Starting /dee2/code/volunteer_pipeline.sh SRR7169631 current disk space = 3051713728512 free memory = 1437746236 SRR7169631 SRAfilesize a382154d0751dc2b195f891e6e0b2c59 SRR7169631.sra SRR7169631.sra file validated SRR7169631 is paired end SRR7169631 is conventional basespace SRR7169631 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169631_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.64775 34.0 33.0 34.0 33.0 34.0 2 33.32225 34.0 34.0 34.0 33.0 34.0 3 33.3625 34.0 34.0 34.0 33.0 34.0 4 33.5035 34.0 34.0 34.0 33.0 34.0 5 33.45275 34.0 34.0 34.0 33.0 34.0 6 37.03075 38.0 37.0 38.0 36.0 38.0 7 37.413 38.0 38.0 38.0 37.0 38.0 8 37.47775 38.0 38.0 38.0 37.0 38.0 9 37.464 38.0 38.0 38.0 37.0 38.0 10-14 37.558949999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.470299999999995 38.0 38.0 38.0 37.4 38.0 20-24 37.455650000000006 38.0 38.0 38.0 37.0 38.0 25-29 37.43560000000001 38.0 38.0 38.0 37.0 38.0 30-34 37.36225 38.0 38.0 38.0 37.0 38.0 35-39 37.294799999999995 38.0 38.0 38.0 36.8 38.0 40-44 37.04765 38.0 38.0 38.0 36.0 38.0 45-49 36.9186 38.0 38.0 38.0 35.4 38.0 50-54 36.783249999999995 38.0 38.0 38.0 34.6 38.0 55-59 36.745 38.0 38.0 38.0 34.8 38.0 60-64 36.65410000000001 38.0 38.0 38.0 34.2 38.0 65-69 36.5935 38.0 38.0 38.0 34.0 38.0 70-74 36.5758 38.0 38.0 38.0 34.0 38.0 75-79 36.4173 38.0 38.0 38.0 34.0 38.0 80-84 36.2689 38.0 37.0 38.0 33.4 38.0 85-89 36.23095 38.0 37.0 38.0 33.6 38.0 90-94 35.937 38.0 37.0 38.0 32.2 38.0 95-99 35.79995 38.0 37.0 38.0 31.2 38.0 100-104 35.48655 38.0 36.2 38.0 29.8 38.0 105-109 35.36095 38.0 36.0 38.0 29.0 38.0 110-114 34.97045 38.0 35.4 38.0 28.4 38.0 115-119 34.76180000000001 38.0 35.0 38.0 27.2 38.0 120-124 34.5725 38.0 35.0 38.0 26.4 38.0 125-129 34.202549999999995 38.0 34.8 38.0 24.2 38.0 130-134 33.91805000000001 38.0 34.4 38.0 22.6 38.0 135-139 33.3381 38.0 34.0 38.0 19.8 38.0 140-144 32.8969 38.0 33.4 38.0 14.6 38.0 145-149 31.959600000000002 37.2 33.0 38.0 11.4 38.0 150-151 28.175875 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 1.0 11 0.0 12 1.0 13 3.0 14 1.0 15 1.0 16 5.0 17 6.0 18 5.0 19 3.0 20 12.0 21 6.0 22 7.0 23 13.0 24 17.0 25 17.0 26 24.0 27 34.0 28 36.0 29 49.0 30 50.0 31 67.0 32 86.0 33 143.0 34 218.0 35 412.0 36 980.0 37 1801.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.23607903515525 10.854503464203233 8.442391583269181 40.46702591737234 2 21.95 13.55 35.949999999999996 28.549999999999997 3 20.075000000000003 15.775 26.150000000000002 38.0 4 24.0 25.1 23.0 27.900000000000002 5 24.25 29.549999999999997 23.05 23.150000000000002 6 19.925 35.175 24.224999999999998 20.674999999999997 7 14.325 27.175 41.425 17.075000000000003 8 17.025000000000002 25.75 32.375 24.85 9 17.224999999999998 24.825 35.225 22.725 10-14 19.695 30.099999999999998 27.005000000000003 23.200000000000003 15-19 19.509999999999998 28.110000000000003 28.265 24.115000000000002 20-24 19.64 27.985 28.225 24.15 25-29 20.285 28.605000000000004 27.650000000000002 23.46 30-34 19.555 28.660000000000004 27.529999999999998 24.255 35-39 20.285 28.62 27.345000000000002 23.75 40-44 20.13 28.494999999999997 27.500000000000004 23.875 45-49 20.669999999999998 28.470000000000002 27.075 23.785 50-54 20.16 28.27 27.42 24.15 55-59 20.424999999999997 28.315 27.200000000000003 24.060000000000002 60-64 19.985 28.76 26.900000000000002 24.355 65-69 19.945 28.18 27.71 24.165 70-74 19.955000000000002 28.52 27.41 24.115000000000002 75-79 20.23 28.82 27.11 23.84 80-84 20.580000000000002 28.15 27.605 23.665 85-89 20.175 27.97 27.860000000000003 23.995 90-94 20.155 28.410000000000004 27.46 23.974999999999998 95-99 20.71 28.46 27.245 23.585 100-104 20.25037556334502 28.753129694541812 27.200801201802705 23.795693540310467 105-109 20.055 28.065 28.215 23.665 110-114 20.431993585246065 28.154755938658916 27.92923724566503 23.48401323042999 115-119 20.654621890796257 27.7663780591562 27.50613082428307 24.072869225764475 120-124 20.79079079079079 27.792792792792792 27.992992992992992 23.423423423423422 125-129 21.027873692638742 28.619326427463342 27.158084371715958 23.194715508181954 130-134 20.669999999999998 27.839999999999996 27.894999999999996 23.595 135-139 20.715 28.415000000000003 27.265 23.605 140-144 21.5 27.735 27.250000000000004 23.515 145-149 21.075 28.000000000000004 27.66 23.265 150-151 21.025 27.3875 27.187499999999996 24.4 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 1.0 24 2.5 25 3.0 26 3.0 27 2.0 28 7.5 29 12.0 30 15.5 31 20.0 32 26.0 33 39.0 34 53.0 35 66.5 36 78.5 37 100.5 38 124.0 39 157.5 40 198.5 41 207.5 42 217.5 43 246.0 44 264.0 45 269.0 46 264.5 47 258.5 48 244.5 49 221.5 50 189.5 51 163.0 52 139.0 53 111.5 54 86.5 55 54.0 56 36.0 57 30.5 58 23.5 59 15.0 60 13.5 61 12.0 62 6.5 63 5.5 64 3.0 65 1.5 66 0.5 67 0.5 68 0.5 69 1.0 70 2.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5749999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.15 105-109 0.0 110-114 0.22999999999999998 115-119 0.095 120-124 0.1 125-129 0.08499999999999999 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.325 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.4375 0.0 0.0 0.0 0.0 110-111 0.525 0.0 0.0 0.0 0.0 112-113 0.5875 0.0 0.0 0.0 0.0 114-115 0.725 0.0 0.0 0.0 0.0 116-117 0.8 0.0 0.0 0.0 0.0 118-119 0.8875 0.0 0.0 0.0 0.0 120-121 0.95 0.0 0.0 0.0 0.0 122-123 1.0750000000000002 0.0 0.0 0.0 0.0 124-125 1.225 0.0 0.0 0.0 0.0 126-127 1.375 0.0 0.0 0.0 0.0 128-129 1.6 0.0 0.0 0.0 0.0 130-131 1.8375 0.0 0.0 0.0 0.0 132-133 2.0125 0.0 0.0 0.0 0.0 134-135 2.2 0.0 0.0 0.0 0.0 136-137 2.425 0.0 0.0 0.0 0.0 138-139 2.6624999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 50 0.0013792695 17.3055 60-64 >>END_MODULE SRR7169631 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169631_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.639 33.0 33.0 34.0 32.0 34.0 2 32.89425 34.0 33.0 34.0 32.0 34.0 3 32.9825 34.0 33.0 34.0 32.0 34.0 4 32.91075 34.0 33.0 34.0 32.0 34.0 5 32.86275 34.0 33.0 34.0 32.0 34.0 6 37.1295 38.0 38.0 38.0 37.0 38.0 7 37.10325 38.0 38.0 38.0 37.0 38.0 8 37.118 38.0 38.0 38.0 37.0 38.0 9 37.012 38.0 38.0 38.0 37.0 38.0 10-14 37.0543 38.0 38.0 38.0 37.0 38.0 15-19 37.0559 38.0 38.0 38.0 37.0 38.0 20-24 37.023199999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.0163 38.0 38.0 38.0 36.8 38.0 30-34 37.02265 38.0 38.0 38.0 36.8 38.0 35-39 37.0018 38.0 38.0 38.0 36.2 38.0 40-44 36.964150000000004 38.0 38.0 38.0 36.4 38.0 45-49 36.9555 38.0 38.0 38.0 36.2 38.0 50-54 36.73175 38.0 38.0 38.0 36.0 38.0 55-59 36.447950000000006 38.0 38.0 38.0 35.2 38.0 60-64 36.2759 38.0 38.0 38.0 34.8 38.0 65-69 36.08755 38.0 38.0 38.0 34.6 38.0 70-74 36.021699999999996 38.0 38.0 38.0 34.4 38.0 75-79 35.883799999999994 38.0 38.0 38.0 33.8 38.0 80-84 35.929500000000004 38.0 38.0 38.0 33.8 38.0 85-89 35.97835 38.0 38.0 38.0 34.0 38.0 90-94 35.98945 38.0 38.0 38.0 34.0 38.0 95-99 35.871500000000005 38.0 38.0 38.0 33.2 38.0 100-104 35.7021 38.0 38.0 38.0 32.6 38.0 105-109 35.55995 38.0 37.6 38.0 31.0 38.0 110-114 35.422450000000005 38.0 37.2 38.0 31.2 38.0 115-119 35.268600000000006 38.0 37.0 38.0 30.2 38.0 120-124 35.066849999999995 38.0 36.8 38.0 28.8 38.0 125-129 34.794149999999995 38.0 36.0 38.0 28.0 38.0 130-134 34.445049999999995 38.0 36.0 38.0 25.0 38.0 135-139 33.88245 38.0 35.6 38.0 21.8 38.0 140-144 33.484049999999996 38.0 35.0 38.0 18.4 38.0 145-149 32.636250000000004 38.0 34.8 38.0 11.2 38.0 150-151 29.018250000000002 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 2.0 4 1.0 5 2.0 6 0.0 7 1.0 8 3.0 9 2.0 10 2.0 11 3.0 12 11.0 13 13.0 14 20.0 15 5.0 16 5.0 17 2.0 18 8.0 19 4.0 20 6.0 21 10.0 22 13.0 23 16.0 24 20.0 25 24.0 26 35.0 27 38.0 28 39.0 29 43.0 30 46.0 31 51.0 32 76.0 33 90.0 34 121.0 35 193.0 36 468.0 37 2620.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.150753768844226 23.015075376884422 13.869346733668342 27.964824120603016 2 27.325 27.450000000000003 28.675 16.55 3 19.15 28.725 30.525000000000002 21.6 4 22.3 33.35 24.625 19.725 5 25.424999999999997 36.075 21.525 16.975 6 20.775 38.824999999999996 23.175 17.224999999999998 7 19.15 23.474999999999998 37.574999999999996 19.8 8 21.224999999999998 25.650000000000002 28.525 24.6 9 22.55 24.3 31.525 21.625 10-14 22.765 29.48 26.57 21.185000000000002 15-19 23.25 27.555000000000003 27.62 21.575 20-24 22.99 27.994999999999997 27.779999999999998 21.235 25-29 23.48 27.96 27.48 21.08 30-34 22.814999999999998 28.33 27.915 20.94 35-39 23.14 28.235 27.839999999999996 20.785 40-44 22.78 28.249999999999996 27.48 21.490000000000002 45-49 23.31 27.68 27.555000000000003 21.455 50-54 23.491044102152426 27.91129396417641 27.399528372886454 21.198133560784708 55-59 23.586192954970436 27.629251528781523 28.250871784504977 20.533683731743064 60-64 23.65788003453705 28.127380770988875 27.807405150083802 20.407334044390268 65-69 22.857288533115792 28.210880538418397 28.307755060419108 20.624075868046702 70-74 23.1448402572216 27.809533530672653 28.131060528733286 20.91456568337246 75-79 23.3486472690148 27.850944359367023 27.88667687595712 20.91373149566105 80-84 23.739581215694248 27.28705021345802 28.176458629802802 20.796909941044927 85-89 23.62854251012146 28.13765182186235 28.031376518218625 20.20242914979757 90-94 23.600444624090542 28.248787388843976 27.546483427647534 20.604284559417945 95-99 23.9511283889534 27.278234967435754 28.0506891503004 20.719947493310446 100-104 24.133064516129032 27.993951612903228 27.641129032258068 20.23185483870968 105-109 23.540081624426865 27.989116743084598 27.68176550612183 20.789036126366707 110-114 23.677188742888788 27.79539847958516 27.634294920203395 20.89311785732266 115-119 24.44321552460912 27.147956362173847 27.89201146247046 20.51681665074657 120-124 23.92462311557789 28.261306532663315 27.623115577889447 20.190954773869347 125-129 23.773299748110833 27.848866498740556 28.000000000000004 20.377833753148614 130-134 24.681367590532066 28.161035808213636 27.336637669431518 19.82095893182278 135-139 23.751398636964705 27.611636659546335 28.13548977723528 20.50147492625369 140-144 25.13750254634345 27.699124057852924 27.215318802200038 19.948054593603583 145-149 24.785539215686274 27.77777777777778 27.22630718954248 20.210375816993466 150-151 25.79817925375048 27.836902166944483 26.78548531863059 19.579433260674445 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 2.5 20 4.5 21 3.0 22 3.0 23 7.0 24 9.5 25 7.0 26 6.5 27 7.5 28 8.5 29 10.5 30 14.5 31 16.0 32 18.5 33 32.0 34 44.0 35 55.5 36 73.5 37 103.5 38 141.0 39 178.0 40 201.5 41 224.5 42 249.0 43 268.5 44 281.5 45 283.5 46 295.0 47 278.5 48 244.0 49 199.5 50 157.5 51 137.5 52 119.0 53 86.0 54 53.0 55 44.5 56 38.0 57 30.0 58 19.0 59 11.5 60 8.0 61 5.0 62 5.0 63 4.5 64 2.0 65 1.0 66 2.5 67 2.0 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.345 55-59 1.065 60-64 1.555 65-69 1.9349999999999998 70-74 2.03 75-79 2.0500000000000003 80-84 1.6199999999999999 85-89 1.2 90-94 1.04 95-99 0.9650000000000001 100-104 0.8 105-109 0.765 110-114 0.685 115-119 0.545 120-124 0.5 125-129 0.75 130-134 1.1400000000000001 135-139 1.69 140-144 1.82 145-149 2.08 150-151 2.5125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.42500000000000004 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.55 0.0 0.0 0.0 0.0 112-113 0.6125 0.0 0.0 0.0 0.0 114-115 0.75 0.0 0.0 0.0 0.0 116-117 0.825 0.0 0.0 0.0 0.0 118-119 0.925 0.0 0.0 0.0 0.0 120-121 1.0125 0.0 0.0 0.0 0.0 122-123 1.15 0.0 0.0 0.0 0.0 124-125 1.2875 0.0 0.0 0.0 0.0 126-127 1.45 0.0 0.0 0.0 0.0 128-129 1.7125 0.0 0.0 0.0 0.0 130-131 1.9625 0.0 0.0 0.0 0.0 132-133 2.1375 0.0 0.0 0.0 0.0 134-135 2.3625 0.0 0.0 0.0 0.0 136-137 2.5999999999999996 0.0 0.0 0.0 0.0 138-139 2.8375000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 849641 spots for SRR7169631.sra Written 849641 spots for SRR7169631.sra Read 849641 spots for SRR7169631.sra Written 849641 spots for SRR7169631.sra Read 849641 spots for SRR7169631.sra Written 849641 spots for SRR7169631.sra Read 849641 spots for SRR7169631.sra Written 849641 spots for SRR7169631.sra Read 849641 spots for SRR7169631.sra Written 849641 spots for SRR7169631.sra Read 849641 spots for SRR7169631.sra Written 849641 spots for SRR7169631.sra Read 849641 spots for SRR7169631.sra Written 849641 spots for SRR7169631.sra Read 849641 spots for SRR7169631.sra Written 849641 spots for SRR7169631.sra Read 849641 spots for SRR7169631.sra Written 849641 spots for SRR7169631.sra Read 849641 spots for SRR7169631.sra Written 849641 spots for SRR7169631.sra Read 849645 spots for SRR7169631.sra Written 849645 spots for SRR7169631.sra Read 849641 spots for SRR7169631.sra Written 849641 spots for SRR7169631.sra Read 849641 spots for SRR7169631.sra Written 849641 spots for SRR7169631.sra Read 849641 spots for SRR7169631.sra Written 849641 spots for SRR7169631.sra Read 849641 spots for SRR7169631.sra Written 849641 spots for SRR7169631.sra Read 849641 spots for SRR7169631.sra Written 849641 spots for SRR7169631.sra Read 849641 spots for SRR7169631.sra Written 849641 spots for SRR7169631.sra Read 849641 spots for SRR7169631.sra Written 849641 spots for SRR7169631.sra Read 849641 spots for SRR7169631.sra Written 849641 spots for SRR7169631.sra Read 849641 spots for SRR7169631.sra Written 849641 spots for SRR7169631.sra SRR ids: ['SRR7169631.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_flbea_gq SRR7169631.sra spots: 16992824 blocks: [[1, 849641], [849642, 1699282], [1699283, 2548923], [2548924, 3398564], [3398565, 4248205], [4248206, 5097846], [5097847, 5947487], [5947488, 6797128], [6797129, 7646769], [7646770, 8496410], [8496411, 9346051], [9346052, 10195692], [10195693, 11045333], [11045334, 11894974], [11894975, 12744615], [12744616, 13594256], [13594257, 14443897], [14443898, 15293538], [15293539, 16143179], [16143180, 16992824]] SRR7169631 file size 5736610 SRR7169631 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169631 SRR7169631_1.fastq SRR7169631_2.fastq Input file: SRR7169631_1.fastq Paired file: SRR7169631_2.fastq trimmed: SRR7169631-trimmed-pair1.fastq, SRR7169631-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 11:34:06 2025 >> started Tue Feb 11 11:34:26 2025 >> done (19.600s) 16992824 read pairs processed; of these: 11079 ( 0.07%) short read pairs filtered out after trimming by size control 11126 ( 0.07%) empty read pairs filtered out after trimming by size control 16970619 (99.87%) read pairs available; of these: 8068013 (47.54%) trimmed read pairs available after processing 8902606 (52.46%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 3 0.00% 21 5 0.00% 22 2 0.00% 23 6 0.00% 24 1 0.00% 25 4 0.00% 26 4 0.00% 27 8 0.00% 28 5 0.00% 29 16 0.00% 30 16 0.00% 31 8 0.00% 32 11 0.00% 33 10 0.00% 34 15 0.00% 35 19 0.00% 36 16 0.00% 37 29 0.00% 38 13 0.00% 39 18 0.00% 40 30 0.00% 41 31 0.00% 42 35 0.00% 43 25 0.00% 44 41 0.00% 45 37 0.00% 46 43 0.00% 47 49 0.00% 48 48 0.00% 49 62 0.00% 50 58 0.00% 51 81 0.00% 52 92 0.00% 53 105 0.00% 54 104 0.00% 55 131 0.00% 56 155 0.00% 57 172 0.00% 58 170 0.00% 59 181 0.00% 60 214 0.00% 61 214 0.00% 62 303 0.00% 63 308 0.00% 64 337 0.00% 65 394 0.00% 66 448 0.00% 67 509 0.00% 68 598 0.00% 69 662 0.00% 70 807 0.00% 71 906 0.01% 72 1113 0.01% 73 1223 0.01% 74 1572 0.01% 75 2338 0.01% 76 1756 0.01% 77 949 0.01% 78 1325 0.01% 79 2325 0.01% 80 4545 0.03% 81 1485 0.01% 82 1651 0.01% 83 1984 0.01% 84 2523 0.01% 85 3286 0.02% 86 3846 0.02% 87 4126 0.02% 88 3852 0.02% 89 4034 0.02% 90 4492 0.03% 91 4890 0.03% 92 5175 0.03% 93 5783 0.03% 94 6321 0.04% 95 7008 0.04% 96 7794 0.05% 97 9151 0.05% 98 11281 0.07% 99 16985 0.10% 100 21003 0.12% 101 12466 0.07% 102 9367 0.06% 103 9826 0.06% 104 10293 0.06% 105 11203 0.07% 106 11900 0.07% 107 12415 0.07% 108 13109 0.08% 109 13736 0.08% 110 14158 0.08% 111 15173 0.09% 112 16332 0.10% 113 16997 0.10% 114 18227 0.11% 115 19195 0.11% 116 20176 0.12% 117 21429 0.13% 118 22550 0.13% 119 23665 0.14% 120 24680 0.15% 121 26032 0.15% 122 27252 0.16% 123 28973 0.17% 124 30755 0.18% 125 32442 0.19% 126 34595 0.20% 127 36116 0.21% 128 38098 0.22% 129 40769 0.24% 130 42834 0.25% 131 45420 0.27% 132 48305 0.28% 133 51751 0.30% 134 55209 0.33% 135 59488 0.35% 136 64395 0.38% 137 69503 0.41% 138 76167 0.45% 139 84358 0.50% 140 91289 0.54% 141 101262 0.60% 142 112939 0.67% 143 126827 0.75% 144 148417 0.87% 145 179510 1.06% 146 229468 1.35% 147 317064 1.87% 148 482281 2.84% 149 933873 5.50% 150 3984343 23.48% 151 8902606 52.46% 16970619 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=41 prefix-density=0.20 prefix-fanout=2.0 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=245.33 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=14.6 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=42 prefix-density=0.39 prefix-fanout=2.2 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.02 sequence-density-rank=42 fanout-score=158.93 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=13.8 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTACTCGAGAAGATCAAGGAGA SRR7169631 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 11:35:09 Started mapping on | Feb 11 11:35:09 Finished on | Feb 11 11:37:04 Mapping speed, Million of reads per hour | 531.25 Number of input reads | 16970619 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 16194641 Uniquely mapped reads % | 95.43% Average mapped length | 295.17 Number of splices: Total | 16029472 Number of splices: Annotated (sjdb) | 15757846 Number of splices: GT/AG | 15794191 Number of splices: GC/AG | 186178 Number of splices: AT/AC | 12289 Number of splices: Non-canonical | 36814 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 296651 % of reads mapped to multiple loci | 1.75% Number of reads mapped to too many loci | 39596 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.54% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 491845 491845 491845 N_multimapping 296651 296651 296651 N_noFeature 325432 16037041 397229 N_ambiguous 150788 930 64364 UnstrandedReadsAssigned:15718421 PositiveStrandReadsAssigned:156670 NegativeStrandReadsAssigned:15733048 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169631 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169631-trimmed-pair1.fastq SRR7169631-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,970,619 reads, 15,595,544 reads pseudoaligned [quant] estimated average fragment length: 259.46 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,113 rounds 52401 SRR7169631.ke.tsv 34699 SRR7169631.se.tsv 87100 total ==> SRR7169631.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759.54 340 11.7052 Potri.005G024800.1.v4.1 1035 776.54 57 4.44641 Potri.004G059700.1.v4.1 961 702.598 4 0.344867 Potri.007G009000.2.v4.1 1416 1157.54 0 0 Potri.003G141000.2.v4.1 2943 2684.54 283.031 6.38649 Potri.016G087400.1.v4.1 270 70.3901 1749.61 1505.67 Potri.015G069301.1.v4.1 564 311.813 0 0 Potri.010G195200.1.v4.1 1773 1514.54 19 0.759925 Potri.012G127500.1.v4.1 977 718.552 5221 440.143 ==> SRR7169631.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1060 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 197 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169631 completed mapping pipeline successfully