Starting /dee2/code/volunteer_pipeline.sh SRR7169635 current disk space = 3050887397376 free memory = 1577838788 SRR7169635 SRAfilesize 58d6a688ae0761d1ace46a439cfed4ad SRR7169635.sra SRR7169635.sra file validated SRR7169635 is paired end SRR7169635 is conventional basespace SRR7169635 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169635_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9895 34.0 33.0 34.0 33.0 34.0 2 33.29 34.0 33.0 34.0 33.0 34.0 3 33.47625 34.0 34.0 34.0 33.0 34.0 4 33.50625 34.0 34.0 34.0 33.0 34.0 5 33.45675 34.0 34.0 34.0 33.0 34.0 6 37.153 38.0 38.0 38.0 36.0 38.0 7 37.4235 38.0 38.0 38.0 37.0 38.0 8 37.501 38.0 38.0 38.0 37.0 38.0 9 37.53675 38.0 38.0 38.0 38.0 38.0 10-14 37.533550000000005 38.0 38.0 38.0 38.0 38.0 15-19 37.506 38.0 38.0 38.0 37.6 38.0 20-24 37.48495 38.0 38.0 38.0 37.4 38.0 25-29 37.48845 38.0 38.0 38.0 37.8 38.0 30-34 37.4968 38.0 38.0 38.0 37.6 38.0 35-39 37.376149999999996 38.0 38.0 38.0 37.0 38.0 40-44 37.35935 38.0 38.0 38.0 37.0 38.0 45-49 37.290350000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.22 38.0 38.0 38.0 36.6 38.0 55-59 37.1987 38.0 38.0 38.0 36.6 38.0 60-64 37.14725 38.0 38.0 38.0 36.2 38.0 65-69 37.1614 38.0 38.0 38.0 36.0 38.0 70-74 37.05355 38.0 38.0 38.0 36.0 38.0 75-79 36.9844 38.0 38.0 38.0 36.0 38.0 80-84 36.938100000000006 38.0 38.0 38.0 35.8 38.0 85-89 36.81505 38.0 38.0 38.0 35.6 38.0 90-94 36.759100000000004 38.0 38.0 38.0 35.0 38.0 95-99 36.674099999999996 38.0 38.0 38.0 35.0 38.0 100-104 36.576350000000005 38.0 38.0 38.0 34.2 38.0 105-109 36.4686 38.0 38.0 38.0 34.0 38.0 110-114 36.34929999999999 38.0 38.0 38.0 34.0 38.0 115-119 36.16374999999999 38.0 37.6 38.0 33.6 38.0 120-124 35.9692 38.0 37.4 38.0 32.6 38.0 125-129 35.88215 38.0 37.0 38.0 33.0 38.0 130-134 35.640550000000005 38.0 36.4 38.0 31.6 38.0 135-139 35.3327 38.0 36.0 38.0 31.0 38.0 140-144 35.012 38.0 36.0 38.0 29.6 38.0 145-149 34.56265 38.0 35.2 38.0 28.0 38.0 150-151 31.66525 36.5 31.5 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 3.0 16 4.0 17 0.0 18 0.0 19 9.0 20 6.0 21 2.0 22 6.0 23 6.0 24 8.0 25 14.0 26 13.0 27 16.0 28 24.0 29 31.0 30 32.0 31 43.0 32 58.0 33 82.0 34 132.0 35 213.0 36 503.0 37 2793.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.26335781210433 12.788047606989112 10.61028108381869 36.33831349708787 2 23.75 14.000000000000002 32.35 29.9 3 20.775 17.95 26.075 35.199999999999996 4 22.475 24.474999999999998 24.9 28.15 5 23.875 29.7 24.15 22.275 6 19.975 33.900000000000006 24.224999999999998 21.9 7 15.275 27.125 40.125 17.474999999999998 8 17.974999999999998 26.450000000000003 29.025000000000002 26.55 9 17.025000000000002 25.75 33.75 23.474999999999998 10-14 19.6 29.87 26.865 23.665 15-19 19.7 28.165000000000003 27.76 24.375 20-24 19.895 28.910000000000004 27.455000000000002 23.74 25-29 19.785 29.635 26.840000000000003 23.74 30-34 20.165 28.74 27.794999999999998 23.3 35-39 20.29 28.565 27.534999999999997 23.61 40-44 20.18 28.985 27.245 23.59 45-49 20.035 28.595 27.495000000000005 23.875 50-54 19.869999999999997 28.54 27.455000000000002 24.135 55-59 19.919999999999998 28.199999999999996 27.515 24.365000000000002 60-64 20.27 28.34 27.325 24.065 65-69 19.91 28.499999999999996 27.16 24.43 70-74 19.66 29.099999999999998 27.150000000000002 24.09 75-79 20.150000000000002 28.005000000000003 27.49 24.355 80-84 20.595 27.725 27.325 24.355 85-89 20.665 27.955000000000002 27.67 23.71 90-94 20.125 27.36 28.015 24.5 95-99 20.330000000000002 28.084999999999997 27.084999999999997 24.5 100-104 20.77 28.115000000000002 27.29 23.825 105-109 20.695 27.955000000000002 27.455000000000002 23.895 110-114 20.385 28.685 26.740000000000002 24.19 115-119 20.630000000000003 27.975 27.115000000000002 24.279999999999998 120-124 21.025 27.92 26.650000000000002 24.404999999999998 125-129 20.52 27.744999999999997 27.455000000000002 24.279999999999998 130-134 20.25 28.255000000000003 27.065 24.43 135-139 20.599999999999998 28.144999999999996 26.650000000000002 24.605 140-144 21.39 27.884999999999998 26.305 24.42 145-149 20.724999999999998 27.839999999999996 26.76 24.675 150-151 20.349999999999998 28.625 26.787499999999998 24.2375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.0 21 0.5 22 1.5 23 1.0 24 0.5 25 1.5 26 3.0 27 5.0 28 8.0 29 10.5 30 15.0 31 19.5 32 27.5 33 36.5 34 41.0 35 60.0 36 80.5 37 97.0 38 121.5 39 141.0 40 177.5 41 224.0 42 240.5 43 242.5 44 272.0 45 300.5 46 269.5 47 252.5 48 250.0 49 218.5 50 185.5 51 153.0 52 129.0 53 104.5 54 77.5 55 50.5 56 37.5 57 36.0 58 30.5 59 21.0 60 13.0 61 10.5 62 6.5 63 2.0 64 4.5 65 7.0 66 3.0 67 0.5 68 1.5 69 2.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.275 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.36250000000000004 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.6625000000000001 0.0 0.0 0.0 0.0 102-103 0.8125 0.0 0.0 0.0 0.0 104-105 1.0 0.0 0.0 0.0 0.0 106-107 1.2374999999999998 0.0 0.0 0.0 0.0 108-109 1.3625 0.0 0.0 0.0 0.0 110-111 1.4875 0.0 0.0 0.0 0.0 112-113 1.6625 0.0 0.0 0.0 0.0 114-115 1.7875 0.0 0.0 0.0 0.0 116-117 2.0125 0.0 0.0 0.0 0.0 118-119 2.15 0.0 0.0 0.0 0.0 120-121 2.35 0.0 0.0 0.0 0.0 122-123 2.575 0.0 0.0 0.0 0.0 124-125 2.8499999999999996 0.0 0.0 0.0 0.0 126-127 3.2125 0.0 0.0 0.0 0.0 128-129 3.5875 0.0 0.0 0.0 0.0 130-131 3.9375 0.0 0.0 0.0 0.0 132-133 4.35 0.0 0.0 0.0 0.0 134-135 4.8125 0.0 0.0 0.0 0.0 136-137 5.125 0.0 0.0 0.0 0.0 138-139 5.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACATCCG 10 0.006830828 145.0 145 TTCCTGG 10 0.006830828 145.0 145 >>END_MODULE SRR7169635 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169635_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.84575 33.0 33.0 34.0 32.0 34.0 2 32.92875 34.0 33.0 34.0 32.0 34.0 3 32.9055 34.0 33.0 34.0 32.0 34.0 4 32.924 34.0 33.0 34.0 32.0 34.0 5 32.86975 34.0 33.0 34.0 32.0 34.0 6 37.00125 38.0 38.0 38.0 36.0 38.0 7 37.0955 38.0 38.0 38.0 37.0 38.0 8 37.02875 38.0 38.0 38.0 37.0 38.0 9 37.06625 38.0 38.0 38.0 37.0 38.0 10-14 36.962399999999995 38.0 38.0 38.0 37.0 38.0 15-19 36.981899999999996 38.0 38.0 38.0 37.0 38.0 20-24 36.94925 38.0 38.0 38.0 36.4 38.0 25-29 36.9045 38.0 38.0 38.0 36.6 38.0 30-34 36.888250000000006 38.0 38.0 38.0 36.4 38.0 35-39 36.85585 38.0 38.0 38.0 36.0 38.0 40-44 36.82475 38.0 38.0 38.0 36.0 38.0 45-49 36.881299999999996 38.0 38.0 38.0 36.4 38.0 50-54 36.83875 38.0 38.0 38.0 36.0 38.0 55-59 36.775549999999996 38.0 38.0 38.0 36.0 38.0 60-64 36.738099999999996 38.0 38.0 38.0 36.0 38.0 65-69 36.705499999999994 38.0 38.0 38.0 36.0 38.0 70-74 36.5577 38.0 38.0 38.0 35.4 38.0 75-79 36.480199999999996 38.0 38.0 38.0 35.0 38.0 80-84 36.38295000000001 38.0 38.0 38.0 34.6 38.0 85-89 36.35795 38.0 38.0 38.0 34.4 38.0 90-94 36.2558 38.0 38.0 38.0 34.0 38.0 95-99 36.230999999999995 38.0 38.0 38.0 34.0 38.0 100-104 36.16175 38.0 38.0 38.0 34.0 38.0 105-109 36.0462 38.0 38.0 38.0 34.0 38.0 110-114 35.94305 38.0 38.0 38.0 33.4 38.0 115-119 35.6357 38.0 37.8 38.0 31.4 38.0 120-124 35.42569999999999 38.0 37.0 38.0 31.4 38.0 125-129 35.263 38.0 36.6 38.0 30.0 38.0 130-134 35.1247 38.0 36.0 38.0 30.0 38.0 135-139 34.727850000000004 38.0 36.0 38.0 27.8 38.0 140-144 34.377300000000005 38.0 35.4 38.0 26.2 38.0 145-149 33.83365 38.0 34.6 38.0 23.0 38.0 150-151 30.358625 36.5 29.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 22.0 3 2.0 4 2.0 5 2.0 6 2.0 7 2.0 8 0.0 9 2.0 10 4.0 11 5.0 12 1.0 13 6.0 14 0.0 15 5.0 16 6.0 17 4.0 18 7.0 19 2.0 20 2.0 21 4.0 22 9.0 23 9.0 24 21.0 25 10.0 26 22.0 27 32.0 28 23.0 29 34.0 30 44.0 31 42.0 32 63.0 33 70.0 34 129.0 35 181.0 36 472.0 37 2759.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.429644466700054 22.458688032048073 15.42313470205308 25.6885327991988 2 29.193790686029043 26.264396594892336 27.84176264396595 16.700050075112667 3 21.968937875751504 28.38176352705411 29.909819639278556 19.739478957915832 4 23.491109441522664 32.682193839218634 23.716503881793138 20.110192837465565 5 24.56184276414622 34.80220330495744 23.234852278417627 17.40110165247872 6 21.668336673346694 36.322645290581164 23.49699398797595 18.512024048096194 7 20.516032064128257 23.171342685370742 36.64829659318637 19.664328657314627 8 22.945891783567134 25.826653306613228 27.07915831663327 24.148296593186373 9 22.739794640621085 26.37114951164538 28.875532181317304 22.01352366641623 10-14 24.015629696423204 28.544234044684902 25.799018134455466 21.641118124436428 15-19 23.662592666800244 28.446203165698257 26.90342616710078 20.987778000400723 20-24 23.351703406813627 28.2064128256513 27.049098196392784 21.392785571142284 25-29 24.387555733680678 28.0396773708732 26.702069034617505 20.870697860828617 30-34 23.58509466092357 28.0777321446459 27.366523089251725 20.970650105178805 35-39 23.58745742336205 27.795031055900623 27.714886796233216 20.902624724504108 40-44 24.029648920719186 27.134772374417786 27.239945910752745 21.59563279411028 45-49 23.47255608974359 27.584134615384613 27.57411858974359 21.369190705128204 50-54 23.158211048229578 28.707367155807084 26.64396253818801 21.490459257775328 55-59 24.232560468726525 28.494165957233715 27.086984826481046 20.186288747558716 60-64 24.110988680757288 28.202945006511072 27.421616748472406 20.26444956425924 65-69 24.033259867761974 27.67982368262873 27.249048286916448 21.037868162692845 70-74 24.3061817453161 27.697625488428013 27.09648331830478 20.899709447951107 75-79 24.154686169413413 27.751339978961077 28.117016480488903 19.976957371136603 80-84 24.073331997595673 28.075535964736524 27.35924664395913 20.491885393708674 85-89 24.71820049095737 28.10480436851861 27.188016632433243 19.988978508090778 90-94 24.184741772278713 27.92165506186445 27.18028352452036 20.713319641336472 95-99 24.273838141025642 27.709334935897434 27.604166666666668 20.412660256410255 100-104 24.47794080825279 27.998397516150032 27.242225449446643 20.281436226150536 105-109 23.740610916374564 28.72308462694041 27.165748622934398 20.370555833750625 110-114 24.194921620674112 27.640607001552564 27.535433465217608 20.629037912555717 115-119 23.97816068924063 27.654778601482672 27.399318773792825 20.967741935483872 120-124 24.465260732354857 27.916645794720235 27.51089515603867 20.10719831688624 125-129 24.869739478957918 28.196392785571145 26.988977955911825 19.94488977955912 130-134 25.145290581162328 27.53507014028056 27.104208416833668 20.215430861723448 135-139 24.66309303141125 27.613847001653223 27.769149842192277 19.95391012474325 140-144 25.11019835704268 27.51953516329393 27.19394910839511 20.176317371268283 145-149 25.20032051282051 27.669270833333332 27.564102564102566 19.56630608974359 150-151 26.732549412059043 27.358018513885412 26.332249186890166 19.577182887165375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 6.0 1 3.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 1.0 26 2.0 27 3.0 28 4.5 29 7.0 30 8.0 31 10.0 32 10.5 33 18.5 34 28.0 35 45.0 36 58.5 37 76.5 38 120.5 39 161.0 40 186.0 41 208.5 42 258.5 43 296.0 44 295.5 45 294.0 46 275.0 47 264.5 48 254.0 49 236.0 50 199.5 51 146.5 52 133.0 53 107.0 54 76.5 55 55.0 56 36.0 57 31.0 58 22.5 59 16.0 60 10.5 61 5.5 62 6.5 63 6.0 64 3.0 65 2.5 66 3.0 67 1.5 68 1.0 69 2.5 70 2.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.15 3 0.2 4 0.17500000000000002 5 0.15 6 0.2 7 0.2 8 0.2 9 0.17500000000000002 10-14 0.19 15-19 0.18 20-24 0.2 25-29 0.19499999999999998 30-34 0.16999999999999998 35-39 0.18 40-44 0.165 45-49 0.16 50-54 0.165 55-59 0.155 60-64 0.16999999999999998 65-69 0.18 70-74 0.19 75-79 0.185 80-84 0.18 85-89 0.19499999999999998 90-94 0.185 95-99 0.16 100-104 0.155 105-109 0.15 110-114 0.165 115-119 0.18 120-124 0.185 125-129 0.2 130-134 0.2 135-139 0.19499999999999998 140-144 0.18 145-149 0.16 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5475113122172 99.0 2 0.4273504273504274 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.025138260432378077 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.38749999999999996 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.7875 0.0 0.0 0.0 0.0 104-105 0.9625 0.0 0.0 0.0 0.0 106-107 1.15 0.0 0.0 0.0 0.0 108-109 1.2625 0.0 0.0 0.0 0.0 110-111 1.3625 0.0 0.0 0.0 0.0 112-113 1.5375 0.0 0.0 0.0 0.0 114-115 1.65 0.0 0.0 0.0 0.0 116-117 1.8625 0.0 0.0 0.0 0.0 118-119 2.0 0.0 0.0 0.0 0.0 120-121 2.175 0.0 0.0 0.0 0.0 122-123 2.4 0.0 0.0 0.0 0.0 124-125 2.675 0.0 0.0 0.0 0.0 126-127 3.0125 0.0 0.0 0.0 0.0 128-129 3.3625 0.0 0.0 0.0 0.0 130-131 3.7375 0.0 0.0 0.0 0.0 132-133 4.125 0.0 0.0 0.0 0.0 134-135 4.5625 0.0 0.0 0.0 0.0 136-137 4.9 0.0 0.0 0.0 0.0 138-139 5.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 761889 spots for SRR7169635.sra Written 761889 spots for SRR7169635.sra Read 761889 spots for SRR7169635.sra Written 761889 spots for SRR7169635.sra Read 761889 spots for SRR7169635.sra Written 761889 spots for SRR7169635.sra Read 761889 spots for SRR7169635.sra Written 761889 spots for SRR7169635.sra Read 761889 spots for SRR7169635.sra Written 761889 spots for SRR7169635.sra Read 761889 spots for SRR7169635.sra Written 761889 spots for SRR7169635.sra Read 761889 spots for SRR7169635.sra Written 761889 spots for SRR7169635.sra Read 761889 spots for SRR7169635.sra Written 761889 spots for SRR7169635.sra Read 761889 spots for SRR7169635.sra Written 761889 spots for SRR7169635.sra Read 761889 spots for SRR7169635.sra Written 761889 spots for SRR7169635.sra Read 761889 spots for SRR7169635.sra Written 761889 spots for SRR7169635.sra Read 761907 spots for SRR7169635.sra Written 761907 spots for SRR7169635.sra Read 761889 spots for SRR7169635.sra Written 761889 spots for SRR7169635.sra Read 761889 spots for SRR7169635.sra Written 761889 spots for SRR7169635.sra Read 761889 spots for SRR7169635.sra Written 761889 spots for SRR7169635.sra Read 761889 spots for SRR7169635.sra Written 761889 spots for SRR7169635.sra Read 761889 spots for SRR7169635.sra Written 761889 spots for SRR7169635.sra Read 761889 spots for SRR7169635.sra Written 761889 spots for SRR7169635.sra Read 761889 spots for SRR7169635.sra Written 761889 spots for SRR7169635.sra Read 761889 spots for SRR7169635.sra Written 761889 spots for SRR7169635.sra SRR ids: ['SRR7169635.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nsfi_nvj SRR7169635.sra spots: 15237798 blocks: [[1, 761889], [761890, 1523778], [1523779, 2285667], [2285668, 3047556], [3047557, 3809445], [3809446, 4571334], [4571335, 5333223], [5333224, 6095112], [6095113, 6857001], [6857002, 7618890], [7618891, 8380779], [8380780, 9142668], [9142669, 9904557], [9904558, 10666446], [10666447, 11428335], [11428336, 12190224], [12190225, 12952113], [12952114, 13714002], [13714003, 14475891], [14475892, 15237798]] SRR7169635 file size 5141889 SRR7169635 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169635 SRR7169635_1.fastq SRR7169635_2.fastq Input file: SRR7169635_1.fastq Paired file: SRR7169635_2.fastq trimmed: SRR7169635-trimmed-pair1.fastq, SRR7169635-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 12:25:47 2025 >> started Tue Feb 11 12:26:04 2025 >> done (16.917s) 15237798 read pairs processed; of these: 20736 ( 0.14%) short read pairs filtered out after trimming by size control 60876 ( 0.40%) empty read pairs filtered out after trimming by size control 15156186 (99.46%) read pairs available; of these: 6451424 (42.57%) trimmed read pairs available after processing 8704762 (57.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 5 0.00% 21 4 0.00% 22 4 0.00% 23 2 0.00% 24 7 0.00% 25 5 0.00% 26 8 0.00% 27 5 0.00% 28 7 0.00% 29 3 0.00% 30 15 0.00% 31 14 0.00% 32 9 0.00% 33 6 0.00% 34 9 0.00% 35 9 0.00% 36 18 0.00% 37 16 0.00% 38 9 0.00% 39 13 0.00% 40 18 0.00% 41 18 0.00% 42 15 0.00% 43 28 0.00% 44 25 0.00% 45 31 0.00% 46 41 0.00% 47 33 0.00% 48 54 0.00% 49 42 0.00% 50 59 0.00% 51 76 0.00% 52 63 0.00% 53 74 0.00% 54 67 0.00% 55 101 0.00% 56 107 0.00% 57 122 0.00% 58 133 0.00% 59 153 0.00% 60 175 0.00% 61 221 0.00% 62 221 0.00% 63 199 0.00% 64 295 0.00% 65 354 0.00% 66 388 0.00% 67 485 0.00% 68 877 0.01% 69 1837 0.01% 70 1619 0.01% 71 824 0.01% 72 811 0.01% 73 910 0.01% 74 926 0.01% 75 1088 0.01% 76 1271 0.01% 77 1280 0.01% 78 1384 0.01% 79 1631 0.01% 80 1857 0.01% 81 2135 0.01% 82 2451 0.02% 83 2669 0.02% 84 3831 0.03% 85 4611 0.03% 86 4963 0.03% 87 5114 0.03% 88 5551 0.04% 89 5877 0.04% 90 5986 0.04% 91 6636 0.04% 92 6970 0.05% 93 7663 0.05% 94 8185 0.05% 95 8614 0.06% 96 9069 0.06% 97 9629 0.06% 98 9949 0.07% 99 10500 0.07% 100 11164 0.07% 101 11670 0.08% 102 12773 0.08% 103 13589 0.09% 104 14195 0.09% 105 15283 0.10% 106 15793 0.10% 107 16433 0.11% 108 16751 0.11% 109 17574 0.12% 110 18295 0.12% 111 19058 0.13% 112 20046 0.13% 113 21410 0.14% 114 22579 0.15% 115 23962 0.16% 116 24374 0.16% 117 25659 0.17% 118 26373 0.17% 119 26717 0.18% 120 28133 0.19% 121 28698 0.19% 122 30022 0.20% 123 31461 0.21% 124 33279 0.22% 125 34924 0.23% 126 36556 0.24% 127 38060 0.25% 128 39111 0.26% 129 40637 0.27% 130 42257 0.28% 131 44117 0.29% 132 46126 0.30% 133 48785 0.32% 134 51353 0.34% 135 54734 0.36% 136 57902 0.38% 137 61423 0.41% 138 64791 0.43% 139 68796 0.45% 140 73157 0.48% 141 77944 0.51% 142 85650 0.57% 143 95996 0.63% 144 109152 0.72% 145 128084 0.85% 146 155241 1.02% 147 205138 1.35% 148 306490 2.02% 149 608740 4.02% 150 3210480 21.18% 151 8704762 57.43% 15156186 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=11.87 fanout-score-rank=14 prefix-density=0.32 prefix-fanout=6.4 sequence=GGTGCTGGTGCTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=271.01 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=16.4 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACT criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=5.32 fanout-score-rank=25 prefix-density=0.36 prefix-fanout=3.7 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.11 sequence-density-rank=22 fanout-score=194.59 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=24.4 sequence=AGAAGAAGAAAT SRR7169635 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 12:26:48 Started mapping on | Feb 11 12:26:48 Finished on | Feb 11 12:28:19 Mapping speed, Million of reads per hour | 599.59 Number of input reads | 15156186 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 14297535 Uniquely mapped reads % | 94.33% Average mapped length | 294.56 Number of splices: Total | 14171926 Number of splices: Annotated (sjdb) | 13938887 Number of splices: GT/AG | 13962518 Number of splices: GC/AG | 169544 Number of splices: AT/AC | 10980 Number of splices: Non-canonical | 28884 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 276979 % of reads mapped to multiple loci | 1.83% Number of reads mapped to too many loci | 14125 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.72% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 598805 598805 598805 N_multimapping 276979 276979 276979 N_noFeature 281264 14146228 354124 N_ambiguous 135324 955 56228 UnstrandedReadsAssigned:13880947 PositiveStrandReadsAssigned:150352 NegativeStrandReadsAssigned:13887183 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169635 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169635-trimmed-pair1.fastq SRR7169635-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,156,186 reads, 13,803,801 reads pseudoaligned [quant] estimated average fragment length: 242.517 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,218 rounds 52401 SRR7169635.ke.tsv 34699 SRR7169635.se.tsv 87100 total ==> SRR7169635.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.48 256 9.58991 Potri.005G024800.1.v4.1 1035 793.483 43 3.60634 Potri.004G059700.1.v4.1 961 719.489 1 0.0924935 Potri.007G009000.2.v4.1 1416 1174.48 0 0 Potri.003G141000.2.v4.1 2943 2701.48 288 7.09456 Potri.016G087400.1.v4.1 270 78.8465 1468 1239.02 Potri.015G069301.1.v4.1 564 326.695 0 0 Potri.010G195200.1.v4.1 1773 1531.48 43 1.86849 Potri.012G127500.1.v4.1 977 735.489 6818 616.902 ==> SRR7169635.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1092 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 225 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169635 completed mapping pipeline successfully