Starting /dee2/code/volunteer_pipeline.sh SRR7169630 current disk space = 3052492783616 free memory = 1415841408 SRR7169630 SRAfilesize b82ec9c0cc420a46c35ccce816d47a43 SRR7169630.sra SRR7169630.sra file validated SRR7169630 is paired end SRR7169630 is conventional basespace SRR7169630 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169630_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.85925 34.0 33.0 34.0 33.0 34.0 2 33.387 34.0 34.0 34.0 33.0 34.0 3 33.47925 34.0 34.0 34.0 33.0 34.0 4 33.52275 34.0 34.0 34.0 33.0 34.0 5 33.52675 34.0 34.0 34.0 33.0 34.0 6 37.0585 38.0 37.0 38.0 36.0 38.0 7 37.41475 38.0 38.0 38.0 37.0 38.0 8 37.41975 38.0 38.0 38.0 37.0 38.0 9 37.507 38.0 38.0 38.0 37.0 38.0 10-14 37.529399999999995 38.0 38.0 38.0 37.4 38.0 15-19 37.49425 38.0 38.0 38.0 37.8 38.0 20-24 37.494400000000006 38.0 38.0 38.0 37.8 38.0 25-29 37.515150000000006 38.0 38.0 38.0 37.6 38.0 30-34 37.4738 38.0 38.0 38.0 37.2 38.0 35-39 37.2413 38.0 38.0 38.0 36.6 38.0 40-44 37.3621 38.0 38.0 38.0 37.0 38.0 45-49 37.289049999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.25385 38.0 38.0 38.0 36.6 38.0 55-59 37.179700000000004 38.0 38.0 38.0 36.2 38.0 60-64 37.171299999999995 38.0 38.0 38.0 36.0 38.0 65-69 37.10315000000001 38.0 38.0 38.0 36.0 38.0 70-74 37.01904999999999 38.0 38.0 38.0 36.0 38.0 75-79 36.9634 38.0 38.0 38.0 36.0 38.0 80-84 36.924800000000005 38.0 38.0 38.0 35.6 38.0 85-89 36.85745 38.0 38.0 38.0 35.6 38.0 90-94 36.72455 38.0 38.0 38.0 34.8 38.0 95-99 36.647149999999996 38.0 38.0 38.0 34.8 38.0 100-104 36.550850000000004 38.0 38.0 38.0 34.2 38.0 105-109 36.4521 38.0 38.0 38.0 34.0 38.0 110-114 36.26345 38.0 37.8 38.0 34.0 38.0 115-119 36.025999999999996 38.0 37.0 38.0 33.0 38.0 120-124 35.94185 38.0 37.0 38.0 32.8 38.0 125-129 35.69775 38.0 36.2 38.0 31.0 38.0 130-134 35.43795 38.0 36.0 38.0 30.4 38.0 135-139 35.2087 38.0 36.0 38.0 30.0 38.0 140-144 34.825 38.0 35.2 38.0 28.2 38.0 145-149 34.25835 38.0 35.0 38.0 26.8 38.0 150-151 31.098750000000003 36.5 31.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 1.0 15 1.0 16 2.0 17 1.0 18 4.0 19 3.0 20 5.0 21 1.0 22 5.0 23 7.0 24 7.0 25 15.0 26 14.0 27 19.0 28 24.0 29 23.0 30 41.0 31 54.0 32 58.0 33 97.0 34 127.0 35 228.0 36 631.0 37 2630.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.089171974522294 12.687898089171975 8.433121019108281 36.789808917197455 2 23.5 14.075 33.050000000000004 29.375 3 21.275 17.849999999999998 25.924999999999997 34.949999999999996 4 24.6 25.4 23.05 26.950000000000003 5 24.55 29.2 23.974999999999998 22.275 6 20.25 33.650000000000006 24.675 21.425 7 14.2 29.049999999999997 40.375 16.375 8 19.15 25.275 31.15 24.425 9 17.625 24.85 33.45 24.075 10-14 19.675 30.349999999999998 27.339999999999996 22.634999999999998 15-19 20.23 28.78 27.495000000000005 23.494999999999997 20-24 20.165 28.96 27.43 23.445 25-29 20.055 28.475 27.495000000000005 23.974999999999998 30-34 20.515 28.485 27.395000000000003 23.605 35-39 20.707247536637823 28.079827939778923 27.279547841744613 23.933376681838645 40-44 19.7 28.79 27.275 24.235 45-49 20.32 28.07 27.425 24.185000000000002 50-54 20.62 28.42 27.235 23.724999999999998 55-59 20.69 27.83 27.650000000000002 23.830000000000002 60-64 20.0 28.64 26.915 24.445 65-69 20.865000000000002 27.82 27.365000000000002 23.95 70-74 20.735 27.79 27.72 23.755000000000003 75-79 20.03 28.005000000000003 27.834999999999997 24.13 80-84 20.5 27.755000000000003 27.74 24.005000000000003 85-89 20.21 28.27 27.93 23.59 90-94 20.635 28.28 26.99 24.095 95-99 20.465 27.955000000000002 27.36 24.22 100-104 20.424999999999997 28.68 26.939999999999998 23.955000000000002 105-109 20.380000000000003 28.075 27.435 24.11 110-114 20.285 27.565 27.77 24.38 115-119 20.724999999999998 28.115000000000002 27.175 23.985 120-124 20.455000000000002 27.625 27.474999999999998 24.445 125-129 20.925 27.915 27.175 23.985 130-134 20.91 27.965 27.189999999999998 23.935000000000002 135-139 21.54 27.744999999999997 27.185 23.53 140-144 21.15 27.825 26.985 24.04 145-149 21.765 27.985 27.029999999999998 23.22 150-151 21.337500000000002 26.950000000000003 26.887499999999996 24.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 1.5 23 2.5 24 2.5 25 2.5 26 2.5 27 3.0 28 7.0 29 11.5 30 12.5 31 18.0 32 23.5 33 30.0 34 39.5 35 50.5 36 70.0 37 87.5 38 124.0 39 168.5 40 193.0 41 211.0 42 238.0 43 259.5 44 260.0 45 255.5 46 265.0 47 274.0 48 269.0 49 236.5 50 194.0 51 161.0 52 124.5 53 94.0 54 74.0 55 62.0 56 43.5 57 28.5 58 25.0 59 23.0 60 18.5 61 12.5 62 5.5 63 3.0 64 2.0 65 1.0 66 1.0 67 1.5 68 1.0 69 1.0 70 1.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.875 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.034999999999999996 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57297161517207 99.1 2 0.37678975131876413 0.75 3 0.050238633509168545 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.36250000000000004 0.0 0.0 0.0 0.0 94-95 0.45 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 0.825 0.0 0.0 0.0 0.0 104-105 0.825 0.0 0.0 0.0 0.0 106-107 0.9125 0.0 0.0 0.0 0.0 108-109 1.1125 0.0 0.0 0.0 0.0 110-111 1.2875 0.0 0.0 0.0 0.0 112-113 1.5 0.0 0.0 0.0 0.0 114-115 1.6 0.0 0.0 0.0 0.0 116-117 1.7875 0.0 0.0 0.0 0.0 118-119 2.075 0.0 0.0 0.0 0.0 120-121 2.3875 0.0 0.0 0.0 0.0 122-123 2.5625 0.0 0.0 0.0 0.0 124-125 2.875 0.0 0.0 0.0 0.0 126-127 3.2 0.0 0.0 0.0 0.0 128-129 3.6375 0.0 0.0 0.0 0.0 130-131 4.0 0.0 0.0 0.0 0.0 132-133 4.362500000000001 0.0 0.0 0.0 0.0 134-135 4.7125 0.0 0.0 0.0 0.0 136-137 5.15 0.0 0.0 0.0 0.0 138-139 5.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTCACT 10 0.006577216 146.82278 1 >>END_MODULE SRR7169630 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169630_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.95975 33.0 33.0 34.0 32.0 34.0 2 33.09825 34.0 33.0 34.0 32.0 34.0 3 33.173 34.0 33.0 34.0 33.0 34.0 4 33.14725 34.0 33.0 34.0 33.0 34.0 5 33.11375 34.0 33.0 34.0 33.0 34.0 6 37.36025 38.0 38.0 38.0 37.0 38.0 7 37.30825 38.0 38.0 38.0 37.0 38.0 8 37.342 38.0 38.0 38.0 37.0 38.0 9 37.336 38.0 38.0 38.0 37.0 38.0 10-14 37.27825 38.0 38.0 38.0 37.0 38.0 15-19 37.21535 38.0 38.0 38.0 37.0 38.0 20-24 37.243849999999995 38.0 38.0 38.0 37.0 38.0 25-29 37.220499999999994 38.0 38.0 38.0 37.0 38.0 30-34 37.1299 38.0 38.0 38.0 37.0 38.0 35-39 37.08815 38.0 38.0 38.0 36.8 38.0 40-44 37.114650000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.11035 38.0 38.0 38.0 36.8 38.0 50-54 37.14084999999999 38.0 38.0 38.0 37.0 38.0 55-59 36.927550000000004 38.0 38.0 38.0 36.0 38.0 60-64 37.0621 38.0 38.0 38.0 36.8 38.0 65-69 37.06255 38.0 38.0 38.0 36.2 38.0 70-74 36.90575 38.0 38.0 38.0 36.0 38.0 75-79 36.858050000000006 38.0 38.0 38.0 36.0 38.0 80-84 36.715199999999996 38.0 38.0 38.0 35.4 38.0 85-89 36.644400000000005 38.0 38.0 38.0 35.0 38.0 90-94 36.61795 38.0 38.0 38.0 35.0 38.0 95-99 36.608050000000006 38.0 38.0 38.0 35.0 38.0 100-104 36.4557 38.0 38.0 38.0 34.4 38.0 105-109 36.45105 38.0 38.0 38.0 34.0 38.0 110-114 36.27825 38.0 38.0 38.0 34.0 38.0 115-119 36.1719 38.0 38.0 38.0 34.0 38.0 120-124 35.9949 38.0 37.8 38.0 33.2 38.0 125-129 35.65565 38.0 37.0 38.0 31.6 38.0 130-134 35.5415 38.0 36.8 38.0 31.2 38.0 135-139 35.22685 38.0 36.0 38.0 31.0 38.0 140-144 34.74655 38.0 35.8 38.0 28.0 38.0 145-149 34.24865 38.0 35.6 38.0 25.8 38.0 150-151 30.785125 36.5 29.5 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 5.0 4 0.0 5 0.0 6 1.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 3.0 13 2.0 14 1.0 15 3.0 16 2.0 17 6.0 18 3.0 19 7.0 20 5.0 21 8.0 22 8.0 23 10.0 24 14.0 25 14.0 26 16.0 27 22.0 28 18.0 29 27.0 30 42.0 31 43.0 32 71.0 33 86.0 34 116.0 35 172.0 36 472.0 37 2819.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.8 21.825 13.625000000000002 27.750000000000004 2 28.125 27.250000000000004 27.925 16.7 3 20.575 29.425 30.325000000000003 19.675 4 23.825 33.675 23.375 19.125 5 24.525 35.05 23.0 17.424999999999997 6 20.965724293219914 38.003502626970224 21.691268451338505 19.339504628471353 7 19.549436795994993 21.952440550688358 38.62327909887359 19.874843554443054 8 22.66700025018764 26.695021265949464 26.019514635976982 24.618463847885916 9 20.515386539904927 26.1195896922692 29.572179134350762 23.792844633475106 10-14 23.054206917263127 29.831322889033483 25.73201861955053 21.38245157415286 15-19 23.436092483234912 27.449704734260834 27.52977679911921 21.584425983385046 20-24 23.004154362080182 28.25466740077081 27.558936883727913 21.18224135342109 25-29 22.94409129586065 28.71014565293558 27.093448120526553 21.252314930677212 30-34 22.781198378134853 27.992191019672624 27.73189167542674 21.49471892676578 35-39 23.367198838896954 28.03163004854612 27.451078524598366 21.15009258795856 40-44 23.274783566031125 28.09387979782815 27.87369263874293 20.757643997397786 45-49 23.88171720204143 27.654358050635448 27.33913739617733 21.1247873511458 50-54 23.39786882785532 28.465656110860976 27.269998499174548 20.86647656210916 55-59 23.670385750737978 28.323410216640816 27.35778255866313 20.648421473958074 60-64 23.346342439707797 28.62003402381667 26.818773141198836 21.214850395276695 65-69 23.417563172379285 28.331248436327243 27.425569176882664 20.82561921441081 70-74 23.670119601661412 27.528399139268377 27.908722414051944 20.892758845018268 75-79 23.60270202651989 27.795846885163872 27.835876907680763 20.765574180635475 80-84 23.882688554126418 27.696311495921126 27.325959661678596 21.09504028827386 85-89 23.820967257434663 27.470711925503156 27.801141483929108 20.907179333133072 90-94 23.97496871088861 27.49436795994994 27.819774718397998 20.710888610763455 95-99 23.844075260208168 27.787229783827062 27.426941553242596 20.941753402722178 100-104 24.5221655158611 27.67437206044231 27.409186430501354 20.394275993195237 105-109 23.74305868227525 27.73025163840112 27.480114062734508 21.046575616589124 110-114 24.225746735377996 27.84309801370891 27.052584179716817 20.878571071196276 115-119 24.105668684645018 27.83309150948116 27.858107770050534 20.203132035823284 120-124 24.447112979085357 28.109676773741622 26.83378364855399 20.60942659861903 125-129 23.76282211658744 28.391293470102575 27.350512884663498 20.495371528646487 130-134 24.85364023017263 28.016012009006758 26.705028771578682 20.42531898924193 135-139 24.310664064454787 27.633488465195416 27.138067357253664 20.917780113096132 140-144 24.337035925147603 27.984589212448714 26.983888722105476 20.69448614029821 145-149 24.892446223111556 28.114057028514257 26.72336168084042 20.27013506753377 150-151 25.03125781445361 27.86946736684171 26.806701675418854 20.29257314328582 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 0.5 26 0.5 27 1.5 28 3.0 29 4.0 30 8.0 31 15.0 32 21.5 33 24.5 34 36.0 35 53.5 36 74.5 37 92.0 38 118.5 39 163.0 40 199.5 41 220.5 42 253.5 43 275.5 44 280.0 45 309.5 46 305.0 47 266.5 48 249.5 49 217.0 50 176.0 51 145.5 52 109.5 53 92.5 54 78.0 55 59.0 56 40.0 57 27.5 58 22.5 59 14.5 60 11.5 61 8.5 62 4.5 63 4.5 64 3.0 65 1.0 66 2.0 67 1.0 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.075 7 0.125 8 0.075 9 0.075 10-14 0.105 15-19 0.09 20-24 0.105 25-29 0.105 30-34 0.11499999999999999 35-39 0.095 40-44 0.08499999999999999 45-49 0.06999999999999999 50-54 0.055 55-59 0.065 60-64 0.06999999999999999 65-69 0.075 70-74 0.08499999999999999 75-79 0.075 80-84 0.095 85-89 0.13 90-94 0.125 95-99 0.08 100-104 0.06999999999999999 105-109 0.055 110-114 0.065 115-119 0.065 120-124 0.06999999999999999 125-129 0.075 130-134 0.075 135-139 0.08499999999999999 140-144 0.06999999999999999 145-149 0.05 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49736114601659 98.97500000000001 2 0.4775069112842423 0.95 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.775 0.0 0.0 0.0 0.0 102-103 0.8 0.0 0.0 0.0 0.0 104-105 0.8 0.0 0.0 0.0 0.0 106-107 0.8875 0.0 0.0 0.0 0.0 108-109 1.0625 0.0 0.0 0.0 0.0 110-111 1.2375 0.0 0.0 0.0 0.0 112-113 1.475 0.0 0.0 0.0 0.0 114-115 1.575 0.0 0.0 0.0 0.0 116-117 1.75 0.0 0.0 0.0 0.0 118-119 2.0 0.0 0.0 0.0 0.0 120-121 2.3125 0.0 0.0 0.0 0.0 122-123 2.4875 0.0 0.0 0.0 0.0 124-125 2.8 0.0 0.0 0.0 0.0 126-127 3.125 0.0 0.0 0.0 0.0 128-129 3.5625 0.0 0.0 0.0 0.0 130-131 3.925 0.0 0.0 0.0 0.0 132-133 4.2875 0.0 0.0 0.0 0.0 134-135 4.625 0.0 0.0 0.0 0.0 136-137 5.075 0.0 0.0 0.0 0.0 138-139 5.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 919514 spots for SRR7169630.sra Written 919514 spots for SRR7169630.sra Read 919514 spots for SRR7169630.sra Written 919514 spots for SRR7169630.sra Read 919514 spots for SRR7169630.sra Written 919514 spots for SRR7169630.sra Read 919514 spots for SRR7169630.sra Written 919514 spots for SRR7169630.sra Read 919514 spots for SRR7169630.sra Written 919514 spots for SRR7169630.sra Read 919514 spots for SRR7169630.sra Written 919514 spots for SRR7169630.sra Read 919514 spots for SRR7169630.sra Written 919514 spots for SRR7169630.sra Read 919514 spots for SRR7169630.sra Written 919514 spots for SRR7169630.sra Read 919514 spots for SRR7169630.sra Written 919514 spots for SRR7169630.sra Read 919514 spots for SRR7169630.sra Written 919514 spots for SRR7169630.sra Read 919514 spots for SRR7169630.sra Written 919514 spots for SRR7169630.sra Read 919514 spots for SRR7169630.sra Written 919514 spots for SRR7169630.sra Read 919514 spots for SRR7169630.sra Written 919514 spots for SRR7169630.sra Read 919514 spots for SRR7169630.sra Written 919514 spots for SRR7169630.sra Read 919514 spots for SRR7169630.sra Written 919514 spots for SRR7169630.sra Read 919514 spots for SRR7169630.sra Written 919514 spots for SRR7169630.sra Read 919527 spots for SRR7169630.sra Written 919527 spots for SRR7169630.sra Read 919514 spots for SRR7169630.sra Written 919514 spots for SRR7169630.sra Read 919514 spots for SRR7169630.sra Written 919514 spots for SRR7169630.sra Read 919514 spots for SRR7169630.sra Written 919514 spots for SRR7169630.sra SRR ids: ['SRR7169630.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_h4kc1467 SRR7169630.sra spots: 18390293 blocks: [[1, 919514], [919515, 1839028], [1839029, 2758542], [2758543, 3678056], [3678057, 4597570], [4597571, 5517084], [5517085, 6436598], [6436599, 7356112], [7356113, 8275626], [8275627, 9195140], [9195141, 10114654], [10114655, 11034168], [11034169, 11953682], [11953683, 12873196], [12873197, 13792710], [13792711, 14712224], [14712225, 15631738], [15631739, 16551252], [16551253, 17470766], [17470767, 18390293]] SRR7169630 file size 6210166 SRR7169630 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169630 SRR7169630_1.fastq SRR7169630_2.fastq Input file: SRR7169630_1.fastq Paired file: SRR7169630_2.fastq trimmed: SRR7169630-trimmed-pair1.fastq, SRR7169630-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 11:05:43 2025 >> started Tue Feb 11 11:06:14 2025 >> done (31.396s) 18390293 read pairs processed; of these: 33486 ( 0.18%) short read pairs filtered out after trimming by size control 36813 ( 0.20%) empty read pairs filtered out after trimming by size control 18319994 (99.62%) read pairs available; of these: 8749177 (47.76%) trimmed read pairs available after processing 9570817 (52.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 6 0.00% 20 5 0.00% 21 6 0.00% 22 8 0.00% 23 6 0.00% 24 7 0.00% 25 10 0.00% 26 6 0.00% 27 7 0.00% 28 9 0.00% 29 5 0.00% 30 8 0.00% 31 9 0.00% 32 11 0.00% 33 12 0.00% 34 10 0.00% 35 10 0.00% 36 10 0.00% 37 10 0.00% 38 23 0.00% 39 18 0.00% 40 15 0.00% 41 22 0.00% 42 20 0.00% 43 32 0.00% 44 33 0.00% 45 33 0.00% 46 56 0.00% 47 40 0.00% 48 43 0.00% 49 58 0.00% 50 69 0.00% 51 64 0.00% 52 76 0.00% 53 87 0.00% 54 79 0.00% 55 118 0.00% 56 109 0.00% 57 127 0.00% 58 139 0.00% 59 149 0.00% 60 189 0.00% 61 214 0.00% 62 243 0.00% 63 288 0.00% 64 285 0.00% 65 359 0.00% 66 404 0.00% 67 489 0.00% 68 614 0.00% 69 1008 0.01% 70 1066 0.01% 71 817 0.00% 72 865 0.00% 73 938 0.01% 74 1102 0.01% 75 1223 0.01% 76 1338 0.01% 77 1485 0.01% 78 1617 0.01% 79 1847 0.01% 80 2055 0.01% 81 2339 0.01% 82 2812 0.02% 83 3141 0.02% 84 4118 0.02% 85 4695 0.03% 86 4911 0.03% 87 5421 0.03% 88 6069 0.03% 89 6467 0.04% 90 6640 0.04% 91 7304 0.04% 92 8053 0.04% 93 8545 0.05% 94 9426 0.05% 95 9709 0.05% 96 10708 0.06% 97 11037 0.06% 98 11865 0.06% 99 12127 0.07% 100 12924 0.07% 101 13848 0.08% 102 15036 0.08% 103 15999 0.09% 104 17026 0.09% 105 18257 0.10% 106 19139 0.10% 107 19887 0.11% 108 20322 0.11% 109 21174 0.12% 110 22046 0.12% 111 23330 0.13% 112 24791 0.14% 113 26463 0.14% 114 27448 0.15% 115 28815 0.16% 116 30338 0.17% 117 31187 0.17% 118 32706 0.18% 119 33257 0.18% 120 34523 0.19% 121 35665 0.19% 122 37456 0.20% 123 39694 0.22% 124 41681 0.23% 125 43294 0.24% 126 45948 0.25% 127 48199 0.26% 128 49558 0.27% 129 51624 0.28% 130 54367 0.30% 131 56609 0.31% 132 59435 0.32% 133 63182 0.34% 134 67486 0.37% 135 71558 0.39% 136 76360 0.42% 137 81674 0.45% 138 87272 0.48% 139 92655 0.51% 140 99368 0.54% 141 107974 0.59% 142 119276 0.65% 143 133648 0.73% 144 153733 0.84% 145 181464 0.99% 146 222840 1.22% 147 303308 1.66% 148 469087 2.56% 149 942846 5.15% 150 4268002 23.30% 151 9570817 52.24% 18319994 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=38 prefix-density=0.24 prefix-fanout=2.2 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=366.02 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=18.0 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCAGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTAACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTT criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=9.55 fanout-score-rank=8 prefix-density=0.35 prefix-fanout=6.0 sequence=TCAATGCTGTTGGAGGTGGTACTGGTTCTGGTCTTGGGTCACTTCTCCTGGAGAGGCTCTCTGTTGACTATGGCAAA criterion=fanout-score sequence-density=0.05 sequence-density-rank=40 fanout-score=34.33 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=5.8 sequence=CTCTTCTTTTCTCCCGGAAAATGGCCGGTTTAATTTCAAGATCAGTTCCTTGTGCAATCCTAGTAGTCTTGTGCACGGTGGTGCCCATTTTGGCTAAAGATCACACTGTAGGAGATAGTTCAGGCTGGGCAATTGGTATGGATTATAGCACCTGGACTAGTGGCAAGACCTTTTCAGTTGGCGACAGCCTTGTGTTTAACTACGGAGGAGGCCACACGGTGGATGAAGTGAG SRR7169630 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 11:07:08 Started mapping on | Feb 11 11:07:08 Finished on | Feb 11 11:09:27 Mapping speed, Million of reads per hour | 474.47 Number of input reads | 18319994 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 17481998 Uniquely mapped reads % | 95.43% Average mapped length | 294.41 Number of splices: Total | 16176458 Number of splices: Annotated (sjdb) | 15882945 Number of splices: GT/AG | 15954302 Number of splices: GC/AG | 173909 Number of splices: AT/AC | 13411 Number of splices: Non-canonical | 34836 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.02% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 301646 % of reads mapped to multiple loci | 1.65% Number of reads mapped to too many loci | 21114 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.77% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 550225 550225 550225 N_multimapping 301646 301646 301646 N_noFeature 418075 17255648 506856 N_ambiguous 210441 1088 72026 UnstrandedReadsAssigned:16853482 PositiveStrandReadsAssigned:225262 NegativeStrandReadsAssigned:16903116 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169630 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169630-trimmed-pair1.fastq SRR7169630-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,319,994 reads, 16,784,940 reads pseudoaligned [quant] estimated average fragment length: 244.586 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,061 rounds 52401 SRR7169630.ke.tsv 34699 SRR7169630.se.tsv 87100 total ==> SRR7169630.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1774.41 301 10.3899 Potri.005G024800.1.v4.1 1035 791.414 14 1.08349 Potri.004G059700.1.v4.1 961 717.479 1 0.0853669 Potri.007G009000.2.v4.1 1416 1172.41 0 0 Potri.003G141000.2.v4.1 2943 2699.41 276.059 6.26371 Potri.016G087400.1.v4.1 270 79.2518 1547 1195.58 Potri.015G069301.1.v4.1 564 325.782 0 0 Potri.010G195200.1.v4.1 1773 1529.41 10 0.400474 Potri.012G127500.1.v4.1 977 733.467 3332 278.243 ==> SRR7169630.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2919 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 279 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 46 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169630 completed mapping pipeline successfully