Starting /dee2/code/volunteer_pipeline.sh SRR7169634 current disk space = 3051388030976 free memory = 1494361624 SRR7169634 SRAfilesize 6db7d6158583a26f7cb2986d5ea85f84 SRR7169634.sra SRR7169634.sra file validated SRR7169634 is paired end SRR7169634 is conventional basespace SRR7169634 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169634_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7225 34.0 33.0 34.0 33.0 34.0 2 33.34325 34.0 33.0 34.0 33.0 34.0 3 33.4045 34.0 34.0 34.0 33.0 34.0 4 33.44375 34.0 34.0 34.0 33.0 34.0 5 33.422 34.0 34.0 34.0 33.0 34.0 6 37.09425 38.0 37.0 38.0 36.0 38.0 7 37.2825 38.0 38.0 38.0 37.0 38.0 8 37.4035 38.0 38.0 38.0 37.0 38.0 9 37.46775 38.0 38.0 38.0 37.0 38.0 10-14 37.51365 38.0 38.0 38.0 38.0 38.0 15-19 37.470299999999995 38.0 38.0 38.0 37.6 38.0 20-24 37.43205 38.0 38.0 38.0 37.4 38.0 25-29 37.41125 38.0 38.0 38.0 37.2 38.0 30-34 37.343 38.0 38.0 38.0 37.0 38.0 35-39 37.2573 38.0 38.0 38.0 37.0 38.0 40-44 37.1018 38.0 38.0 38.0 36.2 38.0 45-49 37.08365 38.0 38.0 38.0 36.0 38.0 50-54 37.039500000000004 38.0 38.0 38.0 36.0 38.0 55-59 36.9459 38.0 38.0 38.0 36.0 38.0 60-64 36.92225 38.0 38.0 38.0 36.0 38.0 65-69 36.81885 38.0 38.0 38.0 35.2 38.0 70-74 36.79805 38.0 38.0 38.0 35.4 38.0 75-79 36.74185000000001 38.0 38.0 38.0 34.8 38.0 80-84 36.570299999999996 38.0 38.0 38.0 34.0 38.0 85-89 36.53995 38.0 38.0 38.0 34.2 38.0 90-94 36.33775 38.0 38.0 38.0 34.0 38.0 95-99 36.1796 38.0 37.6 38.0 33.8 38.0 100-104 35.919650000000004 38.0 37.0 38.0 32.6 38.0 105-109 35.806 38.0 37.0 38.0 32.0 38.0 110-114 35.648399999999995 38.0 37.0 38.0 31.0 38.0 115-119 35.31305 38.0 36.0 38.0 29.6 38.0 120-124 35.08155 38.0 36.0 38.0 28.2 38.0 125-129 34.85809999999999 38.0 35.8 38.0 27.2 38.0 130-134 34.70345 38.0 35.2 38.0 27.0 38.0 135-139 34.4144 38.0 35.0 38.0 25.8 38.0 140-144 33.972449999999995 38.0 35.0 38.0 23.0 38.0 145-149 33.16415 38.0 34.4 38.0 16.8 38.0 150-151 29.536 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 1.0 11 1.0 12 2.0 13 2.0 14 2.0 15 1.0 16 3.0 17 3.0 18 7.0 19 5.0 20 8.0 21 8.0 22 8.0 23 10.0 24 13.0 25 12.0 26 15.0 27 31.0 28 39.0 29 47.0 30 50.0 31 63.0 32 84.0 33 107.0 34 151.0 35 266.0 36 653.0 37 2406.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.809037528720964 11.998978810314016 8.475874393668624 35.716109267296396 2 23.75 14.249999999999998 32.925 29.075 3 20.724999999999998 17.224999999999998 26.325 35.725 4 23.375 25.775 23.275000000000002 27.575 5 23.7 30.3 24.625 21.375 6 19.8 35.025 24.775 20.4 7 13.925 25.900000000000002 42.199999999999996 17.974999999999998 8 18.575 26.0 30.175 25.25 9 16.475 25.900000000000002 33.875 23.75 10-14 19.79 29.494999999999997 27.800000000000004 22.915 15-19 20.025000000000002 28.21 27.73 24.035 20-24 19.96 29.09 27.11 23.84 25-29 19.905 28.904999999999998 27.084999999999997 24.104999999999997 30-34 20.095 28.305000000000003 27.894999999999996 23.705000000000002 35-39 20.45 28.51 27.250000000000004 23.79 40-44 19.72 28.575 27.42 24.285 45-49 19.835 28.79 27.11 24.265 50-54 20.0 28.144999999999996 27.55 24.305 55-59 20.119999999999997 28.26 27.339999999999996 24.279999999999998 60-64 20.505000000000003 27.779999999999998 27.675 24.04 65-69 19.86 28.23 27.975 23.935000000000002 70-74 20.845 28.194999999999997 27.355 23.605 75-79 20.24 28.055000000000003 27.05 24.654999999999998 80-84 20.294999999999998 28.439999999999998 27.13 24.135 85-89 21.044999999999998 27.975 27.38 23.599999999999998 90-94 20.53 28.33 26.784999999999997 24.355 95-99 21.135 27.82 27.48 23.565 100-104 20.749337201740783 27.582412085438445 26.987144214896702 24.681106497924066 105-109 20.735 27.26 27.865000000000002 24.14 110-114 20.723470255666182 27.64797118126782 27.6329614249262 23.99559713813979 115-119 21.081324397319197 27.70331099329799 27.27818345503651 23.937181154346305 120-124 20.774348456805562 28.132659696863588 27.63743684658096 23.455554999749886 125-129 21.27 27.744999999999997 27.36 23.625 130-134 21.172410343620268 28.534987245535937 26.844395538438455 23.448206872405343 135-139 21.154999999999998 27.794999999999998 27.305 23.745 140-144 21.145 27.455000000000002 27.62 23.78 145-149 21.465 28.305000000000003 26.56 23.669999999999998 150-151 20.0375 28.1125 27.400000000000002 24.45 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 1.0 24 2.0 25 2.0 26 3.5 27 5.5 28 5.0 29 8.0 30 17.0 31 22.5 32 23.0 33 34.0 34 46.0 35 53.5 36 79.5 37 96.5 38 108.0 39 151.5 40 170.5 41 205.5 42 256.5 43 248.5 44 247.0 45 272.5 46 283.0 47 285.0 48 264.0 49 226.0 50 185.5 51 140.5 52 123.0 53 110.0 54 85.5 55 59.0 56 44.0 57 39.5 58 27.0 59 17.0 60 14.0 61 9.5 62 6.5 63 5.0 64 2.5 65 2.5 66 3.0 67 2.0 68 1.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.045 105-109 0.0 110-114 0.065 115-119 0.03 120-124 0.045 125-129 0.0 130-134 0.034999999999999996 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.037500000000000006 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.5375000000000001 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.6375 0.0 0.0 0.0 0.0 106-107 0.7375 0.0 0.0 0.0 0.0 108-109 0.85 0.0 0.0 0.0 0.0 110-111 0.95 0.0 0.0 0.0 0.0 112-113 1.05 0.0 0.0 0.0 0.0 114-115 1.1625 0.0 0.0 0.0 0.0 116-117 1.3875000000000002 0.0 0.0 0.0 0.0 118-119 1.575 0.0 0.0 0.0 0.0 120-121 1.8 0.0 0.0 0.0 0.0 122-123 1.9874999999999998 0.0 0.0 0.0 0.0 124-125 2.1125 0.0 0.0 0.0 0.0 126-127 2.225 0.0 0.0 0.0 0.0 128-129 2.4749999999999996 0.0 0.0 0.0 0.0 130-131 2.8125 0.0 0.0 0.0 0.0 132-133 3.0875000000000004 0.0 0.0 0.0 0.0 134-135 3.425 0.0 0.0 0.0 0.0 136-137 3.8 0.0 0.0 0.0 0.0 138-139 4.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGCTT 10 0.0063298983 148.6923 1 >>END_MODULE SRR7169634 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169634_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.509 33.0 33.0 34.0 32.0 34.0 2 32.705 33.0 33.0 34.0 32.0 34.0 3 32.7805 34.0 33.0 34.0 32.0 34.0 4 32.77325 34.0 33.0 34.0 32.0 34.0 5 32.78525 34.0 33.0 34.0 32.0 34.0 6 36.88625 38.0 38.0 38.0 36.0 38.0 7 36.95025 38.0 38.0 38.0 36.0 38.0 8 36.873 38.0 38.0 38.0 36.0 38.0 9 36.9595 38.0 38.0 38.0 36.0 38.0 10-14 36.843399999999995 38.0 38.0 38.0 36.0 38.0 15-19 36.8622 38.0 38.0 38.0 36.0 38.0 20-24 36.87330000000001 38.0 38.0 38.0 36.0 38.0 25-29 36.908550000000005 38.0 38.0 38.0 36.0 38.0 30-34 36.91405 38.0 38.0 38.0 36.0 38.0 35-39 36.78320000000001 38.0 38.0 38.0 36.0 38.0 40-44 36.766999999999996 38.0 38.0 38.0 36.0 38.0 45-49 36.7181 38.0 38.0 38.0 35.6 38.0 50-54 36.53655 38.0 38.0 38.0 35.4 38.0 55-59 36.1963 38.0 38.0 38.0 34.6 38.0 60-64 35.936249999999994 38.0 38.0 38.0 34.2 38.0 65-69 35.813900000000004 38.0 38.0 38.0 34.0 38.0 70-74 35.6991 38.0 38.0 38.0 33.4 38.0 75-79 35.5169 38.0 38.0 38.0 33.0 38.0 80-84 35.68595 38.0 38.0 38.0 33.2 38.0 85-89 35.744550000000004 38.0 38.0 38.0 33.2 38.0 90-94 35.65635 38.0 38.0 38.0 32.6 38.0 95-99 35.5921 38.0 38.0 38.0 32.0 38.0 100-104 35.444750000000006 38.0 38.0 38.0 31.0 38.0 105-109 35.46485 38.0 38.0 38.0 31.4 38.0 110-114 35.336999999999996 38.0 38.0 38.0 30.8 38.0 115-119 34.908750000000005 38.0 37.0 38.0 27.8 38.0 120-124 34.756099999999996 38.0 36.8 38.0 27.2 38.0 125-129 34.54555 38.0 36.4 38.0 26.0 38.0 130-134 34.11775 38.0 36.0 38.0 22.6 38.0 135-139 33.7367 38.0 35.4 38.0 17.8 38.0 140-144 33.308049999999994 38.0 35.0 38.0 14.6 38.0 145-149 32.3984 38.0 34.2 38.0 8.6 38.0 150-151 28.660249999999998 36.0 18.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 5.0 4 3.0 5 2.0 6 3.0 7 1.0 8 2.0 9 2.0 10 9.0 11 7.0 12 6.0 13 16.0 14 29.0 15 3.0 16 5.0 17 7.0 18 6.0 19 9.0 20 13.0 21 20.0 22 15.0 23 22.0 24 21.0 25 17.0 26 31.0 27 33.0 28 39.0 29 45.0 30 41.0 31 60.0 32 70.0 33 95.0 34 126.0 35 185.0 36 450.0 37 2596.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.63987945755902 24.81165243596183 11.551983927674534 26.996484178804618 2 27.200000000000003 28.725 27.825 16.25 3 20.95 30.025000000000002 29.225 19.8 4 23.0 32.725 24.95 19.325 5 23.775 36.6 22.05 17.575 6 21.325 37.6 22.75 18.325 7 21.875 21.9 36.7 19.525000000000002 8 21.925 26.224999999999998 27.55 24.3 9 21.0 25.324999999999996 30.65 23.025000000000002 10-14 23.754252551530918 29.39263558134881 25.310186111667 21.542925755453272 15-19 23.377857821801992 27.970383711041073 27.310020511281202 21.341737955875733 20-24 23.0 28.075 27.165 21.759999999999998 25-29 23.32 28.055000000000003 27.445000000000004 21.18 30-34 22.770000000000003 28.255000000000003 28.265 20.71 35-39 22.900000000000002 28.28 27.339999999999996 21.48 40-44 23.235 27.560000000000002 27.900000000000002 21.305 45-49 23.544999999999998 28.244999999999997 26.840000000000003 21.37 50-54 23.327641623141822 28.20912012856569 27.355363599839293 21.107874648453194 55-59 23.55749695245835 27.666598943518895 27.38216172287688 21.393742381145874 60-64 23.3285699703991 28.039195672144533 27.462488516892925 21.169745840563436 65-69 23.51675376575469 28.44041397684189 27.154421559586023 20.8884106978174 70-74 23.446153846153848 28.425641025641024 27.17948717948718 20.94871794871795 75-79 23.640285552873504 27.7695033639772 27.327820861794468 21.262390221354835 80-84 23.485816509072325 28.264758497316638 27.446971633018148 20.802453360592896 85-89 23.742945752198892 27.378107682139408 27.942447506228074 20.93649905943363 90-94 24.10746026103296 27.088517596871668 27.911228480016252 20.89279366207912 95-99 24.133043082063484 28.03118513643497 27.418619956462308 20.417151825039234 100-104 24.210845811412383 27.003237555645487 27.772157021448805 21.01375961149332 105-109 24.21196201252778 27.545968882602544 27.13174378662356 21.110325318246108 110-114 23.81745671159574 28.189206926144685 27.235095158766214 20.75824120349336 115-119 24.09954158480681 27.66107500881568 26.965895924638556 21.273487481738957 120-124 24.129766762379727 27.75175054153443 27.439423706614274 20.679058989471564 125-129 24.62629845452242 27.808462123131495 26.749429946795033 20.81580947555105 130-134 25.14117108409218 27.50165335503892 26.90644554102864 20.45073001984026 135-139 24.524831391784183 27.66196607398324 27.258328223993463 20.554874310239118 140-144 24.576488049541943 28.031117252674136 26.720917140078814 20.671477557705103 145-149 25.208183407011415 27.942839518865014 26.36989822144546 20.47907885267811 150-151 25.439049586776857 27.221074380165287 26.924070247933884 20.41580578512397 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 1.0 18 1.5 19 4.0 20 5.5 21 5.0 22 6.0 23 6.0 24 7.5 25 9.0 26 9.0 27 8.0 28 8.0 29 10.0 30 13.0 31 15.5 32 16.5 33 21.0 34 34.0 35 55.5 36 79.5 37 92.5 38 117.0 39 158.0 40 184.5 41 216.5 42 250.5 43 270.5 44 292.0 45 285.0 46 275.0 47 276.0 48 238.0 49 198.0 50 177.0 51 151.0 52 127.5 53 101.5 54 70.0 55 51.5 56 37.5 57 29.5 58 26.0 59 17.0 60 11.0 61 7.0 62 4.5 63 5.5 64 3.5 65 1.0 66 1.0 67 0.5 68 0.5 69 0.5 70 0.5 71 1.5 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.44999999999999996 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.06 15-19 0.055 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.44 55-59 1.5599999999999998 60-64 2.03 65-69 2.41 70-74 2.5 75-79 2.645 80-84 2.175 85-89 1.6549999999999998 90-94 1.545 95-99 1.2349999999999999 100-104 1.16 105-109 1.02 110-114 0.955 115-119 0.745 120-124 0.745 125-129 1.325 130-134 1.7149999999999999 135-139 2.1399999999999997 140-144 2.305 145-149 2.73 150-151 3.2 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.037500000000000006 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.5375000000000001 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.6375 0.0 0.0 0.0 0.0 106-107 0.75 0.0 0.0 0.0 0.0 108-109 0.9 0.0 0.0 0.0 0.0 110-111 1.0 0.0 0.0 0.0 0.0 112-113 1.1 0.0 0.0 0.0 0.0 114-115 1.2125 0.0 0.0 0.0 0.0 116-117 1.4375 0.0 0.0 0.0 0.0 118-119 1.6 0.0 0.0 0.0 0.0 120-121 1.825 0.0 0.0 0.0 0.0 122-123 2.0125 0.0 0.0 0.0 0.0 124-125 2.1375 0.0 0.0 0.0 0.0 126-127 2.275 0.0 0.0 0.0 0.0 128-129 2.5250000000000004 0.0 0.0 0.0 0.0 130-131 2.8125 0.0 0.0 0.0 0.0 132-133 3.075 0.0 0.0 0.0 0.0 134-135 3.425 0.0 0.0 0.0 0.0 136-137 3.7750000000000004 0.0 0.0 0.0 0.0 138-139 4.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTAGAG 10 0.007122333 142.9875 1 ATATGCA 10 0.007122333 142.9875 8 AAAAAAC 10 0.007122333 142.9875 6 CTTCTCT 10 0.007122333 142.9875 3 CCGAATG 10 0.007122333 142.9875 1 >>END_MODULE Read 920121 spots for SRR7169634.sra Written 920121 spots for SRR7169634.sra Read 920121 spots for SRR7169634.sra Written 920121 spots for SRR7169634.sra Read 920121 spots for SRR7169634.sra Written 920121 spots for SRR7169634.sra Read 920121 spots for SRR7169634.sra Written 920121 spots for SRR7169634.sra Read 920121 spots for SRR7169634.sra Written 920121 spots for SRR7169634.sra Read 920121 spots for SRR7169634.sra Written 920121 spots for SRR7169634.sra Read 920121 spots for SRR7169634.sra Written 920121 spots for SRR7169634.sra Read 920121 spots for SRR7169634.sra Written 920121 spots for SRR7169634.sra Read 920121 spots for SRR7169634.sra Written 920121 spots for SRR7169634.sra Read 920121 spots for SRR7169634.sra Written 920121 spots for SRR7169634.sra Read 920121 spots for SRR7169634.sra Written 920121 spots for SRR7169634.sra Read 920121 spots for SRR7169634.sra Written 920121 spots for SRR7169634.sra Read 920121 spots for SRR7169634.sra Written 920121 spots for SRR7169634.sra Read 920121 spots for SRR7169634.sra Written 920121 spots for SRR7169634.sra Read 920121 spots for SRR7169634.sra Written 920121 spots for SRR7169634.sra Read 920121 spots for SRR7169634.sra Written 920121 spots for SRR7169634.sra Read 920121 spots for SRR7169634.sra Written 920121 spots for SRR7169634.sra Read 920121 spots for SRR7169634.sra Written 920121 spots for SRR7169634.sra Read 920121 spots for SRR7169634.sra Written 920121 spots for SRR7169634.sra Read 920130 spots for SRR7169634.sra Written 920130 spots for SRR7169634.sra SRR ids: ['SRR7169634.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kydwg53g SRR7169634.sra spots: 18402429 blocks: [[1, 920121], [920122, 1840242], [1840243, 2760363], [2760364, 3680484], [3680485, 4600605], [4600606, 5520726], [5520727, 6440847], [6440848, 7360968], [7360969, 8281089], [8281090, 9201210], [9201211, 10121331], [10121332, 11041452], [11041453, 11961573], [11961574, 12881694], [12881695, 13801815], [13801816, 14721936], [14721937, 15642057], [15642058, 16562178], [16562179, 17482299], [17482300, 18402429]] SRR7169634 file size 6214278 SRR7169634 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169634 SRR7169634_1.fastq SRR7169634_2.fastq Input file: SRR7169634_1.fastq Paired file: SRR7169634_2.fastq trimmed: SRR7169634-trimmed-pair1.fastq, SRR7169634-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 11:55:15 2025 >> started Tue Feb 11 11:55:37 2025 >> done (21.748s) 18402429 read pairs processed; of these: 17037 ( 0.09%) short read pairs filtered out after trimming by size control 13481 ( 0.07%) empty read pairs filtered out after trimming by size control 18371911 (99.83%) read pairs available; of these: 9725112 (52.93%) trimmed read pairs available after processing 8646799 (47.07%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 14 0.00% 20 4 0.00% 21 6 0.00% 22 3 0.00% 23 10 0.00% 24 6 0.00% 25 9 0.00% 26 11 0.00% 27 13 0.00% 28 16 0.00% 29 14 0.00% 30 15 0.00% 31 11 0.00% 32 18 0.00% 33 14 0.00% 34 11 0.00% 35 15 0.00% 36 24 0.00% 37 23 0.00% 38 18 0.00% 39 37 0.00% 40 28 0.00% 41 33 0.00% 42 37 0.00% 43 34 0.00% 44 49 0.00% 45 50 0.00% 46 55 0.00% 47 59 0.00% 48 56 0.00% 49 74 0.00% 50 76 0.00% 51 85 0.00% 52 100 0.00% 53 102 0.00% 54 106 0.00% 55 120 0.00% 56 145 0.00% 57 168 0.00% 58 187 0.00% 59 168 0.00% 60 249 0.00% 61 257 0.00% 62 276 0.00% 63 334 0.00% 64 344 0.00% 65 434 0.00% 66 458 0.00% 67 504 0.00% 68 659 0.00% 69 854 0.00% 70 991 0.01% 71 850 0.00% 72 1024 0.01% 73 1234 0.01% 74 1415 0.01% 75 1915 0.01% 76 1591 0.01% 77 1381 0.01% 78 1817 0.01% 79 2964 0.02% 80 4665 0.03% 81 2015 0.01% 82 2419 0.01% 83 2754 0.01% 84 3744 0.02% 85 4548 0.02% 86 5176 0.03% 87 5335 0.03% 88 5547 0.03% 89 5839 0.03% 90 6129 0.03% 91 6497 0.04% 92 7109 0.04% 93 7898 0.04% 94 8586 0.05% 95 9196 0.05% 96 10012 0.05% 97 10900 0.06% 98 12299 0.07% 99 15034 0.08% 100 18666 0.10% 101 17227 0.09% 102 13768 0.07% 103 14021 0.08% 104 15228 0.08% 105 16165 0.09% 106 16945 0.09% 107 17895 0.10% 108 18707 0.10% 109 19553 0.11% 110 20358 0.11% 111 21769 0.12% 112 22788 0.12% 113 24434 0.13% 114 25865 0.14% 115 27675 0.15% 116 28649 0.16% 117 29877 0.16% 118 31283 0.17% 119 32399 0.18% 120 33786 0.18% 121 35542 0.19% 122 37469 0.20% 123 39670 0.22% 124 42085 0.23% 125 44152 0.24% 126 47122 0.26% 127 48836 0.27% 128 50982 0.28% 129 53398 0.29% 130 56197 0.31% 131 59027 0.32% 132 62847 0.34% 133 67602 0.37% 134 72109 0.39% 135 77550 0.42% 136 83210 0.45% 137 88616 0.48% 138 97306 0.53% 139 106789 0.58% 140 115480 0.63% 141 125319 0.68% 142 139001 0.76% 143 157973 0.86% 144 183793 1.00% 145 220904 1.20% 146 278385 1.52% 147 374894 2.04% 148 574643 3.13% 149 1156020 6.29% 150 4603852 25.06% 151 8646799 47.07% 18371911 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=3.41 fanout-score-rank=32 prefix-density=0.24 prefix-fanout=2.8 sequence=CTGGCCATTCAATGTGACATCCTCTTGAGTGGCTTTCAAAAGCCTGATAAAAACGCTGAACTGACCACCTTTTTCTAGGACTTTGGTGACATTGGTTGGACCGGGTGGTGCTGGGGCTGCAGCTGGTGACTGAGCTAGGGTTGGAGGGCAATGAAGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=168.80 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=12.7 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.44 fanout-score-rank=41 prefix-density=0.32 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=31 fanout-score=216.11 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=24.6 sequence=GAAGAAGAAGAAA SRR7169634 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 11:56:44 Started mapping on | Feb 11 11:56:44 Finished on | Feb 11 11:58:38 Mapping speed, Million of reads per hour | 580.17 Number of input reads | 18371911 Average input read length | 281 UNIQUE READS: Uniquely mapped reads number | 16491950 Uniquely mapped reads % | 89.77% Average mapped length | 281.20 Number of splices: Total | 15532397 Number of splices: Annotated (sjdb) | 15275122 Number of splices: GT/AG | 15308637 Number of splices: GC/AG | 177804 Number of splices: AT/AC | 12700 Number of splices: Non-canonical | 33256 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.02% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 299247 % of reads mapped to multiple loci | 1.63% Number of reads mapped to too many loci | 60372 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.20% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1596191 1596191 1596191 N_multimapping 299247 299247 299247 N_noFeature 321410 16316450 400565 N_ambiguous 193317 1755 95477 UnstrandedReadsAssigned:15977223 PositiveStrandReadsAssigned:173745 NegativeStrandReadsAssigned:15995908 Dataset is classified negative stranded MeadianReadLen=139 20thPercentileLength=138 echo kmer=133 SRR7169634 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169634-trimmed-pair1.fastq SRR7169634-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,371,911 reads, 16,954,637 reads pseudoaligned [quant] estimated average fragment length: 239.744 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,024 rounds 52401 SRR7169634.ke.tsv 34699 SRR7169634.se.tsv 87100 total ==> SRR7169634.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1779.26 332 11.0978 Potri.005G024800.1.v4.1 1035 796.256 46 3.4359 Potri.004G059700.1.v4.1 961 722.307 1 0.0823405 Potri.007G009000.2.v4.1 1416 1177.26 0 0 Potri.003G141000.2.v4.1 2943 2704.26 364.073 8.00711 Potri.016G087400.1.v4.1 270 82.0251 1423 1031.8 Potri.015G069301.1.v4.1 564 330.879 0 0 Potri.010G195200.1.v4.1 1773 1534.26 8 0.310118 Potri.012G127500.1.v4.1 977 738.301 6791 547.061 ==> SRR7169634.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1187 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 230 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169634 completed mapping pipeline successfully