Starting /dee2/code/volunteer_pipeline.sh SRR7169629 current disk space = 3051507658752 free memory = 1501772256 SRR7169629 SRAfilesize 3da0f8c85207b0a2afa352fccb298be0 SRR7169629.sra SRR7169629.sra file validated SRR7169629 is paired end SRR7169629 is conventional basespace SRR7169629 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169629_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.816 34.0 33.0 34.0 33.0 34.0 2 33.35275 34.0 34.0 34.0 33.0 34.0 3 33.37075 34.0 34.0 34.0 33.0 34.0 4 33.496 34.0 34.0 34.0 33.0 34.0 5 33.4975 34.0 34.0 34.0 33.0 34.0 6 37.0495 38.0 37.0 38.0 36.0 38.0 7 37.35825 38.0 38.0 38.0 37.0 38.0 8 37.46975 38.0 38.0 38.0 37.0 38.0 9 37.5375 38.0 38.0 38.0 37.0 38.0 10-14 37.48035 38.0 38.0 38.0 37.6 38.0 15-19 37.5134 38.0 38.0 38.0 37.2 38.0 20-24 37.499399999999994 38.0 38.0 38.0 37.0 38.0 25-29 37.482600000000005 38.0 38.0 38.0 37.2 38.0 30-34 37.459199999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.30995 38.0 38.0 38.0 37.0 38.0 40-44 37.3155 38.0 38.0 38.0 37.0 38.0 45-49 37.21825 38.0 38.0 38.0 36.2 38.0 50-54 37.13275 38.0 38.0 38.0 36.0 38.0 55-59 37.14235 38.0 38.0 38.0 36.0 38.0 60-64 37.0661 38.0 38.0 38.0 36.0 38.0 65-69 37.07789999999999 38.0 38.0 38.0 36.0 38.0 70-74 36.951350000000005 38.0 38.0 38.0 35.8 38.0 75-79 36.955650000000006 38.0 38.0 38.0 36.0 38.0 80-84 36.88745 38.0 38.0 38.0 35.4 38.0 85-89 36.75935 38.0 38.0 38.0 34.8 38.0 90-94 36.6818 38.0 38.0 38.0 34.4 38.0 95-99 36.5899 38.0 38.0 38.0 34.4 38.0 100-104 36.529 38.0 38.0 38.0 34.0 38.0 105-109 36.37525000000001 38.0 37.4 38.0 34.0 38.0 110-114 36.2861 38.0 37.4 38.0 33.8 38.0 115-119 36.034949999999995 38.0 37.0 38.0 33.0 38.0 120-124 35.8708 38.0 36.8 38.0 31.8 38.0 125-129 35.62349999999999 38.0 36.0 38.0 31.0 38.0 130-134 35.52290000000001 38.0 36.0 38.0 31.0 38.0 135-139 35.1158 38.0 35.8 38.0 28.6 38.0 140-144 34.86300000000001 38.0 35.2 38.0 28.0 38.0 145-149 34.2725 38.0 35.0 38.0 26.0 38.0 150-151 31.203 36.5 31.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 1.0 19 1.0 20 2.0 21 3.0 22 4.0 23 6.0 24 13.0 25 17.0 26 15.0 27 18.0 28 22.0 29 30.0 30 41.0 31 51.0 32 63.0 33 106.0 34 132.0 35 247.0 36 680.0 37 2544.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.467108618052016 11.703212646608872 9.102498725140235 34.72718001019888 2 24.7 12.950000000000001 31.424999999999997 30.925000000000004 3 19.15 19.400000000000002 25.174999999999997 36.275 4 23.150000000000002 26.775 23.05 27.025 5 23.45 30.3 24.05 22.2 6 20.0 35.675000000000004 24.224999999999998 20.1 7 15.950000000000001 25.650000000000002 41.0 17.4 8 17.65 25.525 31.5 25.324999999999996 9 16.175 25.575 35.0 23.25 10-14 19.945 29.705 27.034999999999997 23.315 15-19 20.05 28.08 27.894999999999996 23.974999999999998 20-24 20.11 28.67 27.71 23.51 25-29 19.950000000000003 28.51 27.250000000000004 24.29 30-34 19.744999999999997 28.544999999999998 27.834999999999997 23.875 35-39 20.115 28.965000000000003 27.534999999999997 23.385 40-44 20.294999999999998 28.89 27.08 23.735 45-49 20.4 28.294999999999998 27.55 23.755000000000003 50-54 19.96 28.199999999999996 27.779999999999998 24.060000000000002 55-59 20.41 28.494999999999997 27.43 23.665 60-64 20.080000000000002 28.199999999999996 27.67 24.05 65-69 20.71 28.33 27.27 23.69 70-74 20.4 28.99 27.105 23.505000000000003 75-79 20.65 28.095 27.644999999999996 23.61 80-84 20.235 27.805000000000003 27.825 24.135 85-89 20.415 28.18 27.894999999999996 23.51 90-94 20.244999999999997 27.98 27.689999999999998 24.085 95-99 20.880000000000003 27.37 28.225 23.525 100-104 20.064999999999998 28.349999999999998 27.765 23.82 105-109 20.585 27.725 27.58 24.11 110-114 20.51 28.13 27.005000000000003 24.355 115-119 20.685000000000002 28.18 27.425 23.71 120-124 20.745 28.595 26.995 23.665 125-129 20.880000000000003 27.834999999999997 27.139999999999997 24.145 130-134 20.76 28.13 27.500000000000004 23.61 135-139 21.240000000000002 28.07 26.945000000000004 23.745 140-144 20.82 27.73 27.534999999999997 23.915 145-149 20.95 28.675 26.740000000000002 23.635 150-151 20.674999999999997 27.987499999999997 27.05 24.2875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.5 24 1.5 25 1.5 26 3.5 27 4.5 28 4.0 29 8.5 30 16.0 31 24.0 32 33.5 33 39.5 34 44.0 35 61.5 36 83.0 37 101.5 38 125.0 39 141.0 40 176.5 41 214.0 42 227.5 43 270.0 44 285.0 45 270.0 46 279.0 47 276.5 48 245.0 49 208.0 50 185.0 51 154.0 52 121.5 53 97.0 54 71.5 55 58.0 56 45.0 57 30.0 58 20.5 59 17.5 60 16.5 61 9.0 62 7.5 63 8.5 64 4.5 65 1.5 66 1.5 67 1.0 68 1.0 69 1.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.95 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.3875 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.45 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.6625000000000001 0.0 0.0 0.0 0.0 108-109 0.7875000000000001 0.0 0.0 0.0 0.0 110-111 0.9125 0.0 0.0 0.0 0.0 112-113 1.0375 0.0 0.0 0.0 0.0 114-115 1.2375 0.0 0.0 0.0 0.0 116-117 1.4125 0.0 0.0 0.0 0.0 118-119 1.6125 0.0 0.0 0.0 0.0 120-121 1.825 0.0 0.0 0.0 0.0 122-123 1.975 0.0 0.0 0.0 0.0 124-125 2.0625 0.0 0.0 0.0 0.0 126-127 2.2625 0.0 0.0 0.0 0.0 128-129 2.4625 0.0 0.0 0.0 0.0 130-131 2.7375 0.0 0.0 0.0 0.0 132-133 3.0625 0.0 0.0 0.0 0.0 134-135 3.325 0.0 0.0 0.0 0.0 136-137 3.675 0.0 0.0 0.0 0.0 138-139 3.9625000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAACTTG 20 0.00593511 29.0 55-59 >>END_MODULE SRR7169629 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169629_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.86225 33.0 33.0 34.0 32.0 34.0 2 32.965 34.0 33.0 34.0 32.0 34.0 3 33.023 34.0 33.0 34.0 32.0 34.0 4 32.9135 34.0 33.0 34.0 32.0 34.0 5 32.91725 34.0 33.0 34.0 32.0 34.0 6 37.0685 38.0 38.0 38.0 37.0 38.0 7 37.18925 38.0 38.0 38.0 37.0 38.0 8 37.19775 38.0 38.0 38.0 37.0 38.0 9 37.08425 38.0 38.0 38.0 37.0 38.0 10-14 37.08755 38.0 38.0 38.0 37.0 38.0 15-19 37.08925 38.0 38.0 38.0 37.0 38.0 20-24 37.06255 38.0 38.0 38.0 36.8 38.0 25-29 37.006 38.0 38.0 38.0 36.6 38.0 30-34 36.90964999999999 38.0 38.0 38.0 36.4 38.0 35-39 36.93745 38.0 38.0 38.0 36.8 38.0 40-44 36.93665 38.0 38.0 38.0 36.6 38.0 45-49 36.89444999999999 38.0 38.0 38.0 36.0 38.0 50-54 36.8956 38.0 38.0 38.0 36.4 38.0 55-59 36.3856 38.0 37.8 38.0 33.6 38.0 60-64 36.75515 38.0 38.0 38.0 36.0 38.0 65-69 36.7721 38.0 38.0 38.0 36.0 38.0 70-74 36.7099 38.0 38.0 38.0 36.0 38.0 75-79 36.66615 38.0 38.0 38.0 35.8 38.0 80-84 36.52625 38.0 38.0 38.0 35.0 38.0 85-89 36.46305 38.0 38.0 38.0 34.6 38.0 90-94 36.378499999999995 38.0 38.0 38.0 34.2 38.0 95-99 36.29115 38.0 38.0 38.0 34.0 38.0 100-104 36.147000000000006 38.0 38.0 38.0 34.0 38.0 105-109 36.0145 38.0 38.0 38.0 33.6 38.0 110-114 35.89895 38.0 38.0 38.0 33.2 38.0 115-119 35.7055 38.0 38.0 38.0 32.4 38.0 120-124 35.4251 38.0 37.0 38.0 31.0 38.0 125-129 35.2444 38.0 36.8 38.0 30.0 38.0 130-134 34.892399999999995 38.0 36.0 38.0 28.0 38.0 135-139 34.7154 38.0 36.0 38.0 28.0 38.0 140-144 34.3309 38.0 35.6 38.0 25.6 38.0 145-149 33.822649999999996 38.0 35.0 38.0 21.8 38.0 150-151 30.212625000000003 36.5 29.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 4.0 4 2.0 5 3.0 6 0.0 7 2.0 8 0.0 9 1.0 10 0.0 11 2.0 12 4.0 13 2.0 14 2.0 15 4.0 16 4.0 17 8.0 18 7.0 19 12.0 20 4.0 21 16.0 22 9.0 23 14.0 24 12.0 25 13.0 26 24.0 27 26.0 28 19.0 29 28.0 30 44.0 31 42.0 32 63.0 33 80.0 34 105.0 35 216.0 36 530.0 37 2686.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.49687108886108 22.40300375469337 13.041301627033791 27.058823529411764 2 29.534068136272545 26.553106212424847 27.980961923847698 15.931863727454909 3 20.240480961923847 28.53206412825651 31.713426853707418 19.514028056112224 4 23.39679358717435 35.49599198396793 23.822645290581164 17.284569138276552 5 24.19839679358717 36.573146292585164 21.8937875751503 17.334669338677354 6 21.201501877346686 37.29662077596996 23.30413016270338 18.197747183979978 7 18.89862327909887 22.878598247809762 37.82227784730914 20.40050062578223 8 22.94794794794795 24.574574574574577 27.3023023023023 25.175175175175173 9 21.871871871871875 25.650650650650654 29.554554554554553 22.922922922922922 10-14 23.403083700440526 28.939727673207848 26.441730076091307 21.215458550260312 15-19 22.688360450563206 27.9549436795995 27.759699624530665 21.59699624530663 20-24 23.001051419416214 28.002803785109897 27.612276573374057 21.383868222099835 25-29 23.338841319913875 28.025637173902158 27.740223323819542 20.895298182364428 30-34 23.039559339008512 27.896845267901853 27.516274411617424 21.54732098147221 35-39 22.97716803524935 27.693771279791708 27.738834368115363 21.59022631684358 40-44 23.35419274092616 28.32040050062578 27.459324155193993 20.866082603254068 45-49 23.833600320384463 27.578093712454947 27.41289547456948 21.17541049259111 50-54 22.61261261261261 28.343343343343342 27.47747747747748 21.566566566566568 55-59 23.663663663663666 27.972972972972972 27.442442442442445 20.92092092092092 60-64 23.351854632827752 27.952144966711717 27.291385092856785 21.404615307603745 65-69 23.221704960704812 27.661811082745157 27.556690193722783 21.55979376282725 70-74 23.745869630519675 27.57084209472314 27.350555722439168 21.332732552318014 75-79 23.380394512866726 27.926304195454087 28.011414839291078 20.681886452388103 80-84 23.076152806288487 27.787513142742704 27.82256045661643 21.313773594352377 85-89 23.827166675011267 27.737445551494517 27.371952135382767 21.06343563811145 90-94 23.251389375657137 28.112952485855907 27.957742952986532 20.677915185500424 95-99 22.73273273273273 28.258258258258255 28.243243243243242 20.765765765765764 100-104 23.98898898898899 28.073073073073076 27.27727727727728 20.66066066066066 105-109 23.800230195666316 28.33408397137567 27.263173697642994 20.602512135315017 110-114 23.657205786654654 27.74690894528708 27.591730490063572 21.004154777994692 115-119 23.343011613936724 28.118742490989185 27.738285943131757 20.79995995194233 120-124 24.615769712140175 27.729662077596995 27.2090112640801 20.445556946182727 125-129 24.332849346617934 27.72743203324488 27.707404996745606 20.23231362339158 130-134 23.81214639763681 28.09292544935663 27.44204676313022 20.65288138987633 135-139 24.374123773282598 28.029240937312238 27.27818946525135 20.318445824153816 140-144 24.067677829503932 27.82700105120889 27.611753516544024 20.493567602743155 145-149 24.75975975975976 27.807807807807805 27.24224224224224 20.19019019019019 150-151 24.296611229210953 28.49818682005752 26.92259597349006 20.282605977241467 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 4.0 1 2.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.5 25 1.5 26 4.0 27 5.5 28 4.5 29 4.0 30 6.0 31 10.5 32 22.0 33 32.5 34 37.5 35 52.0 36 69.0 37 92.5 38 124.0 39 163.5 40 204.0 41 222.0 42 258.0 43 289.5 44 294.0 45 287.5 46 282.5 47 272.5 48 237.5 49 204.5 50 175.5 51 144.5 52 121.5 53 103.5 54 71.5 55 47.0 56 38.5 57 28.5 58 20.5 59 15.5 60 11.5 61 9.5 62 5.0 63 3.5 64 3.5 65 2.0 66 3.5 67 3.0 68 0.5 69 0.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.2 3 0.2 4 0.2 5 0.2 6 0.125 7 0.125 8 0.1 9 0.1 10-14 0.12 15-19 0.125 20-24 0.135 25-29 0.145 30-34 0.15 35-39 0.13999999999999999 40-44 0.125 45-49 0.12 50-54 0.1 55-59 0.1 60-64 0.11499999999999999 65-69 0.11499999999999999 70-74 0.13 75-79 0.13 80-84 0.135 85-89 0.135 90-94 0.135 95-99 0.1 100-104 0.1 105-109 0.08499999999999999 110-114 0.11499999999999999 115-119 0.12 120-124 0.125 125-129 0.135 130-134 0.135 135-139 0.13999999999999999 140-144 0.11499999999999999 145-149 0.1 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64850615114236 99.225 2 0.3012804418779814 0.6 3 0.025106703489831784 0.075 4 0.025106703489831784 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.3875 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.45 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.6625000000000001 0.0 0.0 0.0 0.0 108-109 0.7875000000000001 0.0 0.0 0.0 0.0 110-111 0.9125 0.0 0.0 0.0 0.0 112-113 1.0375 0.0 0.0 0.0 0.0 114-115 1.2375 0.0 0.0 0.0 0.0 116-117 1.4249999999999998 0.0 0.0 0.0 0.0 118-119 1.6 0.0 0.0 0.0 0.0 120-121 1.7625 0.0 0.0 0.0 0.0 122-123 1.9 0.0 0.0 0.0 0.0 124-125 2.0 0.0 0.0 0.0 0.0 126-127 2.2125 0.0 0.0 0.0 0.0 128-129 2.4000000000000004 0.0 0.0 0.0 0.0 130-131 2.6625 0.0 0.0 0.0 0.0 132-133 2.9875 0.0 0.0 0.0 0.0 134-135 3.2375 0.0 0.0 0.0 0.0 136-137 3.575 0.0 0.0 0.0 0.0 138-139 3.8499999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGATGAA 10 0.00682755 145.0 5 AGCAGGC 10 0.00682755 145.0 9 TTGGTAT 10 0.00682755 145.0 3 >>END_MODULE Read 924476 spots for SRR7169629.sra Written 924476 spots for SRR7169629.sra Read 924476 spots for SRR7169629.sra Written 924476 spots for SRR7169629.sra Read 924476 spots for SRR7169629.sra Written 924476 spots for SRR7169629.sra Read 924476 spots for SRR7169629.sra Written 924476 spots for SRR7169629.sra Read 924476 spots for SRR7169629.sra Written 924476 spots for SRR7169629.sra Read 924490 spots for SRR7169629.sra Written 924490 spots for SRR7169629.sra Read 924476 spots for SRR7169629.sra Written 924476 spots for SRR7169629.sra Read 924476 spots for SRR7169629.sra Written 924476 spots for SRR7169629.sra Read 924476 spots for SRR7169629.sra Written 924476 spots for SRR7169629.sra Read 924476 spots for SRR7169629.sra Written 924476 spots for SRR7169629.sra Read 924476 spots for SRR7169629.sra Written 924476 spots for SRR7169629.sra Read 924476 spots for SRR7169629.sra Written 924476 spots for SRR7169629.sra Read 924476 spots for SRR7169629.sra Written 924476 spots for SRR7169629.sra Read 924476 spots for SRR7169629.sra Written 924476 spots for SRR7169629.sra Read 924476 spots for SRR7169629.sra Written 924476 spots for SRR7169629.sra Read 924476 spots for SRR7169629.sra Written 924476 spots for SRR7169629.sra Read 924476 spots for SRR7169629.sra Written 924476 spots for SRR7169629.sra Read 924476 spots for SRR7169629.sra Written 924476 spots for SRR7169629.sra Read 924476 spots for SRR7169629.sra Written 924476 spots for SRR7169629.sra Read 924476 spots for SRR7169629.sra Written 924476 spots for SRR7169629.sra SRR ids: ['SRR7169629.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nkg915zw SRR7169629.sra spots: 18489534 blocks: [[1, 924476], [924477, 1848952], [1848953, 2773428], [2773429, 3697904], [3697905, 4622380], [4622381, 5546856], [5546857, 6471332], [6471333, 7395808], [7395809, 8320284], [8320285, 9244760], [9244761, 10169236], [10169237, 11093712], [11093713, 12018188], [12018189, 12942664], [12942665, 13867140], [13867141, 14791616], [14791617, 15716092], [15716093, 16640568], [16640569, 17565044], [17565045, 18489534]] SRR7169629 file size 6243796 SRR7169629 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169629 SRR7169629_1.fastq SRR7169629_2.fastq Input file: SRR7169629_1.fastq Paired file: SRR7169629_2.fastq trimmed: SRR7169629-trimmed-pair1.fastq, SRR7169629-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 11:43:57 2025 >> started Tue Feb 11 11:44:16 2025 >> done (19.369s) 18489534 read pairs processed; of these: 17617 ( 0.10%) short read pairs filtered out after trimming by size control 52902 ( 0.29%) empty read pairs filtered out after trimming by size control 18419015 (99.62%) read pairs available; of these: 7475003 (40.58%) trimmed read pairs available after processing 10944012 (59.42%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 5 0.00% 20 4 0.00% 21 4 0.00% 22 7 0.00% 23 2 0.00% 24 4 0.00% 25 5 0.00% 26 7 0.00% 27 11 0.00% 28 15 0.00% 29 12 0.00% 30 11 0.00% 31 9 0.00% 32 8 0.00% 33 16 0.00% 34 14 0.00% 35 13 0.00% 36 12 0.00% 37 16 0.00% 38 14 0.00% 39 22 0.00% 40 12 0.00% 41 33 0.00% 42 34 0.00% 43 26 0.00% 44 16 0.00% 45 16 0.00% 46 27 0.00% 47 44 0.00% 48 52 0.00% 49 43 0.00% 50 48 0.00% 51 65 0.00% 52 62 0.00% 53 76 0.00% 54 83 0.00% 55 100 0.00% 56 103 0.00% 57 106 0.00% 58 126 0.00% 59 117 0.00% 60 192 0.00% 61 175 0.00% 62 185 0.00% 63 231 0.00% 64 274 0.00% 65 279 0.00% 66 362 0.00% 67 387 0.00% 68 461 0.00% 69 803 0.00% 70 1231 0.01% 71 994 0.01% 72 817 0.00% 73 832 0.00% 74 871 0.00% 75 952 0.01% 76 982 0.01% 77 1169 0.01% 78 1313 0.01% 79 1371 0.01% 80 1640 0.01% 81 1892 0.01% 82 2047 0.01% 83 2449 0.01% 84 3443 0.02% 85 3964 0.02% 86 4201 0.02% 87 4386 0.02% 88 4803 0.03% 89 5022 0.03% 90 5393 0.03% 91 5774 0.03% 92 6122 0.03% 93 6680 0.04% 94 7044 0.04% 95 7469 0.04% 96 7831 0.04% 97 8523 0.05% 98 8799 0.05% 99 9104 0.05% 100 9822 0.05% 101 10443 0.06% 102 11188 0.06% 103 12031 0.07% 104 12738 0.07% 105 13485 0.07% 106 13919 0.08% 107 14689 0.08% 108 15299 0.08% 109 15892 0.09% 110 16688 0.09% 111 17552 0.10% 112 18347 0.10% 113 19699 0.11% 114 20424 0.11% 115 22173 0.12% 116 23053 0.13% 117 23924 0.13% 118 24944 0.14% 119 25680 0.14% 120 26660 0.14% 121 28264 0.15% 122 29497 0.16% 123 31152 0.17% 124 33240 0.18% 125 34363 0.19% 126 36254 0.20% 127 38562 0.21% 128 40226 0.22% 129 41869 0.23% 130 43626 0.24% 131 46204 0.25% 132 49246 0.27% 133 52144 0.28% 134 55436 0.30% 135 59819 0.32% 136 63433 0.34% 137 68289 0.37% 138 73412 0.40% 139 77215 0.42% 140 83200 0.45% 141 90102 0.49% 142 99331 0.54% 143 112804 0.61% 144 129878 0.71% 145 153629 0.83% 146 189765 1.03% 147 256213 1.39% 148 381652 2.07% 149 735922 4.00% 150 3849732 20.90% 151 10944012 59.42% 18419015 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.66 fanout-score-rank=33 prefix-density=0.20 prefix-fanout=2.4 sequence=CTGGCCATTCAATGTGACATCCTCTTGAGTGGCTTTCAAAAGCCTGATAAAAACGCTGAACTGACCACCTTTTTCTAGGACTTTGGTGACATTGGTTGGACCGGGTGGTGCTGGGGCTGCAGCTGGTGACTGAGCTAGGGTTGGAGGGCAATGAAGAA criterion=fanout-score sequence-density=0.09 sequence-density-rank=14 fanout-score=273.23 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=29.1 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=36 prefix-density=0.42 prefix-fanout=2.2 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=18 fanout-score=208.54 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=24.6 sequence=GAAGAAGAAGAAA SRR7169629 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 11:44:56 Started mapping on | Feb 11 11:44:56 Finished on | Feb 11 11:46:35 Mapping speed, Million of reads per hour | 669.78 Number of input reads | 18419015 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 17627217 Uniquely mapped reads % | 95.70% Average mapped length | 295.69 Number of splices: Total | 17130788 Number of splices: Annotated (sjdb) | 16843521 Number of splices: GT/AG | 16879050 Number of splices: GC/AG | 202455 Number of splices: AT/AC | 14628 Number of splices: Non-canonical | 34655 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 324803 % of reads mapped to multiple loci | 1.76% Number of reads mapped to too many loci | 36863 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.29% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 484968 484968 484968 N_multimapping 324803 324803 324803 N_noFeature 424759 17431886 526763 N_ambiguous 166491 1060 72345 UnstrandedReadsAssigned:17035967 PositiveStrandReadsAssigned:194271 NegativeStrandReadsAssigned:17028109 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169629 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169629-trimmed-pair1.fastq SRR7169629-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,419,015 reads, 16,904,971 reads pseudoaligned [quant] estimated average fragment length: 260.499 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,138 rounds 52401 SRR7169629.ke.tsv 34699 SRR7169629.se.tsv 87100 total ==> SRR7169629.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1758.5 307 10.1519 Potri.005G024800.1.v4.1 1035 775.501 52 3.89918 Potri.004G059700.1.v4.1 961 701.55 1 0.0828884 Potri.007G009000.2.v4.1 1416 1156.5 0 0 Potri.003G141000.2.v4.1 2943 2683.5 346.068 7.49915 Potri.016G087400.1.v4.1 270 73.9212 1298.55 1021.51 Potri.015G069301.1.v4.1 564 312.55 0 0 Potri.010G195200.1.v4.1 1773 1513.5 33 1.2679 Potri.012G127500.1.v4.1 977 717.523 6883 557.82 ==> SRR7169629.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1237 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 324 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 15 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169629 completed mapping pipeline successfully