Starting /dee2/code/volunteer_pipeline.sh SRR7169633 current disk space = 3051387166720 free memory = 1475095208 SRR7169633 SRAfilesize f75c76aabab50734d4141aa681852c41 SRR7169633.sra SRR7169633.sra file validated SRR7169633 is paired end SRR7169633 is conventional basespace SRR7169633 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169633_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.002 34.0 33.0 34.0 33.0 34.0 2 33.36025 34.0 34.0 34.0 33.0 34.0 3 33.413 34.0 34.0 34.0 33.0 34.0 4 33.45325 34.0 34.0 34.0 33.0 34.0 5 33.485 34.0 34.0 34.0 33.0 34.0 6 37.05475 38.0 37.0 38.0 36.0 38.0 7 37.31325 38.0 38.0 38.0 37.0 38.0 8 37.30025 38.0 38.0 38.0 37.0 38.0 9 37.465 38.0 38.0 38.0 37.0 38.0 10-14 37.46475 38.0 38.0 38.0 37.4 38.0 15-19 37.4384 38.0 38.0 38.0 37.0 38.0 20-24 37.4573 38.0 38.0 38.0 37.2 38.0 25-29 37.40685 38.0 38.0 38.0 37.0 38.0 30-34 37.3995 38.0 38.0 38.0 37.0 38.0 35-39 37.31535 38.0 38.0 38.0 37.0 38.0 40-44 37.23955 38.0 38.0 38.0 37.0 38.0 45-49 37.1529 38.0 38.0 38.0 36.0 38.0 50-54 37.13835 38.0 38.0 38.0 36.0 38.0 55-59 37.12595 38.0 38.0 38.0 36.0 38.0 60-64 37.017599999999995 38.0 38.0 38.0 36.0 38.0 65-69 37.00565 38.0 38.0 38.0 36.0 38.0 70-74 36.8882 38.0 38.0 38.0 35.6 38.0 75-79 36.779 38.0 38.0 38.0 35.0 38.0 80-84 36.784800000000004 38.0 38.0 38.0 35.0 38.0 85-89 36.692449999999994 38.0 38.0 38.0 34.8 38.0 90-94 36.580999999999996 38.0 38.0 38.0 34.4 38.0 95-99 36.492999999999995 38.0 38.0 38.0 34.0 38.0 100-104 36.21495 38.0 37.8 38.0 33.8 38.0 105-109 36.181200000000004 38.0 37.2 38.0 33.6 38.0 110-114 36.0676 38.0 37.2 38.0 33.2 38.0 115-119 35.8269 38.0 37.0 38.0 32.0 38.0 120-124 35.69135 38.0 37.0 38.0 31.4 38.0 125-129 35.539049999999996 38.0 36.0 38.0 31.0 38.0 130-134 35.4079 38.0 36.0 38.0 31.0 38.0 135-139 35.22835 38.0 36.0 38.0 30.2 38.0 140-144 34.6919 38.0 35.0 38.0 27.8 38.0 145-149 34.15745 38.0 35.0 38.0 26.0 38.0 150-151 31.153750000000002 36.5 31.5 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 2.0 13 1.0 14 1.0 15 3.0 16 2.0 17 1.0 18 8.0 19 3.0 20 4.0 21 5.0 22 10.0 23 7.0 24 9.0 25 11.0 26 12.0 27 25.0 28 20.0 29 32.0 30 45.0 31 52.0 32 70.0 33 101.0 34 119.0 35 257.0 36 568.0 37 2629.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.816797767064195 13.524486171022584 9.6422227860949 35.01649327581832 2 25.424999999999997 13.225000000000001 30.5 30.85 3 20.1 17.025000000000002 25.324999999999996 37.55 4 22.45 26.224999999999998 23.025000000000002 28.299999999999997 5 22.825 29.9 23.425 23.849999999999998 6 21.25 33.75 23.974999999999998 21.025 7 15.299999999999999 27.525 40.699999999999996 16.475 8 18.275 25.900000000000002 30.9 24.925 9 16.875 24.925 33.975 24.224999999999998 10-14 19.52 30.165 27.455000000000002 22.86 15-19 19.715 28.87 27.68 23.735 20-24 20.19 28.79 27.33 23.69 25-29 19.875 28.83 27.339999999999996 23.955000000000002 30-34 20.025000000000002 28.53 27.384999999999998 24.060000000000002 35-39 20.16 28.970000000000002 26.939999999999998 23.93 40-44 20.39 28.7 27.48 23.43 45-49 20.5 28.355000000000004 26.939999999999998 24.205 50-54 20.25 28.625 26.889999999999997 24.235 55-59 20.285 29.13 27.095000000000002 23.49 60-64 20.655 27.744999999999997 27.63 23.97 65-69 20.047004700470048 28.472847284728473 27.522752275227525 23.957395739573958 70-74 20.275000000000002 27.92 27.644999999999996 24.16 75-79 19.835 28.585 27.49 24.09 80-84 20.605 27.72 26.995 24.68 85-89 20.06 28.28 27.334999999999997 24.325 90-94 20.36 28.43 27.29 23.919999999999998 95-99 20.44 27.88 27.425 24.255 100-104 20.52 27.515 27.73 24.235 105-109 20.73 28.64 26.495 24.135 110-114 20.74 27.994999999999997 27.334999999999997 23.93 115-119 20.635 28.810000000000002 26.515 24.04 120-124 21.26 27.615000000000002 27.07 24.055 125-129 20.62 27.800000000000004 27.555000000000003 24.025 130-134 20.945 27.57 27.125 24.36 135-139 21.115000000000002 28.595 26.965 23.325000000000003 140-144 21.195 27.6 26.905 24.3 145-149 21.099999999999998 27.11 27.52 24.27 150-151 19.6375 28.475 27.125 24.762500000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 1.5 21 1.5 22 1.0 23 1.0 24 1.0 25 3.5 26 6.5 27 7.0 28 9.5 29 11.0 30 14.0 31 21.0 32 26.5 33 37.0 34 45.0 35 64.0 36 84.5 37 83.5 38 96.5 39 133.5 40 172.0 41 199.0 42 249.0 43 290.5 44 268.5 45 267.0 46 280.5 47 261.0 48 233.5 49 203.0 50 185.0 51 159.5 52 130.0 53 114.0 54 93.0 55 63.5 56 48.0 57 39.5 58 25.5 59 15.0 60 10.5 61 10.5 62 9.0 63 7.0 64 3.5 65 3.0 66 3.0 67 1.0 68 0.0 69 0.5 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4749999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.01 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62311557788944 99.125 2 0.2763819095477387 0.5499999999999999 3 0.07537688442211055 0.22499999999999998 4 0.02512562814070352 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.36250000000000004 0.0 0.0 0.0 0.0 96-97 0.5375 0.0 0.0 0.0 0.0 98-99 0.75 0.0 0.0 0.0 0.0 100-101 0.8875 0.0 0.0 0.0 0.0 102-103 0.9624999999999999 0.0 0.0 0.0 0.0 104-105 1.0625 0.0 0.0 0.0 0.0 106-107 1.2375 0.0 0.0 0.0 0.0 108-109 1.5375 0.0 0.0 0.0 0.0 110-111 1.725 0.0 0.0 0.0 0.0 112-113 1.975 0.0 0.0 0.0 0.0 114-115 2.3375000000000004 0.0 0.0 0.0 0.0 116-117 2.725 0.0 0.0 0.0 0.0 118-119 3.1625 0.0 0.0 0.0 0.0 120-121 3.375 0.0 0.0 0.0 0.0 122-123 3.575 0.0 0.0 0.0 0.0 124-125 4.012499999999999 0.0 0.0 0.0 0.0 126-127 4.475 0.0 0.0 0.0 0.0 128-129 5.0625 0.0 0.0 0.0 0.0 130-131 5.525 0.0 0.0 0.0 0.0 132-133 6.05 0.0 0.0 0.0 0.0 134-135 6.4 0.0 0.0 0.0 0.0 136-137 7.0375 0.0 0.0 0.0 0.0 138-139 7.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169633 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169633_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.76575 33.0 33.0 34.0 32.0 34.0 2 32.919 33.0 33.0 34.0 32.0 34.0 3 32.8735 34.0 33.0 34.0 32.0 34.0 4 32.88325 34.0 33.0 34.0 32.0 34.0 5 32.9595 34.0 33.0 34.0 32.0 34.0 6 37.072 38.0 38.0 38.0 37.0 38.0 7 37.14225 38.0 38.0 38.0 37.0 38.0 8 37.06075 38.0 38.0 38.0 37.0 38.0 9 37.06475 38.0 38.0 38.0 37.0 38.0 10-14 37.0664 38.0 38.0 38.0 36.8 38.0 15-19 37.02655 38.0 38.0 38.0 36.8 38.0 20-24 36.941649999999996 38.0 38.0 38.0 36.2 38.0 25-29 36.89665 38.0 38.0 38.0 36.2 38.0 30-34 36.811099999999996 38.0 38.0 38.0 36.0 38.0 35-39 36.86805 38.0 38.0 38.0 36.0 38.0 40-44 36.9058 38.0 38.0 38.0 36.2 38.0 45-49 36.839150000000004 38.0 38.0 38.0 36.0 38.0 50-54 36.880849999999995 38.0 38.0 38.0 36.0 38.0 55-59 36.845549999999996 38.0 38.0 38.0 36.0 38.0 60-64 36.800650000000005 38.0 38.0 38.0 36.0 38.0 65-69 36.73325 38.0 38.0 38.0 36.0 38.0 70-74 36.68300000000001 38.0 38.0 38.0 35.6 38.0 75-79 36.5785 38.0 38.0 38.0 35.2 38.0 80-84 36.37495 38.0 38.0 38.0 34.0 38.0 85-89 36.3483 38.0 38.0 38.0 34.0 38.0 90-94 36.28750000000001 38.0 38.0 38.0 34.0 38.0 95-99 36.2318 38.0 38.0 38.0 34.0 38.0 100-104 36.1641 38.0 38.0 38.0 34.0 38.0 105-109 36.097 38.0 38.0 38.0 34.0 38.0 110-114 36.0131 38.0 38.0 38.0 33.6 38.0 115-119 35.76115 38.0 37.2 38.0 32.8 38.0 120-124 35.446549999999995 38.0 36.8 38.0 31.0 38.0 125-129 35.1192 38.0 36.0 38.0 28.6 38.0 130-134 34.8533 38.0 36.0 38.0 27.8 38.0 135-139 34.69605 38.0 36.0 38.0 27.8 38.0 140-144 34.15315 38.0 35.0 38.0 23.4 38.0 145-149 33.522149999999996 38.0 35.0 38.0 19.2 38.0 150-151 29.716250000000002 36.5 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 2.0 4 1.0 5 1.0 6 0.0 7 1.0 8 1.0 9 1.0 10 2.0 11 1.0 12 1.0 13 4.0 14 3.0 15 2.0 16 4.0 17 7.0 18 5.0 19 5.0 20 8.0 21 4.0 22 10.0 23 16.0 24 19.0 25 20.0 26 21.0 27 27.0 28 25.0 29 30.0 30 45.0 31 57.0 32 78.0 33 91.0 34 114.0 35 217.0 36 508.0 37 2653.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.07214428857716 24.248496993987974 13.326653306613226 26.352705410821642 2 29.391130042595844 26.634928589325984 28.71460786770233 15.259333500375845 3 21.303258145363408 29.022556390977446 29.598997493734338 20.075187969924812 4 23.076923076923077 34.37734903532949 23.177148584314708 19.368579303432725 5 25.231771485843147 35.52994237033325 21.57354046604861 17.66474567777499 6 22.105263157894736 37.89473684210527 22.005012531328322 17.99498746867168 7 21.82639237330657 23.08078273958856 36.728549924736576 18.364274962368288 8 20.822880080280985 26.94430506773708 26.84395383843452 25.388861013547416 9 21.9573400250941 24.24090338770389 29.585947302383943 24.215809284818068 10-14 23.92939524621402 28.833617490723096 26.23608464547187 21.000902617591013 15-19 23.57894736842105 28.195488721804512 26.917293233082706 21.30827067669173 20-24 23.88022270150976 28.58504288508803 26.884686763304412 20.650047650097807 25-29 23.79471228615863 28.21451863743541 27.160989314202578 20.829779762203383 30-34 23.53236075600341 28.094450293277184 27.207098811851406 21.166090138868 35-39 23.650140505820954 27.714773183460455 27.43376154154958 21.20132476916901 40-44 23.70983935742972 28.07730923694779 27.32429718875502 20.88855421686747 45-49 24.445448158185286 27.431496537187595 27.105289571414232 21.017765733212887 50-54 23.801876850504343 28.438801625934662 26.998544688111608 20.76077683544939 55-59 24.27661601725089 28.10290356551828 26.90436788526152 20.716112531969312 60-64 23.512293025589564 27.64676367285499 27.65679879578525 21.184144505770195 65-69 23.993978926241848 28.003010536879074 27.551430005017565 20.451580531861516 70-74 23.69358967923297 27.819888559811258 27.533758345464587 20.95276341549119 75-79 23.809284818067756 27.387703889585946 28.095357590966124 20.707653701380178 80-84 23.724220984494956 27.748507200561995 27.8037031461689 20.72356866877415 85-89 24.484057243283956 27.351242781822748 27.421541551594274 20.743158423299022 90-94 24.002609524765393 27.630852612033923 27.706127364881816 20.660410498318864 95-99 23.960475497818127 27.832672919697043 27.240808546922807 20.96604303556202 100-104 24.627502132142677 27.878392615261127 27.075703607083728 20.418401645512464 105-109 24.293955354903435 27.373965387509408 27.75018811136193 20.58189114622523 110-114 24.695137250966027 27.565614492899083 27.2645154815075 20.47473277462739 115-119 24.771746764322263 27.801745761011336 26.923848700712348 20.50265877395405 120-124 24.661178596526454 27.803433390221866 27.1458688886658 20.389519124585885 125-129 24.93596504444779 27.632966701823115 27.180955250866358 20.250113002862737 130-134 25.234818423828422 27.41975990757949 26.957657340901097 20.387764327690995 135-139 25.542168674698797 27.65060240963855 27.083333333333332 19.723895582329316 140-144 25.348930615523646 28.08514911135656 26.33296515714429 20.2329551159755 145-149 26.233622810099895 27.18739019125546 26.615129762562123 19.96385723608253 150-151 25.2222917971196 28.040075140889165 26.449592986850345 20.28804007514089 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 7.0 1 3.5 2 0.5 3 0.5 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 0.5 25 1.0 26 1.0 27 2.0 28 2.5 29 2.5 30 4.5 31 12.0 32 24.0 33 27.0 34 32.5 35 47.5 36 62.0 37 74.0 38 117.5 39 156.0 40 176.0 41 224.5 42 278.0 43 294.5 44 292.5 45 286.0 46 273.5 47 262.5 48 249.5 49 218.0 50 180.5 51 151.0 52 130.0 53 105.5 54 77.5 55 61.5 56 36.5 57 31.0 58 29.0 59 18.0 60 11.5 61 9.0 62 6.5 63 3.0 64 4.5 65 4.0 66 1.0 67 0.0 68 0.0 69 0.5 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.22499999999999998 3 0.25 4 0.22499999999999998 5 0.22499999999999998 6 0.25 7 0.35000000000000003 8 0.35000000000000003 9 0.375 10-14 0.29 15-19 0.25 20-24 0.315 25-29 0.335 30-34 0.265 35-39 0.36 40-44 0.4 45-49 0.37 50-54 0.365 55-59 0.295 60-64 0.35000000000000003 65-69 0.35000000000000003 70-74 0.395 75-79 0.375 80-84 0.35500000000000004 85-89 0.42500000000000004 90-94 0.365 95-99 0.315 100-104 0.335 105-109 0.325 110-114 0.365 115-119 0.33 120-124 0.38999999999999996 125-129 0.445 130-134 0.455 135-139 0.4 140-144 0.41000000000000003 145-149 0.395 150-151 0.1875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39531368102796 98.625 2 0.5542957923910304 1.0999999999999999 3 0.0 0.0 4 0.02519526329050139 0.1 5 0.0 0.0 6 0.0 0.0 7 0.02519526329050139 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.36250000000000004 0.0 0.0 0.0 0.0 96-97 0.5375 0.0 0.0 0.0 0.0 98-99 0.75 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 0.9375 0.0 0.0 0.0 0.0 104-105 1.0375 0.0 0.0 0.0 0.0 106-107 1.225 0.0 0.0 0.0 0.0 108-109 1.5375 0.0 0.0 0.0 0.0 110-111 1.725 0.0 0.0 0.0 0.0 112-113 1.975 0.0 0.0 0.0 0.0 114-115 2.325 0.0 0.0 0.0 0.0 116-117 2.7 0.0 0.0 0.0 0.0 118-119 3.1125 0.0 0.0 0.0 0.0 120-121 3.325 0.0 0.0 0.0 0.0 122-123 3.525 0.0 0.0 0.0 0.0 124-125 3.9125 0.0 0.0 0.0 0.0 126-127 4.362500000000001 0.0 0.0 0.0 0.0 128-129 4.9375 0.0 0.0 0.0 0.0 130-131 5.387499999999999 0.0 0.0 0.0 0.0 132-133 5.8875 0.0 0.0 0.0 0.0 134-135 6.25 0.0 0.0 0.0 0.0 136-137 6.925 0.0 0.0 0.0 0.0 138-139 7.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGAACT 10 0.006830828 145.0 3 >>END_MODULE Read 1164137 spots for SRR7169633.sra Written 1164137 spots for SRR7169633.sra Read 1164137 spots for SRR7169633.sra Written 1164137 spots for SRR7169633.sra Read 1164137 spots for SRR7169633.sra Written 1164137 spots for SRR7169633.sra Read 1164137 spots for SRR7169633.sra Written 1164137 spots for SRR7169633.sra Read 1164137 spots for SRR7169633.sra Written 1164137 spots for SRR7169633.sra Read 1164137 spots for SRR7169633.sra Written 1164137 spots for SRR7169633.sra Read 1164137 spots for SRR7169633.sra Written 1164137 spots for SRR7169633.sra Read 1164137 spots for SRR7169633.sra Written 1164137 spots for SRR7169633.sra Read 1164137 spots for SRR7169633.sra Written 1164137 spots for SRR7169633.sra Read 1164137 spots for SRR7169633.sra Written 1164137 spots for SRR7169633.sra Read 1164137 spots for SRR7169633.sra Written 1164137 spots for SRR7169633.sra Read 1164137 spots for SRR7169633.sra Written 1164137 spots for SRR7169633.sra Read 1164137 spots for SRR7169633.sra Written 1164137 spots for SRR7169633.sra Read 1164137 spots for SRR7169633.sra Written 1164137 spots for SRR7169633.sra Read 1164137 spots for SRR7169633.sra Written 1164137 spots for SRR7169633.sra Read 1164137 spots for SRR7169633.sra Written 1164137 spots for SRR7169633.sra Read 1164155 spots for SRR7169633.sra Written 1164155 spots for SRR7169633.sra Read 1164137 spots for SRR7169633.sra Written 1164137 spots for SRR7169633.sra Read 1164137 spots for SRR7169633.sra Written 1164137 spots for SRR7169633.sra Read 1164137 spots for SRR7169633.sra Written 1164137 spots for SRR7169633.sra SRR ids: ['SRR7169633.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gvjmkp_p SRR7169633.sra spots: 23282758 blocks: [[1, 1164137], [1164138, 2328274], [2328275, 3492411], [3492412, 4656548], [4656549, 5820685], [5820686, 6984822], [6984823, 8148959], [8148960, 9313096], [9313097, 10477233], [10477234, 11641370], [11641371, 12805507], [12805508, 13969644], [13969645, 15133781], [15133782, 16297918], [16297919, 17462055], [17462056, 18626192], [18626193, 19790329], [19790330, 20954466], [20954467, 22118603], [22118604, 23282758]] SRR7169633 file size 7868062 SRR7169633 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169633 SRR7169633_1.fastq SRR7169633_2.fastq Input file: SRR7169633_1.fastq Paired file: SRR7169633_2.fastq trimmed: SRR7169633-trimmed-pair1.fastq, SRR7169633-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 11:56:57 2025 >> started Tue Feb 11 11:57:23 2025 >> done (25.567s) 23282758 read pairs processed; of these: 30694 ( 0.13%) short read pairs filtered out after trimming by size control 87800 ( 0.38%) empty read pairs filtered out after trimming by size control 23164264 (99.49%) read pairs available; of these: 11649224 (50.29%) trimmed read pairs available after processing 11515040 (49.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 6 0.00% 20 5 0.00% 21 8 0.00% 22 9 0.00% 23 9 0.00% 24 13 0.00% 25 14 0.00% 26 10 0.00% 27 17 0.00% 28 10 0.00% 29 15 0.00% 30 17 0.00% 31 18 0.00% 32 16 0.00% 33 16 0.00% 34 11 0.00% 35 12 0.00% 36 16 0.00% 37 29 0.00% 38 30 0.00% 39 25 0.00% 40 27 0.00% 41 34 0.00% 42 37 0.00% 43 42 0.00% 44 51 0.00% 45 61 0.00% 46 62 0.00% 47 65 0.00% 48 70 0.00% 49 101 0.00% 50 123 0.00% 51 120 0.00% 52 149 0.00% 53 137 0.00% 54 161 0.00% 55 162 0.00% 56 182 0.00% 57 182 0.00% 58 246 0.00% 59 310 0.00% 60 323 0.00% 61 356 0.00% 62 403 0.00% 63 477 0.00% 64 526 0.00% 65 585 0.00% 66 715 0.00% 67 885 0.00% 68 1162 0.01% 69 1972 0.01% 70 1900 0.01% 71 1466 0.01% 72 1505 0.01% 73 1700 0.01% 74 1879 0.01% 75 2104 0.01% 76 2286 0.01% 77 2615 0.01% 78 2913 0.01% 79 3305 0.01% 80 3600 0.02% 81 4096 0.02% 82 4736 0.02% 83 5379 0.02% 84 7380 0.03% 85 8294 0.04% 86 8593 0.04% 87 9333 0.04% 88 9960 0.04% 89 10720 0.05% 90 11546 0.05% 91 12335 0.05% 92 13098 0.06% 93 14136 0.06% 94 15177 0.07% 95 16388 0.07% 96 17488 0.08% 97 18329 0.08% 98 19323 0.08% 99 20104 0.09% 100 21291 0.09% 101 22571 0.10% 102 24215 0.10% 103 25636 0.11% 104 27013 0.12% 105 29044 0.13% 106 30634 0.13% 107 31377 0.14% 108 32604 0.14% 109 33796 0.15% 110 35124 0.15% 111 36632 0.16% 112 38788 0.17% 113 41097 0.18% 114 42537 0.18% 115 45167 0.19% 116 46585 0.20% 117 48820 0.21% 118 50609 0.22% 119 51470 0.22% 120 53553 0.23% 121 55394 0.24% 122 57150 0.25% 123 60412 0.26% 124 63411 0.27% 125 65962 0.28% 126 69098 0.30% 127 73042 0.32% 128 75168 0.32% 129 77993 0.34% 130 81721 0.35% 131 84940 0.37% 132 88748 0.38% 133 93634 0.40% 134 98420 0.42% 135 103745 0.45% 136 111047 0.48% 137 117158 0.51% 138 123638 0.53% 139 132050 0.57% 140 141132 0.61% 141 152436 0.66% 142 168561 0.73% 143 186549 0.81% 144 214201 0.92% 145 254149 1.10% 146 313010 1.35% 147 420249 1.81% 148 644565 2.78% 149 1190642 5.14% 150 5300707 22.88% 151 11515040 49.71% 23164264 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=3.19 fanout-score-rank=35 prefix-density=0.22 prefix-fanout=2.7 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.02 sequence-density-rank=43 fanout-score=229.35 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=16.5 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=41 prefix-density=0.20 prefix-fanout=2.2 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=42 fanout-score=158.71 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=14.3 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCACGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGAT SRR7169633 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 11:58:03 Started mapping on | Feb 11 11:58:03 Finished on | Feb 11 12:00:05 Mapping speed, Million of reads per hour | 683.54 Number of input reads | 23164264 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 22025421 Uniquely mapped reads % | 95.08% Average mapped length | 293.05 Number of splices: Total | 20516304 Number of splices: Annotated (sjdb) | 20180807 Number of splices: GT/AG | 20223568 Number of splices: GC/AG | 237023 Number of splices: AT/AC | 17729 Number of splices: Non-canonical | 37984 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.02% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 431187 % of reads mapped to multiple loci | 1.86% Number of reads mapped to too many loci | 37510 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.85% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 734081 734081 734081 N_multimapping 431187 431187 431187 N_noFeature 412111 21765767 523372 N_ambiguous 233781 1156 84671 UnstrandedReadsAssigned:21379529 PositiveStrandReadsAssigned:258498 NegativeStrandReadsAssigned:21417378 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169633 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169633-trimmed-pair1.fastq SRR7169633-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,164,264 reads, 21,331,086 reads pseudoaligned [quant] estimated average fragment length: 233.935 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,140 rounds 52401 SRR7169633.ke.tsv 34699 SRR7169633.se.tsv 87100 total ==> SRR7169633.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1785.06 415 10.348 Potri.005G024800.1.v4.1 1035 802.065 50 2.77474 Potri.004G059700.1.v4.1 961 728.091 5 0.305666 Potri.007G009000.2.v4.1 1416 1183.06 0 0 Potri.003G141000.2.v4.1 2943 2710.06 407 6.68462 Potri.016G087400.1.v4.1 270 81.8698 2604 1415.73 Potri.015G069301.1.v4.1 564 334.412 0 0 Potri.010G195200.1.v4.1 1773 1540.06 71 2.05202 Potri.012G127500.1.v4.1 977 744.078 5372 321.351 ==> SRR7169633.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2521 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 302 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 20 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169633 completed mapping pipeline successfully