Starting /dee2/code/volunteer_pipeline.sh SRR7169627 current disk space = 3052997591040 free memory = 1412554108 SRR7169627 SRAfilesize 32d9777b328cf54c8966b05bb286532d SRR7169627.sra SRR7169627.sra file validated SRR7169627 is paired end SRR7169627 is conventional basespace SRR7169627 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169627_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.78375 34.0 33.0 34.0 33.0 34.0 2 33.33625 34.0 33.0 34.0 33.0 34.0 3 33.434 34.0 34.0 34.0 33.0 34.0 4 33.47225 34.0 34.0 34.0 33.0 34.0 5 33.4655 34.0 34.0 34.0 33.0 34.0 6 36.9165 38.0 37.0 38.0 35.0 38.0 7 37.3235 38.0 38.0 38.0 36.0 38.0 8 37.34075 38.0 38.0 38.0 37.0 38.0 9 37.49825 38.0 38.0 38.0 37.0 38.0 10-14 37.49745 38.0 38.0 38.0 37.2 38.0 15-19 37.444599999999994 38.0 38.0 38.0 37.0 38.0 20-24 37.4687 38.0 38.0 38.0 37.2 38.0 25-29 37.474000000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.433299999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.173500000000004 38.0 38.0 38.0 36.4 38.0 40-44 37.2051 38.0 38.0 38.0 36.2 38.0 45-49 37.19155000000001 38.0 38.0 38.0 36.2 38.0 50-54 37.139799999999994 38.0 38.0 38.0 36.0 38.0 55-59 37.09715 38.0 38.0 38.0 36.0 38.0 60-64 37.017900000000004 38.0 38.0 38.0 36.0 38.0 65-69 37.01180000000001 38.0 38.0 38.0 36.0 38.0 70-74 36.908500000000004 38.0 38.0 38.0 35.2 38.0 75-79 36.8047 38.0 38.0 38.0 35.0 38.0 80-84 36.7659 38.0 38.0 38.0 35.0 38.0 85-89 36.6518 38.0 38.0 38.0 34.4 38.0 90-94 36.66705 38.0 38.0 38.0 34.8 38.0 95-99 36.399950000000004 38.0 38.0 38.0 34.0 38.0 100-104 36.2838 38.0 37.6 38.0 33.8 38.0 105-109 36.2334 38.0 37.4 38.0 33.6 38.0 110-114 36.0238 38.0 37.0 38.0 33.0 38.0 115-119 35.8385 38.0 37.0 38.0 32.0 38.0 120-124 35.67815 38.0 36.4 38.0 31.2 38.0 125-129 35.453100000000006 38.0 36.0 38.0 30.8 38.0 130-134 35.238350000000004 38.0 35.8 38.0 29.2 38.0 135-139 34.8783 38.0 35.4 38.0 28.0 38.0 140-144 34.4339 38.0 35.0 38.0 26.6 38.0 145-149 33.756099999999996 38.0 35.0 38.0 22.6 38.0 150-151 30.734500000000004 36.5 30.5 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 2.0 16 1.0 17 1.0 18 2.0 19 6.0 20 2.0 21 5.0 22 9.0 23 7.0 24 10.0 25 17.0 26 20.0 27 23.0 28 33.0 29 36.0 30 45.0 31 41.0 32 79.0 33 81.0 34 143.0 35 302.0 36 655.0 37 2478.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.843996941116494 12.898292123374969 7.545245985215396 35.712464950293146 2 23.45 13.4 33.125 30.025000000000002 3 19.725 16.8 24.25 39.225 4 22.575 25.275 23.125 29.025000000000002 5 23.3 30.25 23.200000000000003 23.25 6 20.674999999999997 34.5 23.45 21.375 7 15.675 27.750000000000004 37.95 18.625 8 17.4 27.05 31.8 23.75 9 16.950000000000003 24.675 34.125 24.25 10-14 20.485 29.759999999999998 27.145000000000003 22.61 15-19 20.06 28.09 27.389999999999997 24.46 20-24 20.43 28.33 28.025 23.215 25-29 20.505000000000003 28.235 28.04 23.22 30-34 19.96 27.965 28.025 24.05 35-39 20.32304845726859 28.63929589438416 27.344101615242288 23.693554033104967 40-44 20.335 28.360000000000003 27.955000000000002 23.35 45-49 20.315 27.205000000000002 28.189999999999998 24.29 50-54 20.28 28.075 27.865000000000002 23.78 55-59 20.455000000000002 28.43 27.075 24.04 60-64 20.244999999999997 27.91 27.82 24.025 65-69 20.125 28.07 27.97 23.835 70-74 20.330000000000002 27.800000000000004 27.91 23.96 75-79 20.064999999999998 28.110000000000003 27.534999999999997 24.29 80-84 20.375 27.825 27.905 23.895 85-89 20.485 28.325 27.685 23.505000000000003 90-94 20.155 28.07 27.61 24.165 95-99 20.29 28.07 27.935 23.705000000000002 100-104 20.560000000000002 27.96 27.905 23.575 105-109 21.065 27.85 27.51 23.575 110-114 20.305 27.55 27.700000000000003 24.445 115-119 20.895 27.735 27.634999999999998 23.735 120-124 21.015 27.405 27.415 24.165 125-129 20.755000000000003 27.715 27.310000000000002 24.22 130-134 20.674999999999997 27.72 27.800000000000004 23.805 135-139 20.880000000000003 27.51 27.51 24.099999999999998 140-144 20.66 27.655 27.215 24.47 145-149 21.065 27.54 27.36 24.035 150-151 20.1 27.8125 27.700000000000003 24.3875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 1.0 22 2.0 23 2.0 24 0.5 25 1.0 26 4.0 27 6.0 28 6.5 29 11.0 30 15.5 31 19.5 32 28.0 33 38.0 34 44.5 35 58.0 36 74.0 37 90.5 38 119.5 39 151.0 40 187.5 41 207.0 42 229.5 43 253.5 44 253.5 45 265.0 46 285.0 47 273.5 48 245.5 49 228.0 50 201.0 51 156.5 52 118.0 53 102.5 54 84.0 55 59.5 56 46.5 57 38.5 58 24.5 59 10.0 60 10.0 61 12.5 62 6.5 63 2.5 64 2.5 65 4.5 66 4.5 67 3.0 68 2.5 69 2.0 70 1.0 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.925 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.015 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.44999999999999996 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.8374999999999999 0.0 0.0 0.0 0.0 106-107 0.925 0.0 0.0 0.0 0.0 108-109 1.125 0.0 0.0 0.0 0.0 110-111 1.325 0.0 0.0 0.0 0.0 112-113 1.475 0.0 0.0 0.0 0.0 114-115 1.575 0.0 0.0 0.0 0.0 116-117 1.8125 0.0 0.0 0.0 0.0 118-119 2.175 0.0 0.0 0.0 0.0 120-121 2.3375 0.0 0.0 0.0 0.0 122-123 2.5375 0.0 0.0 0.0 0.0 124-125 2.7875 0.0 0.0 0.0 0.0 126-127 3.1 0.0 0.0 0.0 0.0 128-129 3.4625 0.0 0.0 0.0 0.0 130-131 3.725 0.0 0.0 0.0 0.0 132-133 4.0 0.0 0.0 0.0 0.0 134-135 4.3625 0.0 0.0 0.0 0.0 136-137 4.725 0.0 0.0 0.0 0.0 138-139 4.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGATCC 10 0.0068343505 144.975 3 >>END_MODULE SRR7169627 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169627_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.881 33.0 33.0 34.0 32.0 34.0 2 33.0345 34.0 33.0 34.0 32.0 34.0 3 33.0735 34.0 33.0 34.0 32.0 34.0 4 33.05975 34.0 33.0 34.0 33.0 34.0 5 33.016 34.0 33.0 34.0 32.0 34.0 6 37.09325 38.0 38.0 38.0 37.0 38.0 7 37.0945 38.0 38.0 38.0 37.0 38.0 8 37.044 38.0 38.0 38.0 37.0 38.0 9 37.07925 38.0 38.0 38.0 37.0 38.0 10-14 37.029199999999996 38.0 38.0 38.0 37.0 38.0 15-19 36.93535000000001 38.0 38.0 38.0 36.2 38.0 20-24 36.949349999999995 38.0 38.0 38.0 36.4 38.0 25-29 36.8818 38.0 38.0 38.0 36.2 38.0 30-34 36.809450000000005 38.0 38.0 38.0 36.0 38.0 35-39 36.8074 38.0 38.0 38.0 36.0 38.0 40-44 36.83125 38.0 38.0 38.0 36.0 38.0 45-49 36.837 38.0 38.0 38.0 36.0 38.0 50-54 36.88825 38.0 38.0 38.0 36.0 38.0 55-59 36.54494999999999 38.0 38.0 38.0 34.6 38.0 60-64 36.693799999999996 38.0 38.0 38.0 36.0 38.0 65-69 36.6677 38.0 38.0 38.0 35.4 38.0 70-74 36.60365 38.0 38.0 38.0 35.0 38.0 75-79 36.50435 38.0 38.0 38.0 34.8 38.0 80-84 36.3757 38.0 38.0 38.0 34.0 38.0 85-89 36.2039 38.0 38.0 38.0 33.8 38.0 90-94 36.2031 38.0 38.0 38.0 34.0 38.0 95-99 36.18255 38.0 38.0 38.0 34.0 38.0 100-104 36.05915 38.0 38.0 38.0 33.6 38.0 105-109 35.8821 38.0 38.0 38.0 33.0 38.0 110-114 35.73355 38.0 37.4 38.0 32.8 38.0 115-119 35.624700000000004 38.0 37.0 38.0 32.0 38.0 120-124 35.36614999999999 38.0 37.0 38.0 30.0 38.0 125-129 35.11559999999999 38.0 36.0 38.0 29.2 38.0 130-134 34.84760000000001 38.0 36.0 38.0 27.8 38.0 135-139 34.45265 38.0 35.6 38.0 25.4 38.0 140-144 33.97545 38.0 35.0 38.0 22.6 38.0 145-149 33.4978 38.0 35.0 38.0 18.6 38.0 150-151 29.81225 36.5 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 12.0 4 2.0 5 2.0 6 0.0 7 0.0 8 2.0 9 3.0 10 1.0 11 4.0 12 1.0 13 3.0 14 4.0 15 2.0 16 6.0 17 1.0 18 3.0 19 10.0 20 9.0 21 5.0 22 9.0 23 12.0 24 15.0 25 19.0 26 26.0 27 19.0 28 31.0 29 36.0 30 50.0 31 52.0 32 82.0 33 89.0 34 127.0 35 216.0 36 504.0 37 2633.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.125 22.7 13.200000000000001 25.974999999999998 2 28.199999999999996 26.424999999999997 29.2 16.175 3 19.475 29.175 31.15 20.200000000000003 4 23.549999999999997 33.025 23.9 19.525000000000002 5 25.25 36.075 21.875 16.8 6 21.238716148445334 37.587763289869606 23.395185556670008 17.778335005015045 7 20.767494356659142 22.121896162528216 37.17080511662905 19.939804364183598 8 21.489468405215646 25.802407221664996 27.331995987963893 25.376128385155468 9 20.63691073219659 25.55165496489468 30.81745235707121 22.993981945837515 10-14 23.041821281716977 28.7784575268278 26.441680874536154 21.738040316919065 15-19 23.326480469337614 28.61154289725718 27.001955573384144 21.06002106002106 20-24 23.687509401795115 28.135185278042417 26.946798375369802 21.23050694479266 25-29 23.326480469337614 28.56139998997142 26.82645539788397 21.285664142807 30-34 23.624692843889473 28.138007121006968 27.435936011233135 20.801364023870416 35-39 23.415245737211634 27.673019057171516 27.748244734202608 21.163490471414242 40-44 24.00120306782295 28.171838187377812 27.224422276805853 20.60253646799338 45-49 23.079236205081944 28.0358843281712 27.72014233448604 21.164737132260814 50-54 23.16749336139085 28.598627185730745 27.055463700586202 21.1784157522922 55-59 24.254722180469965 28.102610351220005 27.22581291647878 20.416854551831253 60-64 23.761086335621588 28.596482437240066 26.96798115949291 20.674450067645438 65-69 23.99158190108734 27.298692188204637 27.960114245628098 20.74961166507992 70-74 24.571428571428573 27.649122807017545 27.233082706766915 20.546365914786968 75-79 23.558005512402907 28.183412678526686 27.65722876472062 20.60135304434979 80-84 23.609648462965747 27.877237851662407 27.917356200792337 20.59575748457951 85-89 23.836276083467094 27.994582664526487 27.643459069020864 20.525682182985555 90-94 23.588123181863775 28.75413782726452 26.858260607884443 20.79947838298726 95-99 23.83840409002055 28.294321086662322 26.83574758157486 21.031527241742268 100-104 23.961309076329375 28.06595499423646 27.504635894351726 20.468100035082443 105-109 24.547868343269375 27.814237763639092 27.047743099043135 20.590150794048395 110-114 24.625482238589107 27.937271406383086 27.576531890375268 19.86071446465254 115-119 24.462486844083596 28.5220267628928 26.963363905177168 20.05212248784644 120-124 24.287074625369616 27.474565228286473 27.660001002355532 20.578359143988372 125-129 24.367263068210292 27.88553099784494 27.274094121184785 20.473111812759985 130-134 24.927318295739347 28.145363408521302 26.79699248120301 20.13032581453634 135-139 24.217966713454985 27.857429316222177 27.07038299578905 20.85422097453379 140-144 25.26685041343022 28.29867201202706 27.121022300175397 19.31345527436733 145-149 25.038825710134766 27.83928660888733 27.283202244376536 19.838685436601374 150-151 23.820843237833103 28.825222069310648 27.198798949080444 20.155135743775805 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 2.0 3 3.5 4 1.5 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 0.5 23 1.5 24 1.5 25 1.0 26 1.5 27 2.0 28 3.5 29 6.5 30 9.0 31 12.0 32 17.0 33 25.5 34 40.5 35 59.0 36 66.5 37 84.5 38 126.0 39 158.5 40 195.5 41 231.0 42 245.0 43 273.0 44 298.0 45 288.5 46 283.5 47 273.5 48 245.0 49 215.0 50 181.5 51 144.5 52 118.0 53 103.0 54 73.0 55 54.5 56 46.5 57 31.5 58 23.0 59 14.0 60 8.5 61 6.0 62 6.0 63 5.0 64 1.5 65 1.5 66 1.5 67 1.0 68 1.0 69 0.5 70 0.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.3 7 0.325 8 0.3 9 0.3 10-14 0.29 15-19 0.28500000000000003 20-24 0.28500000000000003 25-29 0.28500000000000003 30-34 0.295 35-39 0.3 40-44 0.255 45-49 0.23500000000000001 50-54 0.20500000000000002 55-59 0.20500000000000002 60-64 0.215 65-69 0.215 70-74 0.25 75-79 0.22499999999999998 80-84 0.295 85-89 0.32 90-94 0.31 95-99 0.245 100-104 0.23500000000000001 105-109 0.19499999999999998 110-114 0.20500000000000002 115-119 0.23500000000000001 120-124 0.23500000000000001 125-129 0.23500000000000001 130-134 0.25 135-139 0.26 140-144 0.22499999999999998 145-149 0.19499999999999998 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.42500000000000004 0.0 0.0 0.0 0.0 100-101 0.6125 0.0 0.0 0.0 0.0 102-103 0.675 0.0 0.0 0.0 0.0 104-105 0.775 0.0 0.0 0.0 0.0 106-107 0.8500000000000001 0.0 0.0 0.0 0.0 108-109 1.0499999999999998 0.0 0.0 0.0 0.0 110-111 1.25 0.0 0.0 0.0 0.0 112-113 1.3875000000000002 0.0 0.0 0.0 0.0 114-115 1.475 0.0 0.0 0.0 0.0 116-117 1.7125 0.0 0.0 0.0 0.0 118-119 2.0375 0.0 0.0 0.0 0.0 120-121 2.1625 0.0 0.0 0.0 0.0 122-123 2.3625 0.0 0.0 0.0 0.0 124-125 2.625 0.0 0.0 0.0 0.0 126-127 2.95 0.0 0.0 0.0 0.0 128-129 3.2875 0.0 0.0 0.0 0.0 130-131 3.5375 0.0 0.0 0.0 0.0 132-133 3.7875 0.0 0.0 0.0 0.0 134-135 4.15 0.0 0.0 0.0 0.0 136-137 4.512499999999999 0.0 0.0 0.0 0.0 138-139 4.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 878716 spots for SRR7169627.sra Written 878716 spots for SRR7169627.sra Read 878716 spots for SRR7169627.sra Written 878716 spots for SRR7169627.sra Read 878716 spots for SRR7169627.sra Written 878716 spots for SRR7169627.sra Read 878716 spots for SRR7169627.sra Written 878716 spots for SRR7169627.sra Read 878716 spots for SRR7169627.sra Written 878716 spots for SRR7169627.sra Read 878716 spots for SRR7169627.sra Written 878716 spots for SRR7169627.sra Read 878716 spots for SRR7169627.sra Written 878716 spots for SRR7169627.sra Read 878716 spots for SRR7169627.sra Written 878716 spots for SRR7169627.sra Read 878716 spots for SRR7169627.sra Written 878716 spots for SRR7169627.sra Read 878716 spots for SRR7169627.sra Written 878716 spots for SRR7169627.sra Read 878716 spots for SRR7169627.sra Written 878716 spots for SRR7169627.sra Read 878716 spots for SRR7169627.sra Written 878716 spots for SRR7169627.sra Read 878727 spots for SRR7169627.sra Written 878727 spots for SRR7169627.sra Read 878716 spots for SRR7169627.sra Written 878716 spots for SRR7169627.sra Read 878716 spots for SRR7169627.sra Written 878716 spots for SRR7169627.sra Read 878716 spots for SRR7169627.sra Written 878716 spots for SRR7169627.sra Read 878716 spots for SRR7169627.sra Written 878716 spots for SRR7169627.sra Read 878716 spots for SRR7169627.sra Written 878716 spots for SRR7169627.sra Read 878716 spots for SRR7169627.sra Written 878716 spots for SRR7169627.sra Read 878716 spots for SRR7169627.sra Written 878716 spots for SRR7169627.sra SRR ids: ['SRR7169627.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_a0iz3v3z SRR7169627.sra spots: 17574331 blocks: [[1, 878716], [878717, 1757432], [1757433, 2636148], [2636149, 3514864], [3514865, 4393580], [4393581, 5272296], [5272297, 6151012], [6151013, 7029728], [7029729, 7908444], [7908445, 8787160], [8787161, 9665876], [9665877, 10544592], [10544593, 11423308], [11423309, 12302024], [12302025, 13180740], [13180741, 14059456], [14059457, 14938172], [14938173, 15816888], [15816889, 16695604], [16695605, 17574331]] SRR7169627 file size 5933663 SRR7169627 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169627 SRR7169627_1.fastq SRR7169627_2.fastq Input file: SRR7169627_1.fastq Paired file: SRR7169627_2.fastq trimmed: SRR7169627-trimmed-pair1.fastq, SRR7169627-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:46:02 2025 >> started Tue Feb 11 10:46:32 2025 >> done (30.157s) 17574331 read pairs processed; of these: 35505 ( 0.20%) short read pairs filtered out after trimming by size control 33079 ( 0.19%) empty read pairs filtered out after trimming by size control 17505747 (99.61%) read pairs available; of these: 8271077 (47.25%) trimmed read pairs available after processing 9234670 (52.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 9 0.00% 21 1 0.00% 22 4 0.00% 23 6 0.00% 24 6 0.00% 25 6 0.00% 26 4 0.00% 27 6 0.00% 28 6 0.00% 29 5 0.00% 30 11 0.00% 31 10 0.00% 32 3 0.00% 33 10 0.00% 34 7 0.00% 35 18 0.00% 36 7 0.00% 37 17 0.00% 38 24 0.00% 39 12 0.00% 40 21 0.00% 41 17 0.00% 42 26 0.00% 43 23 0.00% 44 18 0.00% 45 27 0.00% 46 32 0.00% 47 40 0.00% 48 44 0.00% 49 45 0.00% 50 65 0.00% 51 65 0.00% 52 69 0.00% 53 80 0.00% 54 86 0.00% 55 93 0.00% 56 108 0.00% 57 97 0.00% 58 140 0.00% 59 136 0.00% 60 186 0.00% 61 201 0.00% 62 205 0.00% 63 235 0.00% 64 263 0.00% 65 312 0.00% 66 356 0.00% 67 461 0.00% 68 727 0.00% 69 1249 0.01% 70 1041 0.01% 71 719 0.00% 72 786 0.00% 73 877 0.01% 74 969 0.01% 75 1028 0.01% 76 1186 0.01% 77 1316 0.01% 78 1471 0.01% 79 1597 0.01% 80 1830 0.01% 81 2038 0.01% 82 2322 0.01% 83 2734 0.02% 84 3768 0.02% 85 4377 0.03% 86 4366 0.02% 87 4724 0.03% 88 5254 0.03% 89 5458 0.03% 90 5842 0.03% 91 6530 0.04% 92 6812 0.04% 93 7231 0.04% 94 7882 0.05% 95 8336 0.05% 96 8716 0.05% 97 9543 0.05% 98 9876 0.06% 99 10409 0.06% 100 11194 0.06% 101 11794 0.07% 102 12622 0.07% 103 13170 0.08% 104 14029 0.08% 105 15046 0.09% 106 16193 0.09% 107 16542 0.09% 108 17275 0.10% 109 17973 0.10% 110 18995 0.11% 111 19872 0.11% 112 21116 0.12% 113 21895 0.13% 114 23099 0.13% 115 24472 0.14% 116 25921 0.15% 117 27253 0.16% 118 28599 0.16% 119 29478 0.17% 120 30511 0.17% 121 32248 0.18% 122 32973 0.19% 123 35028 0.20% 124 37078 0.21% 125 38925 0.22% 126 40976 0.23% 127 43501 0.25% 128 45408 0.26% 129 47791 0.27% 130 50159 0.29% 131 52535 0.30% 132 54992 0.31% 133 58357 0.33% 134 61781 0.35% 135 66780 0.38% 136 71464 0.41% 137 75607 0.43% 138 82024 0.47% 139 87924 0.50% 140 94336 0.54% 141 103496 0.59% 142 114809 0.66% 143 127618 0.73% 144 147123 0.84% 145 175061 1.00% 146 214424 1.22% 147 294755 1.68% 148 454573 2.60% 149 905710 5.17% 150 4071931 23.26% 151 9234670 52.75% 17505747 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=40 prefix-density=0.15 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.11 sequence-density-rank=14 fanout-score=225.94 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=27.0 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.50 fanout-score-rank=38 prefix-density=0.29 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=32 fanout-score=220.20 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=24.3 sequence=GAAGAAGAAGAAA SRR7169627 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:47:28 Started mapping on | Feb 11 10:47:28 Finished on | Feb 11 10:49:32 Mapping speed, Million of reads per hour | 508.23 Number of input reads | 17505747 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 16799956 Uniquely mapped reads % | 95.97% Average mapped length | 294.74 Number of splices: Total | 15921771 Number of splices: Annotated (sjdb) | 15654521 Number of splices: GT/AG | 15688710 Number of splices: GC/AG | 189173 Number of splices: AT/AC | 12951 Number of splices: Non-canonical | 30937 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.02% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 303449 % of reads mapped to multiple loci | 1.73% Number of reads mapped to too many loci | 24263 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.12% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 418811 418811 418811 N_multimapping 303449 303449 303449 N_noFeature 375876 16607558 472606 N_ambiguous 162934 963 66579 UnstrandedReadsAssigned:16261146 PositiveStrandReadsAssigned:191435 NegativeStrandReadsAssigned:16260771 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169627 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169627-trimmed-pair1.fastq SRR7169627-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,505,747 reads, 16,143,817 reads pseudoaligned [quant] estimated average fragment length: 246.444 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,127 rounds 52401 SRR7169627.ke.tsv 34699 SRR7169627.se.tsv 87100 total ==> SRR7169627.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1772.56 293 10.2065 Potri.005G024800.1.v4.1 1035 789.556 33 2.58072 Potri.004G059700.1.v4.1 961 715.569 2 0.172579 Potri.007G009000.2.v4.1 1416 1170.56 0 0 Potri.003G141000.2.v4.1 2943 2697.56 316.076 7.23489 Potri.016G087400.1.v4.1 270 77.1319 1243 995.056 Potri.015G069301.1.v4.1 564 323.939 0 0 Potri.010G195200.1.v4.1 1773 1527.56 33 1.33391 Potri.012G127500.1.v4.1 977 731.569 7131 601.874 ==> SRR7169627.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1191 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 241 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169627 completed mapping pipeline successfully