 1.875 0.0 0.0 0.0 0.0 120-121 2.2 0.0 0.0 0.0 0.0 122-123 2.4000000000000004 0.0 0.0 0.0 0.0 124-125 2.6500000000000004 0.0 0.0 0.0 0.0 126-127 2.8875 0.0 0.0 0.0 0.0 128-129 3.2874999999999996 0.0 0.0 0.0 0.0 130-131 3.65 0.0 0.0 0.0 0.0 132-133 4.0875 0.0 0.0 0.0 0.0 134-135 4.387499999999999 0.0 0.0 0.0 0.0 136-137 4.875 0.0 0.0 0.0 0.0 138-139 5.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 916815 spots for SRR7169626.sra Written 916815 spots for SRR7169626.sra Read 916815 spots for SRR7169626.sra Written 916815 spots for SRR7169626.sra Read 916815 spots for SRR7169626.sra Written 916815 spots for SRR7169626.sra Read 916815 spots for SRR7169626.sra Written 916815 spots for SRR7169626.sra Read 916815 spots for SRR7169626.sra Written 916815 spots for SRR7169626.sra Read 916815 spots for SRR7169626.sra Written 916815 spots for SRR7169626.sra Read 916815 spots for SRR7169626.sra Written 916815 spots for SRR7169626.sra Read 916815 spots for SRR7169626.sra Written 916815 spots for SRR7169626.sra Read 916826 spots for SRR7169626.sra Written 916826 spots for SRR7169626.sra Read 916815 spots for SRR7169626.sra Written 916815 spots for SRR7169626.sra Read 916815 spots for SRR7169626.sra Written 916815 spots for SRR7169626.sra Read 916815 spots for SRR7169626.sra Written 916815 spots for SRR7169626.sra Read 916815 spots for SRR7169626.sra Written 916815 spots for SRR7169626.sra Read 916815 spots for SRR7169626.sra Written 916815 spots for SRR7169626.sra Read 916815 spots for SRR7169626.sra Written 916815 spots for SRR7169626.sra Read 916815 spots for SRR7169626.sra Written 916815 spots for SRR7169626.sra Read 916815 spots for SRR7169626.sra Written 916815 spots for SRR7169626.sra Read 916815 spots for SRR7169626.sra Written 916815 spots for SRR7169626.sra Read 916815 spots for SRR7169626.sra Written 916815 spots for SRR7169626.sra Read 916815 spots for SRR7169626.sra Written 916815 spots for SRR7169626.sra SRR ids: ['SRR7169626.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0z4o39lk SRR7169626.sra spots: 18336311 blocks: [[1, 916815], [916816, 1833630], [1833631, 2750445], [2750446, 3667260], [3667261, 4584075], [4584076, 5500890], [5500891, 6417705], [6417706, 7334520], [7334521, 8251335], [8251336, 9168150], [9168151, 10084965], [10084966, 11001780], [11001781, 11918595], [11918596, 12835410], [12835411, 13752225], [13752226, 14669040], [14669041, 15585855], [15585856, 16502670], [16502671, 17419485], [17419486, 18336311]] SRR7169626 file size 6191873 SRR7169626 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169626 SRR7169626_1.fastq SRR7169626_2.fastq Input file: SRR7169626_1.fastq Paired file: SRR7169626_2.fastq trimmed: SRR7169626-trimmed-pair1.fastq, SRR7169626-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:59:10 2025 >> started Tue Feb 11 10:59:30 2025 >> done (20.396s) 18336311 read pairs processed; of these: 37765 ( 0.21%) short read pairs filtered out after trimming by size control 37476 ( 0.20%) empty read pairs filtered out after trimming by size control 18261070 (99.59%) read pairs available; of these: 8561481 (46.88%) trimmed read pairs available after processing 9699589 (53.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 3 0.00% 21 5 0.00% 22 9 0.00% 23 4 0.00% 24 5 0.00% 25 7 0.00% 26 4 0.00% 27 6 0.00% 28 3 0.00% 29 5 0.00% 30 10 0.00% 31 8 0.00% 32 6 0.00% 33 12 0.00% 34 7 0.00% 35 16 0.00% 36 10 0.00% 37 15 0.00% 38 14 0.00% 39 13 0.00% 40 26 0.00% 41 26 0.00% 42 18 0.00% 43 24 0.00% 44 31 0.00% 45 24 0.00% 46 34 0.00% 47 44 0.00% 48 38 0.00% 49 52 0.00% 50 44 0.00% 51 65 0.00% 52 73 0.00% 53 87 0.00% 54 76 0.00% 55 97 0.00% 56 112 0.00% 57 135 0.00% 58 119 0.00% 59 169 0.00% 60 171 0.00% 61 198 0.00% 62 250 0.00% 63 224 0.00% 64 314 0.00% 65 326 0.00% 66 401 0.00% 67 483 0.00% 68 543 0.00% 69 1023 0.01% 70 1642 0.01% 71 1300 0.01% 72 1029 0.01% 73 996 0.01% 74 1077 0.01% 75 1187 0.01% 76 1282 0.01% 77 1392 0.01% 78 1674 0.01% 79 1773 0.01% 80 1966 0.01% 81 2165 0.01% 82 2655 0.01% 83 3081 0.02% 84 4151 0.02% 85 4877 0.03% 86 4944 0.03% 87 5425 0.03% 88 5840 0.03% 89 6195 0.03% 90 6637 0.04% 91 7233 0.04% 92 7930 0.04% 93 8477 0.05% 94 9220 0.05% 95 9491 0.05% 96 10047 0.06% 97 10708 0.06% 98 11232 0.06% 99 12027 0.07% 100 12618 0.07% 101 13330 0.07% 102 14162 0.08% 103 15245 0.08% 104 16253 0.09% 105 17428 0.10% 106 18220 0.10% 107 18802 0.10% 108 19800 0.11% 109 20722 0.11% 110 21747 0.12% 111 22775 0.12% 112 23876 0.13% 113 25196 0.14% 114 26094 0.14% 115 27945 0.15% 116 29069 0.16% 117 30251 0.17% 118 31412 0.17% 119 32214 0.18% 120 33375 0.18% 121 34747 0.19% 122 36015 0.20% 123 38035 0.21% 124 40413 0.22% 125 42295 0.23% 126 44123 0.24% 127 46616 0.26% 128 48043 0.26% 129 50484 0.28% 130 53065 0.29% 131 54642 0.30% 132 57900 0.32% 133 61508 0.34% 134 65009 0.36% 135 69697 0.38% 136 74602 0.41% 137 79019 0.43% 138 84478 0.46% 139 90903 0.50% 140 96498 0.53% 141 106170 0.58% 142 116532 0.64% 143 130535 0.71% 144 149849 0.82% 145 178227 0.98% 146 217737 1.19% 147 296843 1.63% 148 458364 2.51% 149 917469 5.02% 150 4198079 22.99% 151 9699589 53.12% 18261070 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=38 prefix-density=0.21 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=37 fanout-score=113.56 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=16.4 sequence=TTCTTCAAGAATTTTAAGCAGTGTGCGTCGCTCCAATCATGGCATATCCACTTCATGAAAACGGCATCTGCTTTGGGCACGCTAACAAACATGTCCCCACCAACATGCTCCACACCGGGATAAGATGGGGCATCCTCAATGACGTGGGGCAGATCAAAGTTAATGCCCTTAATTGAAGGGTATTTAGAGACGATGGTGTTAACGACAGCTCCAGTCCCACCACCAACA criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.78 fanout-score-rank=35 prefix-density=0.26 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.02 sequence-density-rank=41 fanout-score=149.67 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=14.4 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTACTCGAGAAGATCAAGGAGA SRR7169626 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 11:00:36 Started mapping on | Feb 11 11:00:37 Finished on | Feb 11 11:02:20 Mapping speed, Million of reads per hour | 638.25 Number of input reads | 18261070 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 16266898 Uniquely mapped reads % | 89.08% Average mapped length | 286.84 Number of splices: Total | 15379170 Number of splices: Annotated (sjdb) | 15121136 Number of splices: GT/AG | 15153270 Number of splices: GC/AG | 180721 Number of splices: AT/AC | 13370 Number of splices: Non-canonical | 31809 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 295987 % of reads mapped to multiple loci | 1.62% Number of reads mapped to too many loci | 23975 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.14% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1712545 1712545 1712545 N_multimapping 295987 295987 295987 N_noFeature 322438 16085800 394678 N_ambiguous 205415 1399 95562 UnstrandedReadsAssigned:15739045 PositiveStrandReadsAssigned:179699 NegativeStrandReadsAssigned:15776658 Dataset is classified negative stranded MeadianReadLen=143 20thPercentileLength=142 echo kmer=137 SRR7169626 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169626-trimmed-pair1.fastq SRR7169626-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,261,070 reads, 16,768,479 reads pseudoaligned [quant] estimated average fragment length: 237.227 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,294 rounds 52401 SRR7169626.ke.tsv 34699 SRR7169626.se.tsv 87100 total ==> SRR7169626.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1781.77 279 8.52338 Potri.005G024800.1.v4.1 1035 798.773 39 2.65767 Potri.004G059700.1.v4.1 961 724.789 0 0 Potri.007G009000.2.v4.1 1416 1179.77 0 0 Potri.003G141000.2.v4.1 2943 2706.77 263.089 5.29067 Potri.016G087400.1.v4.1 270 83.0929 1378 902.704 Potri.015G069301.1.v4.1 564 332.048 0 0 Potri.010G195200.1.v4.1 1773 1536.77 25 0.885503 Potri.012G127500.1.v4.1 977 740.779 11789 866.26 ==> SRR7169626.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1371 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 280 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169626 completed mapping pipeline successfully