Starting /dee2/code/volunteer_pipeline.sh SRR7169628 current disk space = 3052403326976 free memory = 1467388736 SRR7169628 SRAfilesize 8f311ef710a4a486d7e621904a27ad5b SRR7169628.sra SRR7169628.sra file validated SRR7169628 is paired end SRR7169628 is conventional basespace SRR7169628 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169628_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8635 34.0 33.0 34.0 33.0 34.0 2 33.375 34.0 34.0 34.0 33.0 34.0 3 33.37175 34.0 34.0 34.0 33.0 34.0 4 33.461 34.0 34.0 34.0 33.0 34.0 5 33.47325 34.0 34.0 34.0 33.0 34.0 6 37.0625 38.0 37.0 38.0 36.0 38.0 7 37.3675 38.0 38.0 38.0 37.0 38.0 8 37.51625 38.0 38.0 38.0 37.0 38.0 9 37.551 38.0 38.0 38.0 37.0 38.0 10-14 37.4694 38.0 38.0 38.0 37.4 38.0 15-19 37.49544999999999 38.0 38.0 38.0 37.6 38.0 20-24 37.50275 38.0 38.0 38.0 37.6 38.0 25-29 37.4878 38.0 38.0 38.0 37.6 38.0 30-34 37.50765 38.0 38.0 38.0 37.4 38.0 35-39 37.316050000000004 38.0 38.0 38.0 36.8 38.0 40-44 37.30505000000001 38.0 38.0 38.0 37.0 38.0 45-49 37.26039999999999 38.0 38.0 38.0 36.4 38.0 50-54 37.21585 38.0 38.0 38.0 36.0 38.0 55-59 37.18140000000001 38.0 38.0 38.0 36.0 38.0 60-64 37.12605 38.0 38.0 38.0 36.0 38.0 65-69 37.11285 38.0 38.0 38.0 36.0 38.0 70-74 37.0154 38.0 38.0 38.0 36.0 38.0 75-79 36.9662 38.0 38.0 38.0 35.8 38.0 80-84 36.8568 38.0 38.0 38.0 35.2 38.0 85-89 36.786 38.0 38.0 38.0 35.0 38.0 90-94 36.754149999999996 38.0 38.0 38.0 34.8 38.0 95-99 36.63485 38.0 38.0 38.0 34.4 38.0 100-104 36.542899999999996 38.0 38.0 38.0 34.0 38.0 105-109 36.350649999999995 38.0 38.0 38.0 34.0 38.0 110-114 36.2607 38.0 37.6 38.0 34.0 38.0 115-119 36.056599999999996 38.0 37.0 38.0 33.2 38.0 120-124 35.874649999999995 38.0 37.2 38.0 32.6 38.0 125-129 35.761250000000004 38.0 37.0 38.0 32.4 38.0 130-134 35.56570000000001 38.0 36.2 38.0 31.0 38.0 135-139 35.26455 38.0 36.0 38.0 30.0 38.0 140-144 34.94335 38.0 35.6 38.0 28.4 38.0 145-149 34.33295 38.0 35.0 38.0 26.2 38.0 150-151 31.358375000000002 36.5 31.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 2.0 17 2.0 18 2.0 19 5.0 20 3.0 21 3.0 22 8.0 23 1.0 24 11.0 25 15.0 26 12.0 27 16.0 28 28.0 29 28.0 30 49.0 31 66.0 32 56.0 33 97.0 34 129.0 35 195.0 36 560.0 37 2710.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.854744339862634 12.617654540829307 11.320274739252097 35.20732638005597 2 24.224999999999998 13.825000000000001 31.525 30.425 3 20.175 17.675 25.025 37.125 4 23.075000000000003 25.7 23.45 27.775 5 22.6 31.7 23.400000000000002 22.3 6 21.075 33.425 23.9 21.6 7 14.774999999999999 27.800000000000004 41.075 16.35 8 18.725 25.924999999999997 30.099999999999998 25.25 9 16.3 25.55 32.95 25.2 10-14 19.475 30.275000000000002 27.089999999999996 23.16 15-19 19.805 28.999999999999996 27.529999999999998 23.665 20-24 19.88 29.12 27.515 23.485 25-29 20.185 28.389999999999997 27.375 24.05 30-34 20.380000000000003 28.849999999999998 27.065 23.705000000000002 35-39 19.875 28.52 27.415 24.19 40-44 19.98 28.49 27.87 23.66 45-49 19.79 28.555000000000003 27.565 24.09 50-54 20.29 28.494999999999997 26.96 24.255 55-59 19.950000000000003 29.015 27.015 24.02 60-64 19.919999999999998 28.79 27.765 23.525 65-69 19.955000000000002 28.449999999999996 27.529999999999998 24.065 70-74 20.200000000000003 28.715000000000003 27.339999999999996 23.745 75-79 19.919999999999998 28.92 27.325 23.835 80-84 20.22 28.68 27.005000000000003 24.095 85-89 19.869999999999997 28.595 27.415 24.12 90-94 20.19 28.415000000000003 27.195000000000004 24.2 95-99 20.54 27.889999999999997 27.405 24.165 100-104 20.265 28.665000000000003 26.745 24.325 105-109 19.985 28.7 26.76 24.555 110-114 20.544999999999998 28.305000000000003 26.955000000000002 24.195 115-119 20.455000000000002 28.360000000000003 27.055 24.13 120-124 20.43 28.035 27.715 23.82 125-129 20.794999999999998 27.85 27.425 23.93 130-134 21.17 28.055000000000003 27.35 23.425 135-139 20.845 27.73 27.295 24.13 140-144 20.94 27.845 27.425 23.79 145-149 20.895 28.52 26.595000000000002 23.990000000000002 150-151 20.625 28.15 26.85 24.375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 2.0 23 2.0 24 1.0 25 4.0 26 6.0 27 7.5 28 10.0 29 12.5 30 16.5 31 25.5 32 32.5 33 39.5 34 41.5 35 52.5 36 81.5 37 97.0 38 118.0 39 160.5 40 186.0 41 213.5 42 255.0 43 263.0 44 263.5 45 276.5 46 259.5 47 236.0 48 251.0 49 218.5 50 169.5 51 160.0 52 128.5 53 95.5 54 78.0 55 60.5 56 40.0 57 30.0 58 29.0 59 18.5 60 10.0 61 11.0 62 9.5 63 8.5 64 6.0 65 2.5 66 1.0 67 1.5 68 2.5 69 2.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.725 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.5625 0.0 0.0 0.0 0.0 102-103 0.6625000000000001 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 0.875 0.0 0.0 0.0 0.0 108-109 1.0125 0.0 0.0 0.0 0.0 110-111 1.1625 0.0 0.0 0.0 0.0 112-113 1.2875 0.0 0.0 0.0 0.0 114-115 1.4375 0.0 0.0 0.0 0.0 116-117 1.6875 0.0 0.0 0.0 0.0 118-119 1.9375 0.0 0.0 0.0 0.0 120-121 2.1875 0.0 0.0 0.0 0.0 122-123 2.4625 0.0 0.0 0.0 0.0 124-125 2.75 0.0 0.0 0.0 0.0 126-127 3.0250000000000004 0.0 0.0 0.0 0.0 128-129 3.3 0.0 0.0 0.0 0.0 130-131 3.5875 0.0 0.0 0.0 0.0 132-133 3.9375 0.0 0.0 0.0 0.0 134-135 4.25 0.0 0.0 0.0 0.0 136-137 4.475 0.0 0.0 0.0 0.0 138-139 4.862500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCCCAC 10 0.006577216 146.82278 1 AGTTGTA 10 0.006832588 144.9875 7 CCGGTTA 10 0.006832588 144.9875 4 >>END_MODULE SRR7169628 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169628_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8585 33.0 33.0 34.0 32.0 34.0 2 32.8855 34.0 33.0 34.0 32.0 34.0 3 32.93775 34.0 33.0 34.0 32.0 34.0 4 32.89875 34.0 33.0 34.0 32.0 34.0 5 32.91975 34.0 33.0 34.0 32.0 34.0 6 37.0 38.0 38.0 38.0 36.0 38.0 7 37.089 38.0 38.0 38.0 37.0 38.0 8 37.05125 38.0 38.0 38.0 37.0 38.0 9 37.01775 38.0 38.0 38.0 37.0 38.0 10-14 37.05935 38.0 38.0 38.0 37.0 38.0 15-19 37.0355 38.0 38.0 38.0 37.0 38.0 20-24 36.9518 38.0 38.0 38.0 36.8 38.0 25-29 36.94635 38.0 38.0 38.0 36.6 38.0 30-34 36.8809 38.0 38.0 38.0 36.0 38.0 35-39 36.8562 38.0 38.0 38.0 36.0 38.0 40-44 36.87065 38.0 38.0 38.0 36.0 38.0 45-49 36.9266 38.0 38.0 38.0 36.4 38.0 50-54 36.845800000000004 38.0 38.0 38.0 36.2 38.0 55-59 36.32625 38.0 37.8 38.0 33.2 38.0 60-64 36.693 38.0 38.0 38.0 35.8 38.0 65-69 36.73485 38.0 38.0 38.0 36.0 38.0 70-74 36.5994 38.0 38.0 38.0 35.6 38.0 75-79 36.53715 38.0 38.0 38.0 35.0 38.0 80-84 36.41335 38.0 38.0 38.0 34.8 38.0 85-89 36.352 38.0 38.0 38.0 34.2 38.0 90-94 36.26685 38.0 38.0 38.0 34.0 38.0 95-99 36.257000000000005 38.0 38.0 38.0 34.2 38.0 100-104 36.14185 38.0 38.0 38.0 34.0 38.0 105-109 36.08645 38.0 38.0 38.0 34.0 38.0 110-114 35.96205 38.0 38.0 38.0 33.8 38.0 115-119 35.69235 38.0 38.0 38.0 32.6 38.0 120-124 35.5019 38.0 37.0 38.0 31.4 38.0 125-129 35.216150000000006 38.0 36.6 38.0 29.4 38.0 130-134 34.907 38.0 36.0 38.0 28.4 38.0 135-139 34.6164 38.0 36.0 38.0 27.2 38.0 140-144 34.28695 38.0 35.4 38.0 25.4 38.0 145-149 33.699850000000005 38.0 35.0 38.0 21.0 38.0 150-151 30.278999999999996 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 2.0 4 1.0 5 0.0 6 1.0 7 4.0 8 1.0 9 5.0 10 2.0 11 5.0 12 6.0 13 0.0 14 7.0 15 7.0 16 3.0 17 4.0 18 5.0 19 8.0 20 7.0 21 9.0 22 12.0 23 15.0 24 12.0 25 18.0 26 24.0 27 28.0 28 23.0 29 29.0 30 32.0 31 42.0 32 62.0 33 88.0 34 113.0 35 192.0 36 490.0 37 2730.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.99624530663329 22.22778473091364 16.245306633291616 24.53066332916145 2 29.771758214196137 26.21018309505894 26.56132430398796 17.45673438675696 3 22.322548281916227 27.363932781540008 30.072736393278156 20.240782543265613 4 23.100075244544772 32.731376975169304 25.156759468271883 19.011788312014048 5 24.73037371457236 34.68773513920241 22.523200401304237 18.058690744920995 6 21.28192288432649 36.25438157235854 23.73560340510766 18.728092138207312 7 19.203805708562843 23.71056584877316 37.35603405107661 19.729594391587383 8 23.62953692115144 25.306633291614517 26.458072590738425 24.60575719649562 9 22.152690863579476 24.55569461827284 29.336670838548184 23.9549436795995 10-14 23.798317644702582 28.975565792108952 26.3018225515722 20.92429401161626 15-19 23.763268576006407 27.853995593831364 27.58361706388944 20.79911876627278 20-24 23.42013019529294 28.327491236855284 27.125688532799195 21.12669003505258 25-29 23.42482219773615 28.122808774917356 27.52178703796454 20.93058198938195 30-34 23.548855611759404 27.941102819652425 27.239945910752745 21.270095657835427 35-39 23.67169112123792 27.883218989433622 27.702939556312284 20.742150333016173 40-44 23.566528118583804 27.898242275527068 27.667885222094245 20.86734438379488 45-49 23.70819146805528 27.59363108351692 27.914079711596234 20.784097736831562 50-54 23.612153977073636 27.852029834309455 28.08229463883466 20.45352154978225 55-59 23.98498122653317 27.909887359198997 27.369211514392994 20.735919899874844 60-64 23.410433563632722 28.421948533093023 27.485731450886153 20.681886452388103 65-69 22.91708391748448 28.514920889244944 27.34328059282996 21.224714600440617 70-74 23.809523809523807 28.00060087126333 27.75524510540283 20.434630213810024 75-79 24.165039306995144 27.114315757848885 27.720194281708476 21.0004506534475 80-84 23.253368057294534 27.315069865277707 28.567135774027147 20.86442630340061 85-89 24.317692423256045 27.657869698031952 27.53768340928439 20.486754469427613 90-94 24.041061592388584 27.516274411617424 27.87681522283425 20.56584877315974 95-99 23.508209851822187 27.6331597917501 27.392871445734883 21.46575891069283 100-104 24.18902683219864 27.32779335202243 27.808370044052865 20.67480977172607 105-109 23.542365246984637 28.001601521445373 27.806416095290526 20.649617136279467 110-114 24.533119711610674 27.28683723026085 27.767486106243428 20.412556951885044 115-119 24.4892849989986 27.228119367113962 27.75385539755658 20.528740236330865 120-124 24.23514095438386 27.534925642181165 27.574983726403286 20.654949677031695 125-129 24.21875 28.400440705128204 27.11338141025641 20.267427884615387 130-134 25.08388001402173 27.607792077720468 27.147077970854827 20.161249937402975 135-139 25.16025641025641 27.408854166666668 27.529046474358974 19.90184294871795 140-144 25.012516271152496 27.986382296986083 26.955041554020227 20.046059877841195 145-149 24.86483780536644 27.61814177012415 27.157589106928313 20.359431317581098 150-151 25.312656328164078 26.96348174087044 27.688844422211105 20.035017508754375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 4.0 1 2.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.0 25 0.5 26 1.0 27 2.5 28 3.0 29 5.5 30 10.5 31 10.5 32 15.0 33 25.5 34 33.5 35 46.0 36 65.0 37 98.5 38 128.5 39 161.5 40 203.5 41 242.0 42 262.5 43 269.5 44 290.0 45 289.5 46 267.0 47 258.5 48 251.5 49 216.0 50 184.5 51 160.5 52 129.5 53 101.0 54 71.5 55 47.0 56 32.0 57 26.5 58 23.0 59 18.0 60 10.0 61 5.0 62 4.0 63 5.0 64 4.0 65 2.5 66 3.0 67 2.5 68 1.0 69 0.5 70 0.5 71 0.5 72 1.0 73 0.5 74 0.5 75 0.5 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.325 3 0.325 4 0.325 5 0.325 6 0.15 7 0.15 8 0.125 9 0.125 10-14 0.13999999999999999 15-19 0.13999999999999999 20-24 0.15 25-29 0.16999999999999998 30-34 0.165 35-39 0.155 40-44 0.155 45-49 0.13999999999999999 50-54 0.11499999999999999 55-59 0.125 60-64 0.13 65-69 0.13999999999999999 70-74 0.145 75-79 0.145 80-84 0.165 85-89 0.155 90-94 0.15 95-99 0.12 100-104 0.12 105-109 0.095 110-114 0.135 115-119 0.13999999999999999 120-124 0.145 125-129 0.16 130-134 0.155 135-139 0.16 140-144 0.13 145-149 0.12 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62339944765253 99.2 2 0.35149384885764495 0.7000000000000001 3 0.0 0.0 4 0.025106703489831784 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.5625 0.0 0.0 0.0 0.0 102-103 0.675 0.0 0.0 0.0 0.0 104-105 0.775 0.0 0.0 0.0 0.0 106-107 0.8999999999999999 0.0 0.0 0.0 0.0 108-109 1.0375 0.0 0.0 0.0 0.0 110-111 1.175 0.0 0.0 0.0 0.0 112-113 1.3125 0.0 0.0 0.0 0.0 114-115 1.4500000000000002 0.0 0.0 0.0 0.0 116-117 1.65 0.0 0.0 0.0 0.0 118-119 1.875 0.0 0.0 0.0 0.0 120-121 2.0999999999999996 0.0 0.0 0.0 0.0 122-123 2.3625 0.0 0.0 0.0 0.0 124-125 2.6500000000000004 0.0 0.0 0.0 0.0 126-127 2.9625 0.0 0.0 0.0 0.0 128-129 3.1875 0.0 0.0 0.0 0.0 130-131 3.45 0.0 0.0 0.0 0.0 132-133 3.8125 0.0 0.0 0.0 0.0 134-135 4.125 0.0 0.0 0.0 0.0 136-137 4.362500000000001 0.0 0.0 0.0 0.0 138-139 4.762499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTGCCA 10 0.0065840036 146.77216 2 CTTAAAG 10 0.0068396386 144.9375 8 CTGTTCT 10 0.0068396386 144.9375 6 >>END_MODULE Read 875012 spots for SRR7169628.sra Written 875012 spots for SRR7169628.sra Read 875012 spots for SRR7169628.sra Written 875012 spots for SRR7169628.sra Read 875012 spots for SRR7169628.sra Written 875012 spots for SRR7169628.sra Read 875012 spots for SRR7169628.sra Written 875012 spots for SRR7169628.sra Read 875012 spots for SRR7169628.sra Written 875012 spots for SRR7169628.sra Read 875012 spots for SRR7169628.sra Written 875012 spots for SRR7169628.sra Read 875012 spots for SRR7169628.sra Written 875012 spots for SRR7169628.sra Read 875012 spots for SRR7169628.sra Written 875012 spots for SRR7169628.sra Read 875012 spots for SRR7169628.sra Written 875012 spots for SRR7169628.sra Read 875012 spots for SRR7169628.sra Written 875012 spots for SRR7169628.sra Read 875012 spots for SRR7169628.sra Written 875012 spots for SRR7169628.sra Read 875012 spots for SRR7169628.sra Written 875012 spots for SRR7169628.sra Read 875016 spots for SRR7169628.sra Written 875016 spots for SRR7169628.sra Read 875012 spots for SRR7169628.sra Written 875012 spots for SRR7169628.sra Read 875012 spots for SRR7169628.sra Written 875012 spots for SRR7169628.sra Read 875012 spots for SRR7169628.sra Written 875012 spots for SRR7169628.sra Read 875012 spots for SRR7169628.sra Written 875012 spots for SRR7169628.sra Read 875012 spots for SRR7169628.sra Written 875012 spots for SRR7169628.sra Read 875012 spots for SRR7169628.sra Written 875012 spots for SRR7169628.sra Read 875012 spots for SRR7169628.sra Written 875012 spots for SRR7169628.sra SRR ids: ['SRR7169628.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cyurr6sj SRR7169628.sra spots: 17500244 blocks: [[1, 875012], [875013, 1750024], [1750025, 2625036], [2625037, 3500048], [3500049, 4375060], [4375061, 5250072], [5250073, 6125084], [6125085, 7000096], [7000097, 7875108], [7875109, 8750120], [8750121, 9625132], [9625133, 10500144], [10500145, 11375156], [11375157, 12250168], [12250169, 13125180], [13125181, 14000192], [14000193, 14875204], [14875205, 15750216], [15750217, 16625228], [16625229, 17500244]] SRR7169628 file size 5908558 SRR7169628 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169628 SRR7169628_1.fastq SRR7169628_2.fastq Input file: SRR7169628_1.fastq Paired file: SRR7169628_2.fastq trimmed: SRR7169628-trimmed-pair1.fastq, SRR7169628-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 11:13:01 2025 >> started Tue Feb 11 11:13:21 2025 >> done (20.091s) 17500244 read pairs processed; of these: 21602 ( 0.12%) short read pairs filtered out after trimming by size control 57379 ( 0.33%) empty read pairs filtered out after trimming by size control 17421263 (99.55%) read pairs available; of these: 7059721 (40.52%) trimmed read pairs available after processing 10361542 (59.48%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 3 0.00% 21 3 0.00% 22 6 0.00% 23 8 0.00% 24 4 0.00% 25 4 0.00% 26 5 0.00% 27 10 0.00% 28 7 0.00% 29 10 0.00% 30 9 0.00% 31 10 0.00% 32 7 0.00% 33 6 0.00% 34 12 0.00% 35 11 0.00% 36 11 0.00% 37 15 0.00% 38 21 0.00% 39 10 0.00% 40 15 0.00% 41 25 0.00% 42 22 0.00% 43 33 0.00% 44 25 0.00% 45 23 0.00% 46 39 0.00% 47 45 0.00% 48 37 0.00% 49 60 0.00% 50 68 0.00% 51 64 0.00% 52 65 0.00% 53 75 0.00% 54 80 0.00% 55 96 0.00% 56 104 0.00% 57 130 0.00% 58 120 0.00% 59 173 0.00% 60 167 0.00% 61 235 0.00% 62 241 0.00% 63 250 0.00% 64 252 0.00% 65 320 0.00% 66 403 0.00% 67 478 0.00% 68 817 0.00% 69 1922 0.01% 70 1828 0.01% 71 1032 0.01% 72 885 0.01% 73 1003 0.01% 74 1045 0.01% 75 1078 0.01% 76 1372 0.01% 77 1406 0.01% 78 1581 0.01% 79 1802 0.01% 80 1925 0.01% 81 2254 0.01% 82 2671 0.02% 83 2949 0.02% 84 4090 0.02% 85 4946 0.03% 86 5194 0.03% 87 5610 0.03% 88 6211 0.04% 89 6171 0.04% 90 6594 0.04% 91 7114 0.04% 92 7588 0.04% 93 8089 0.05% 94 8683 0.05% 95 9323 0.05% 96 9945 0.06% 97 10424 0.06% 98 10737 0.06% 99 11352 0.07% 100 12068 0.07% 101 12769 0.07% 102 13749 0.08% 103 14714 0.08% 104 15494 0.09% 105 16323 0.09% 106 17041 0.10% 107 17703 0.10% 108 18110 0.10% 109 19149 0.11% 110 19977 0.11% 111 20855 0.12% 112 21891 0.13% 113 23204 0.13% 114 24359 0.14% 115 25670 0.15% 116 26515 0.15% 117 27655 0.16% 118 28587 0.16% 119 29133 0.17% 120 30451 0.17% 121 31498 0.18% 122 32729 0.19% 123 34432 0.20% 124 36437 0.21% 125 37959 0.22% 126 39823 0.23% 127 41383 0.24% 128 42453 0.24% 129 44396 0.25% 130 46461 0.27% 131 48541 0.28% 132 50926 0.29% 133 53574 0.31% 134 56190 0.32% 135 60148 0.35% 136 63857 0.37% 137 66992 0.38% 138 71801 0.41% 139 75254 0.43% 140 79724 0.46% 141 85513 0.49% 142 94182 0.54% 143 105039 0.60% 144 119393 0.69% 145 140833 0.81% 146 170408 0.98% 147 226781 1.30% 148 337072 1.93% 149 644398 3.70% 150 3534645 20.29% 151 10361542 59.48% 17421263 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=40 prefix-density=0.22 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.14 sequence-density-rank=11 fanout-score=88.14 fanout-score-rank=1 prefix-density=0.72 prefix-fanout=16.6 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=46 prefix-density=0.23 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.13 sequence-density-rank=7 fanout-score=49.26 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=12.9 sequence=TGTTGGTGGTGG SRR7169628 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 11:14:04 Started mapping on | Feb 11 11:14:05 Finished on | Feb 11 11:15:38 Mapping speed, Million of reads per hour | 674.37 Number of input reads | 17421263 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 16477126 Uniquely mapped reads % | 94.58% Average mapped length | 294.94 Number of splices: Total | 15226340 Number of splices: Annotated (sjdb) | 14974068 Number of splices: GT/AG | 15008580 Number of splices: GC/AG | 172635 Number of splices: AT/AC | 12544 Number of splices: Non-canonical | 32581 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 302610 % of reads mapped to multiple loci | 1.74% Number of reads mapped to too many loci | 32669 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.45% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 661447 661447 661447 N_multimapping 302610 302610 302610 N_noFeature 348794 16271375 436101 N_ambiguous 182080 865 63082 UnstrandedReadsAssigned:15946252 PositiveStrandReadsAssigned:204886 NegativeStrandReadsAssigned:15977943 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169628 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169628-trimmed-pair1.fastq SRR7169628-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,421,263 reads, 15,867,571 reads pseudoaligned [quant] estimated average fragment length: 245.542 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,065 rounds 52401 SRR7169628.ke.tsv 34699 SRR7169628.se.tsv 87100 total ==> SRR7169628.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.46 254 8.60343 Potri.005G024800.1.v4.1 1035 790.458 20 1.51988 Potri.004G059700.1.v4.1 961 716.51 0 0 Potri.007G009000.2.v4.1 1416 1171.46 0 0 Potri.003G141000.2.v4.1 2943 2698.46 288.099 6.41334 Potri.016G087400.1.v4.1 270 77.0858 1571.46 1224.58 Potri.015G069301.1.v4.1 564 323.789 0 0 Potri.010G195200.1.v4.1 1773 1528.46 24 0.943227 Potri.012G127500.1.v4.1 977 732.47 7172 588.178 ==> SRR7169628.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1202 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 298 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169628 completed mapping pipeline successfully