Starting /dee2/code/volunteer_pipeline.sh SRR7169632 current disk space = 3050923560960 free memory = 1573521536 SRR7169632 SRAfilesize d0486eb0eb185177e2f9c71117fed538 SRR7169632.sra SRR7169632.sra file validated SRR7169632 is paired end SRR7169632 is conventional basespace SRR7169632 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169632_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8715 34.0 33.0 34.0 33.0 34.0 2 33.4145 34.0 34.0 34.0 33.0 34.0 3 33.4255 34.0 34.0 34.0 33.0 34.0 4 33.54125 34.0 34.0 34.0 33.0 34.0 5 33.5095 34.0 34.0 34.0 33.0 34.0 6 37.078 38.0 37.0 38.0 36.0 38.0 7 37.391 38.0 38.0 38.0 37.0 38.0 8 37.485 38.0 38.0 38.0 37.0 38.0 9 37.61125 38.0 38.0 38.0 38.0 38.0 10-14 37.52885 38.0 38.0 38.0 37.8 38.0 15-19 37.51875 38.0 38.0 38.0 38.0 38.0 20-24 37.53505 38.0 38.0 38.0 38.0 38.0 25-29 37.5269 38.0 38.0 38.0 38.0 38.0 30-34 37.52454999999999 38.0 38.0 38.0 38.0 38.0 35-39 37.365750000000006 38.0 38.0 38.0 37.0 38.0 40-44 37.38205 38.0 38.0 38.0 37.0 38.0 45-49 37.320499999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.2685 38.0 38.0 38.0 37.0 38.0 55-59 37.22135 38.0 38.0 38.0 36.6 38.0 60-64 37.14385 38.0 38.0 38.0 36.0 38.0 65-69 37.159549999999996 38.0 38.0 38.0 36.0 38.0 70-74 37.1034 38.0 38.0 38.0 36.0 38.0 75-79 37.03645 38.0 38.0 38.0 36.0 38.0 80-84 36.95725 38.0 38.0 38.0 36.0 38.0 85-89 36.8711 38.0 38.0 38.0 35.6 38.0 90-94 36.8526 38.0 38.0 38.0 35.2 38.0 95-99 36.708549999999995 38.0 38.0 38.0 35.0 38.0 100-104 36.61075 38.0 38.0 38.0 34.6 38.0 105-109 36.5062 38.0 38.0 38.0 34.4 38.0 110-114 36.319 38.0 38.0 38.0 34.0 38.0 115-119 36.1282 38.0 38.0 38.0 33.4 38.0 120-124 35.997499999999995 38.0 37.2 38.0 33.2 38.0 125-129 35.836349999999996 38.0 37.0 38.0 32.6 38.0 130-134 35.72555 38.0 36.6 38.0 32.4 38.0 135-139 35.50455000000001 38.0 36.0 38.0 31.2 38.0 140-144 35.239900000000006 38.0 36.0 38.0 30.6 38.0 145-149 34.47465 38.0 35.2 38.0 27.6 38.0 150-151 31.72825 36.5 33.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 1.0 6 0.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 2.0 16 0.0 17 3.0 18 5.0 19 4.0 20 5.0 21 1.0 22 7.0 23 6.0 24 7.0 25 11.0 26 8.0 27 15.0 28 22.0 29 29.0 30 32.0 31 44.0 32 60.0 33 88.0 34 117.0 35 200.0 36 542.0 37 2787.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.728476821192054 12.455425369332653 9.67906265919511 37.137035150280184 2 22.975 15.675 31.574999999999996 29.775000000000002 3 20.65 19.25 25.05 35.05 4 21.8 28.825 21.65 27.725 5 21.925 29.95 24.55 23.575 6 19.2 35.949999999999996 24.7 20.150000000000002 7 15.0 25.874999999999996 40.6 18.525 8 17.2 27.175 30.375000000000004 25.25 9 16.775000000000002 25.7 33.650000000000006 23.875 10-14 19.665 29.955 27.045 23.335 15-19 19.81 29.4 27.305 23.485 20-24 19.994999999999997 29.13 27.400000000000002 23.474999999999998 25-29 19.59 29.48 27.315 23.615 30-34 20.27 28.975 27.229999999999997 23.525 35-39 19.36 29.515 27.189999999999998 23.935000000000002 40-44 19.74 29.115000000000002 27.57 23.575 45-49 19.695 29.770000000000003 27.334999999999997 23.200000000000003 50-54 20.080000000000002 29.154999999999998 27.279999999999998 23.485 55-59 20.275000000000002 29.304999999999996 26.779999999999998 23.64 60-64 19.805 29.099999999999998 27.284999999999997 23.810000000000002 65-69 20.345 28.825 26.795 24.035 70-74 20.349999999999998 28.935 26.889999999999997 23.825 75-79 20.064999999999998 28.98 26.88 24.075 80-84 20.13 28.23 27.26 24.38 85-89 20.775 28.48 27.060000000000002 23.685000000000002 90-94 19.99 28.99 26.465 24.555 95-99 20.555 28.439999999999998 26.96 24.044999999999998 100-104 20.23 28.32 27.21 24.240000000000002 105-109 20.47 28.26 27.215 24.055 110-114 20.39 27.965 27.175 24.47 115-119 20.87 28.255000000000003 27.175 23.7 120-124 20.815 28.025 26.490000000000002 24.67 125-129 20.95 28.055000000000003 27.315 23.68 130-134 21.060000000000002 27.794999999999998 27.450000000000003 23.695 135-139 20.4 27.52 27.675 24.404999999999998 140-144 21.725 27.894999999999996 26.27 24.11 145-149 20.845 27.83 27.065 24.26 150-151 20.974999999999998 27.9125 25.900000000000002 25.2125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.5 17 1.0 18 0.0 19 0.5 20 1.5 21 1.0 22 1.5 23 2.0 24 3.5 25 5.0 26 4.0 27 7.0 28 12.5 29 15.0 30 15.5 31 26.0 32 36.5 33 45.5 34 58.5 35 74.0 36 91.5 37 110.0 38 126.5 39 154.0 40 187.5 41 201.0 42 229.5 43 247.5 44 255.0 45 266.0 46 265.0 47 263.5 48 228.5 49 197.5 50 174.5 51 142.5 52 125.5 53 94.5 54 70.5 55 59.0 56 45.0 57 39.5 58 29.0 59 16.5 60 13.5 61 12.5 62 9.5 63 8.5 64 7.0 65 4.5 66 2.0 67 1.5 68 2.5 69 2.5 70 1.0 71 0.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.8499999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44681921046015 98.875 2 0.5280362081971335 1.05 3 0.025144581342720643 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.725 0.0 0.0 0.0 0.0 98-99 0.8875 0.0 0.0 0.0 0.0 100-101 0.9624999999999999 0.0 0.0 0.0 0.0 102-103 1.0625 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.2625000000000002 0.0 0.0 0.0 0.0 108-109 1.5 0.0 0.0 0.0 0.0 110-111 1.7125 0.0 0.0 0.0 0.0 112-113 1.85 0.0 0.0 0.0 0.0 114-115 2.125 0.0 0.0 0.0 0.0 116-117 2.45 0.0 0.0 0.0 0.0 118-119 2.7 0.0 0.0 0.0 0.0 120-121 2.875 0.0 0.0 0.0 0.0 122-123 3.5 0.0 0.0 0.0 0.0 124-125 3.9125 0.0 0.0 0.0 0.0 126-127 4.1625 0.0 0.0 0.0 0.0 128-129 4.4375 0.0 0.0 0.0 0.0 130-131 4.7375 0.0 0.0 0.0 0.0 132-133 5.0375 0.0 0.0 0.0 0.0 134-135 5.55 0.0 0.0 0.0 0.0 136-137 6.012499999999999 0.0 0.0 0.0 0.0 138-139 6.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATCTTG 10 0.006832588 144.9875 5 AGACTCA 10 0.006832588 144.9875 5 >>END_MODULE SRR7169632 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169632_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.80325 33.0 33.0 34.0 32.0 34.0 2 32.8375 34.0 33.0 34.0 32.0 34.0 3 32.8795 34.0 33.0 34.0 32.0 34.0 4 32.8025 34.0 33.0 34.0 32.0 34.0 5 32.8525 34.0 33.0 34.0 32.0 34.0 6 36.89925 38.0 38.0 38.0 36.0 38.0 7 37.05925 38.0 38.0 38.0 37.0 38.0 8 37.0235 38.0 38.0 38.0 37.0 38.0 9 37.062 38.0 38.0 38.0 37.0 38.0 10-14 37.0291 38.0 38.0 38.0 37.0 38.0 15-19 36.984700000000004 38.0 38.0 38.0 37.0 38.0 20-24 36.921350000000004 38.0 38.0 38.0 37.0 38.0 25-29 36.913650000000004 38.0 38.0 38.0 36.8 38.0 30-34 36.848200000000006 38.0 38.0 38.0 36.8 38.0 35-39 36.8332 38.0 38.0 38.0 36.6 38.0 40-44 36.85315000000001 38.0 38.0 38.0 36.6 38.0 45-49 36.846050000000005 38.0 38.0 38.0 36.2 38.0 50-54 36.82475000000001 38.0 38.0 38.0 36.2 38.0 55-59 36.3531 38.0 37.8 38.0 33.8 38.0 60-64 36.704 38.0 38.0 38.0 36.0 38.0 65-69 36.6673 38.0 38.0 38.0 36.0 38.0 70-74 36.642100000000006 38.0 38.0 38.0 35.8 38.0 75-79 36.5493 38.0 38.0 38.0 35.4 38.0 80-84 36.4085 38.0 38.0 38.0 35.0 38.0 85-89 36.33765 38.0 38.0 38.0 34.2 38.0 90-94 36.322199999999995 38.0 38.0 38.0 34.4 38.0 95-99 36.19105 38.0 38.0 38.0 34.0 38.0 100-104 36.10815 38.0 38.0 38.0 34.0 38.0 105-109 35.96320000000001 38.0 38.0 38.0 33.4 38.0 110-114 35.89255 38.0 38.0 38.0 33.6 38.0 115-119 35.67885 38.0 37.6 38.0 32.4 38.0 120-124 35.460499999999996 38.0 37.2 38.0 31.0 38.0 125-129 35.250299999999996 38.0 36.8 38.0 30.0 38.0 130-134 34.79065 38.0 36.0 38.0 27.6 38.0 135-139 34.67775 38.0 36.0 38.0 28.0 38.0 140-144 34.26995000000001 38.0 35.4 38.0 24.8 38.0 145-149 33.7649 38.0 35.0 38.0 22.4 38.0 150-151 29.890500000000003 36.5 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 23.0 3 5.0 4 6.0 5 1.0 6 0.0 7 0.0 8 4.0 9 2.0 10 0.0 11 2.0 12 3.0 13 0.0 14 4.0 15 3.0 16 2.0 17 10.0 18 3.0 19 6.0 20 8.0 21 9.0 22 8.0 23 14.0 24 12.0 25 16.0 26 14.0 27 28.0 28 30.0 29 35.0 30 34.0 31 45.0 32 66.0 33 64.0 34 136.0 35 205.0 36 461.0 37 2741.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.96992481203007 22.05513784461153 14.486215538847116 25.48872180451128 2 26.85069008782936 27.50313676286073 28.60727728983689 17.038895859473023 3 21.80677540777917 28.20577164366374 30.163111668757843 19.82434127979925 4 23.086574654956085 34.077791718946045 24.090338770388957 18.74529485570891 5 25.49560853199498 35.131744040150565 21.555834378920956 17.8168130489335 6 22.41163198796691 34.77061920280772 23.84056154424668 18.977187264978692 7 20.631737277513164 22.186011531712207 35.99899724241665 21.183253948357986 8 23.57805061388123 25.933350037584564 25.783011776497116 24.705587572037082 9 22.330827067669173 25.839598997493734 29.57393483709273 22.25563909774436 10-14 24.5475963707454 28.226978795929618 25.896034888966867 21.329389944358113 15-19 23.13515139362342 27.807298977341087 27.255865249649087 21.801684379386405 20-24 24.120124335706407 28.787726862528828 26.366188709515693 20.725960092249075 25-29 23.825520180496365 27.74128854349461 27.209827024316873 21.223364251692153 30-34 23.780396089245425 27.801453998495862 27.500626723489596 20.917523188769117 35-39 23.70518927049386 27.691150664326898 27.48057157182251 21.123088493356732 40-44 23.88950165446706 28.401684548280357 26.50656773287877 21.20224606437381 45-49 24.24682941500827 27.028923755576724 27.790866710110784 20.933380119304225 50-54 23.87491229828606 28.079583040994287 27.03217400020046 21.013330660519195 55-59 23.77587330226031 28.020848995138575 27.404400340800883 20.79887736180023 60-64 23.983760212520675 27.89333867976542 26.9009072226956 21.221993885018296 65-69 24.152797272909567 27.972729095648685 27.606777621816725 20.267696009625023 70-74 24.37459267057703 28.009224444778663 27.046673685265954 20.569509199378352 75-79 24.19912768837419 27.066726826089138 28.08943700807139 20.644708477465283 80-84 24.62147799057455 27.815100772084627 26.68204151208262 20.8813797252582 85-89 24.180286774290586 28.10588589190815 26.692068585179985 21.021758748621277 90-94 23.528527022962 28.206156622881778 27.885290283766167 20.380026070390052 95-99 24.582769508344608 27.223976344409362 27.654989224677994 20.538264922568032 100-104 24.66549736908043 28.29867201202706 26.830368328739663 20.205462290152845 105-109 24.060903536011217 27.66202544325353 27.486727436642294 20.79034358409296 110-114 23.988772492606884 28.023657962006915 27.281840509247658 20.70572903613854 115-119 23.997393222378182 27.772207740124323 27.89753358732705 20.33286545017044 120-124 24.345733480397072 27.79003308934122 27.18840870349945 20.675824726762258 125-129 24.044921287476186 27.343828336508576 27.980547478191113 20.630702897824126 130-134 24.74304336926548 27.315116570569064 27.405364753070945 20.53647530709451 135-139 25.21808883986764 27.514288579163743 26.962799558808783 20.30482302215983 140-144 25.214296455962703 28.046518622487344 27.01889819038548 19.720286731164467 145-149 24.98621899273365 28.318717113505386 27.256326735154097 19.438737158606862 150-151 25.83187390542907 26.90768076057043 27.257943457593193 20.002501876407305 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 9.0 1 4.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.5 18 1.0 19 0.5 20 0.5 21 0.5 22 0.5 23 1.0 24 1.0 25 0.5 26 2.5 27 4.0 28 3.0 29 6.0 30 9.0 31 10.5 32 17.0 33 18.0 34 24.0 35 45.5 36 63.0 37 89.0 38 120.0 39 152.5 40 187.0 41 207.0 42 243.0 43 274.0 44 276.5 45 279.0 46 282.5 47 277.5 48 262.0 49 225.5 50 172.5 51 142.5 52 129.0 53 107.5 54 92.0 55 71.0 56 48.5 57 34.5 58 27.0 59 22.0 60 14.0 61 9.5 62 5.0 63 4.5 64 6.0 65 6.0 66 4.5 67 2.5 68 2.0 69 1.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.375 3 0.375 4 0.375 5 0.375 6 0.27499999999999997 7 0.27499999999999997 8 0.22499999999999998 9 0.25 10-14 0.255 15-19 0.26 20-24 0.27 25-29 0.27499999999999997 30-34 0.27499999999999997 35-39 0.27499999999999997 40-44 0.27 45-49 0.255 50-54 0.22999999999999998 55-59 0.23500000000000001 60-64 0.245 65-69 0.26 70-74 0.265 75-79 0.265 80-84 0.27 85-89 0.27 90-94 0.27 95-99 0.23500000000000001 100-104 0.22499999999999998 105-109 0.16999999999999998 110-114 0.245 115-119 0.26 120-124 0.27 125-129 0.27 130-134 0.27499999999999997 135-139 0.27 140-144 0.255 145-149 0.22499999999999998 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57243460764587 98.97500000000001 2 0.4024144869215292 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025150905432595575 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.725 0.0 0.0 0.0 0.0 98-99 0.8875 0.0 0.0 0.0 0.0 100-101 0.9624999999999999 0.0 0.0 0.0 0.0 102-103 1.0625 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.2625000000000002 0.0 0.0 0.0 0.0 108-109 1.525 0.0 0.0 0.0 0.0 110-111 1.7625 0.0 0.0 0.0 0.0 112-113 1.9249999999999998 0.0 0.0 0.0 0.0 114-115 2.225 0.0 0.0 0.0 0.0 116-117 2.5 0.0 0.0 0.0 0.0 118-119 2.75 0.0 0.0 0.0 0.0 120-121 2.9625000000000004 0.0 0.0 0.0 0.0 122-123 3.5875000000000004 0.0 0.0 0.0 0.0 124-125 3.95 0.0 0.0 0.0 0.0 126-127 4.1875 0.0 0.0 0.0 0.0 128-129 4.475 0.0 0.0 0.0 0.0 130-131 4.737500000000001 0.0 0.0 0.0 0.0 132-133 5.025 0.0 0.0 0.0 0.0 134-135 5.5 0.0 0.0 0.0 0.0 136-137 5.975 0.0 0.0 0.0 0.0 138-139 6.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGTTAT 10 0.006830828 145.0 6 >>END_MODULE Read 828153 spots for SRR7169632.sra Written 828153 spots for SRR7169632.sra Read 828153 spots for SRR7169632.sra Written 828153 spots for SRR7169632.sra Read 828153 spots for SRR7169632.sra Written 828153 spots for SRR7169632.sra Read 828153 spots for SRR7169632.sra Written 828153 spots for SRR7169632.sra Read 828153 spots for SRR7169632.sra Written 828153 spots for SRR7169632.sra Read 828153 spots for SRR7169632.sra Written 828153 spots for SRR7169632.sra Read 828153 spots for SRR7169632.sra Written 828153 spots for SRR7169632.sra Read 828153 spots for SRR7169632.sra Written 828153 spots for SRR7169632.sra Read 828153 spots for SRR7169632.sra Written 828153 spots for SRR7169632.sra Read 828165 spots for SRR7169632.sra Written 828165 spots for SRR7169632.sra Read 828153 spots for SRR7169632.sra Written 828153 spots for SRR7169632.sra Read 828153 spots for SRR7169632.sra Written 828153 spots for SRR7169632.sra Read 828153 spots for SRR7169632.sra Written 828153 spots for SRR7169632.sra Read 828153 spots for SRR7169632.sra Written 828153 spots for SRR7169632.sra Read 828153 spots for SRR7169632.sra Written 828153 spots for SRR7169632.sra Read 828153 spots for SRR7169632.sra Written 828153 spots for SRR7169632.sra Read 828153 spots for SRR7169632.sra Written 828153 spots for SRR7169632.sra Read 828153 spots for SRR7169632.sra Written 828153 spots for SRR7169632.sra Read 828153 spots for SRR7169632.sra Written 828153 spots for SRR7169632.sra Read 828153 spots for SRR7169632.sra Written 828153 spots for SRR7169632.sra SRR ids: ['SRR7169632.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ecyjhmqr SRR7169632.sra spots: 16563072 blocks: [[1, 828153], [828154, 1656306], [1656307, 2484459], [2484460, 3312612], [3312613, 4140765], [4140766, 4968918], [4968919, 5797071], [5797072, 6625224], [6625225, 7453377], [7453378, 8281530], [8281531, 9109683], [9109684, 9937836], [9937837, 10765989], [10765990, 11594142], [11594143, 12422295], [12422296, 13250448], [13250449, 14078601], [14078602, 14906754], [14906755, 15734907], [15734908, 16563072]] SRR7169632 file size 5590981 SRR7169632 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169632 SRR7169632_1.fastq SRR7169632_2.fastq Input file: SRR7169632_1.fastq Paired file: SRR7169632_2.fastq trimmed: SRR7169632-trimmed-pair1.fastq, SRR7169632-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 12:24:54 2025 >> started Tue Feb 11 12:25:11 2025 >> done (17.709s) 16563072 read pairs processed; of these: 21301 ( 0.13%) short read pairs filtered out after trimming by size control 67636 ( 0.41%) empty read pairs filtered out after trimming by size control 16474135 (99.46%) read pairs available; of these: 6979782 (42.37%) trimmed read pairs available after processing 9494353 (57.63%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 2 0.00% 20 7 0.00% 21 5 0.00% 22 4 0.00% 23 11 0.00% 24 10 0.00% 25 7 0.00% 26 13 0.00% 27 14 0.00% 28 4 0.00% 29 10 0.00% 30 13 0.00% 31 12 0.00% 32 13 0.00% 33 10 0.00% 34 6 0.00% 35 17 0.00% 36 16 0.00% 37 21 0.00% 38 21 0.00% 39 19 0.00% 40 19 0.00% 41 25 0.00% 42 34 0.00% 43 43 0.00% 44 47 0.00% 45 57 0.00% 46 52 0.00% 47 58 0.00% 48 71 0.00% 49 73 0.00% 50 81 0.00% 51 93 0.00% 52 93 0.00% 53 114 0.00% 54 126 0.00% 55 125 0.00% 56 144 0.00% 57 146 0.00% 58 229 0.00% 59 218 0.00% 60 256 0.00% 61 317 0.00% 62 361 0.00% 63 406 0.00% 64 476 0.00% 65 532 0.00% 66 598 0.00% 67 707 0.00% 68 992 0.01% 69 2249 0.01% 70 2340 0.01% 71 1453 0.01% 72 1302 0.01% 73 1300 0.01% 74 1539 0.01% 75 1699 0.01% 76 1841 0.01% 77 1996 0.01% 78 2333 0.01% 79 2491 0.02% 80 2775 0.02% 81 3268 0.02% 82 3702 0.02% 83 4300 0.03% 84 5464 0.03% 85 6406 0.04% 86 6887 0.04% 87 7386 0.04% 88 7899 0.05% 89 8298 0.05% 90 8714 0.05% 91 9279 0.06% 92 10186 0.06% 93 10824 0.07% 94 11861 0.07% 95 12460 0.08% 96 13082 0.08% 97 13903 0.08% 98 14380 0.09% 99 14835 0.09% 100 15647 0.09% 101 16806 0.10% 102 17732 0.11% 103 18851 0.11% 104 19972 0.12% 105 21304 0.13% 106 22008 0.13% 107 22353 0.14% 108 23267 0.14% 109 24491 0.15% 110 25099 0.15% 111 26003 0.16% 112 27158 0.16% 113 28737 0.17% 114 30101 0.18% 115 32171 0.20% 116 32644 0.20% 117 33869 0.21% 118 34509 0.21% 119 35046 0.21% 120 36626 0.22% 121 37318 0.23% 122 39286 0.24% 123 41171 0.25% 124 43509 0.26% 125 44896 0.27% 126 46731 0.28% 127 47691 0.29% 128 49433 0.30% 129 50861 0.31% 130 52382 0.32% 131 54445 0.33% 132 56939 0.35% 133 59693 0.36% 134 63158 0.38% 135 67324 0.41% 136 69985 0.42% 137 73586 0.45% 138 77441 0.47% 139 80574 0.49% 140 84236 0.51% 141 90215 0.55% 142 97301 0.59% 143 107071 0.65% 144 120781 0.73% 145 140596 0.85% 146 167436 1.02% 147 217889 1.32% 148 316131 1.92% 149 595184 3.61% 150 3238940 19.66% 151 9494353 57.63% 16474135 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=37 prefix-density=0.25 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACGAACTGGATTGTGCGCTTGGTCTTGATGGTAGCCACAGCTGCATTCACATCCTTGGGCACAACATCACCTCTATACATCAGGCAGCAAGCCATGTACTTGCCATGACGTGGGTCACACTTGGCCATCATGGATGATGGCTCAAAAGCACTGTTGGTTATCTCAGCCACAGAGAGCTGCTCATGGTATGCCTTCTCTGCGGAGATGACAGGGGCATAAGAGGAAAGCATGAAATGGATCCTGGGGTATGGAACCAAGTTGGTTTGGAACTCAGTAACATCCACATTAAGAGCTCCATCAAACCTTAATGAGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=41 fanout-score=108.06 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=10.6 sequence=AGAAAAGAAAACAAAGATGCATCAATCTCACATTTAGAAAAGGAGCTGCCCAAATGCAAGAGCAACGAGAGAAGCAAGAACAGCCGGCACAAAAGTGGTGGCATCGGAGGTAGGGCTAGGTGCTGGGGCCTCCGCTGCTGCTACATTTTGGACGGCTGAAACAGCCATGAGCACAACCACGATAGCCAAAAACACTCTCATCTTCAATGCCTCCATTGTGAAAAACTTTCTTGCTGGAAAAAACAGAGGCGTGGAGGGAGAAGAGAAAATGCAAGATTTCAGACAAC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=43 prefix-density=0.25 prefix-fanout=2.1 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.11 sequence-density-rank=20 fanout-score=270.29 fanout-score-rank=1 prefix-density=1.03 prefix-fanout=28.4 sequence=AAGAAGAAGAAA SRR7169632 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 12:26:11 Started mapping on | Feb 11 12:26:11 Finished on | Feb 11 12:27:44 Mapping speed, Million of reads per hour | 637.71 Number of input reads | 16474135 Average input read length | 285 UNIQUE READS: Uniquely mapped reads number | 14087061 Uniquely mapped reads % | 85.51% Average mapped length | 286.36 Number of splices: Total | 12987490 Number of splices: Annotated (sjdb) | 12765661 Number of splices: GT/AG | 12790009 Number of splices: GC/AG | 154664 Number of splices: AT/AC | 12139 Number of splices: Non-canonical | 30678 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.83 Insertion rate per base | 0.02% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 268026 % of reads mapped to multiple loci | 1.63% Number of reads mapped to too many loci | 18515 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 12.72% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2133409 2133409 2133409 N_multimapping 268026 268026 268026 N_noFeature 280381 13940695 334856 N_ambiguous 185720 1648 92596 UnstrandedReadsAssigned:13620960 PositiveStrandReadsAssigned:144718 NegativeStrandReadsAssigned:13659609 Dataset is classified negative stranded MeadianReadLen=143 20thPercentileLength=142 echo kmer=137 SRR7169632 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169632-trimmed-pair1.fastq SRR7169632-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,474,135 reads, 14,867,516 reads pseudoaligned [quant] estimated average fragment length: 224.036 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,155 rounds 52401 SRR7169632.ke.tsv 34699 SRR7169632.se.tsv 87100 total ==> SRR7169632.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1794.96 476 15.639 Potri.005G024800.1.v4.1 1035 811.964 70 5.08417 Potri.004G059700.1.v4.1 961 737.992 6 0.479467 Potri.007G009000.2.v4.1 1416 1192.96 0 0 Potri.003G141000.2.v4.1 2943 2719.96 227 4.92178 Potri.016G087400.1.v4.1 270 88.2286 1941.91 1298.01 Potri.015G069301.1.v4.1 564 344.186 0 0 Potri.010G195200.1.v4.1 1773 1549.96 15 0.570727 Potri.012G127500.1.v4.1 977 753.981 6898 539.538 ==> SRR7169632.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 742 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 268 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7169632 completed mapping pipeline successfully