Starting /dee2/code/volunteer_pipeline.sh SRR7169636 current disk space = 3051669495808 free memory = 1152446376 SRR7169636 SRAfilesize cf8e3baadcce67d53249bfe2b1b5efb1 SRR7169636.sra SRR7169636.sra file validated SRR7169636 is paired end SRR7169636 is conventional basespace SRR7169636 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169636_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.83875 34.0 33.0 34.0 28.0 34.0 2 32.926 34.0 33.0 34.0 28.0 34.0 3 33.08425 34.0 33.0 34.0 30.0 34.0 4 33.32925 34.0 33.0 34.0 33.0 34.0 5 33.37075 34.0 33.0 34.0 33.0 34.0 6 36.93325 38.0 37.0 38.0 36.0 38.0 7 37.28 38.0 38.0 38.0 37.0 38.0 8 37.36425 38.0 38.0 38.0 37.0 38.0 9 37.49025 38.0 38.0 38.0 38.0 38.0 10-14 37.5282 38.0 38.0 38.0 38.0 38.0 15-19 37.5301 38.0 38.0 38.0 38.0 38.0 20-24 37.48695 38.0 38.0 38.0 37.8 38.0 25-29 37.4006 38.0 38.0 38.0 37.4 38.0 30-34 37.3346 38.0 38.0 38.0 37.0 38.0 35-39 37.229699999999994 38.0 38.0 38.0 36.6 38.0 40-44 36.89875 38.0 38.0 38.0 35.6 38.0 45-49 36.84705 38.0 38.0 38.0 35.4 38.0 50-54 36.5985 38.0 38.0 38.0 34.4 38.0 55-59 36.528000000000006 38.0 38.0 38.0 34.0 38.0 60-64 36.4136 38.0 38.0 38.0 34.0 38.0 65-69 36.2996 38.0 38.0 38.0 33.8 38.0 70-74 36.1731 38.0 37.2 38.0 33.4 38.0 75-79 35.927499999999995 38.0 37.0 38.0 33.0 38.0 80-84 35.7724 38.0 37.0 38.0 31.8 38.0 85-89 35.611399999999996 38.0 37.0 38.0 30.8 38.0 90-94 35.32055 38.0 36.6 38.0 29.4 38.0 95-99 35.08475 38.0 36.2 38.0 29.0 38.0 100-104 34.77675 38.0 36.0 38.0 27.6 38.0 105-109 34.53785 38.0 35.2 38.0 25.8 38.0 110-114 34.236000000000004 38.0 35.0 38.0 23.8 38.0 115-119 33.92465 38.0 34.6 38.0 21.4 38.0 120-124 33.271249999999995 38.0 33.8 38.0 16.6 38.0 125-129 33.1052 38.0 34.0 38.0 15.0 38.0 130-134 32.84395000000001 38.0 33.8 38.0 15.0 38.0 135-139 32.5253 37.6 33.4 38.0 14.4 38.0 140-144 31.814749999999997 36.6 32.0 38.0 13.8 38.0 145-149 30.3745 36.0 29.4 38.0 6.4 38.0 150-151 26.33 33.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 2.0 9 1.0 10 0.0 11 1.0 12 4.0 13 5.0 14 1.0 15 7.0 16 10.0 17 14.0 18 20.0 19 21.0 20 12.0 21 13.0 22 19.0 23 13.0 24 22.0 25 20.0 26 27.0 27 36.0 28 43.0 29 39.0 30 62.0 31 70.0 32 106.0 33 139.0 34 253.0 35 479.0 36 1043.0 37 1517.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.53911147451622 14.799672935404743 11.011174707004635 35.65004088307441 2 22.975 15.299999999999999 29.25 32.475 3 20.025000000000002 18.05 25.45 36.475 4 22.900000000000002 24.5 22.75 29.849999999999998 5 23.375 28.775000000000002 24.099999999999998 23.75 6 20.674999999999997 31.974999999999998 25.900000000000002 21.45 7 15.15 29.799999999999997 38.675 16.375 8 17.349999999999998 29.575000000000003 30.049999999999997 23.025000000000002 9 17.5 27.450000000000003 32.525 22.525000000000002 10-14 18.740000000000002 32.019999999999996 27.255000000000003 21.985 15-19 19.28 29.585 28.03 23.105 20-24 18.759999999999998 30.795 27.310000000000002 23.135 25-29 18.915000000000003 30.514999999999997 27.22 23.35 30-34 19.015 30.09 27.505000000000003 23.39 35-39 19.06 30.020000000000003 27.54 23.380000000000003 40-44 19.205 29.455 27.700000000000003 23.64 45-49 19.925 29.770000000000003 27.195000000000004 23.11 50-54 19.525000000000002 29.86 27.47 23.145 55-59 19.259999999999998 29.445 27.325 23.97 60-64 19.675 29.220000000000002 27.584999999999997 23.52 65-69 19.485 29.830000000000002 27.245 23.44 70-74 19.575 29.955 26.615 23.855 75-79 19.395 29.375 27.384999999999998 23.845 80-84 20.185 29.435 27.18 23.200000000000003 85-89 19.73 29.53 27.46 23.28 90-94 20.165 29.154999999999998 27.060000000000002 23.62 95-99 19.415 28.845 27.525 24.215 100-104 20.075000000000003 29.110000000000003 26.685 24.13 105-109 19.865 28.34 27.76 24.035 110-114 20.415 29.304999999999996 26.775 23.505000000000003 115-119 19.775000000000002 29.595 26.634999999999998 23.995 120-124 20.27 28.365000000000002 26.974999999999998 24.39 125-129 20.1 28.275 27.1 24.525 130-134 20.615 28.754999999999995 26.625 24.005000000000003 135-139 20.345 29.020000000000003 26.19 24.445 140-144 20.595 28.71 26.619999999999997 24.075 145-149 21.425 28.515 26.27 23.79 150-151 20.25 28.3375 25.75 25.662499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.5 4 1.0 5 0.5 6 1.0 7 1.0 8 0.5 9 0.5 10 0.5 11 0.5 12 1.5 13 1.5 14 1.0 15 1.0 16 1.5 17 1.5 18 1.0 19 1.5 20 3.0 21 3.5 22 5.0 23 4.5 24 4.0 25 4.0 26 7.0 27 9.5 28 13.0 29 26.5 30 35.5 31 46.0 32 62.5 33 75.5 34 85.0 35 98.5 36 115.5 37 133.5 38 159.5 39 169.0 40 176.0 41 205.0 42 217.0 43 225.5 44 245.5 45 229.0 46 210.0 47 215.5 48 195.5 49 163.0 50 138.5 51 119.0 52 103.0 53 99.5 54 92.5 55 66.0 56 49.5 57 44.5 58 34.5 59 25.0 60 19.5 61 12.0 62 10.5 63 8.5 64 3.5 65 3.5 66 3.0 67 1.5 68 1.5 69 1.5 70 1.0 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.275 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.975 #Duplication Level Percentage of deduplicated Percentage of total 1 98.80071446797652 96.8 2 0.9696351109977035 1.9 3 0.07655014034192395 0.22499999999999998 4 0.07655014034192395 0.3 5 0.05103342689461597 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025516713447307986 0.525 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGAATATCTCGTATGC 21 0.525 TruSeq Adapter, Index 7 (97% over 37bp) CCCCCTTCGCAGTAACACCAAGTACAGGAATATTAACCTGTTTCCCATCG 5 0.125 No Hit CCCCACTGCTGCCTCCCGTAGGAGTCTGGACCGTGTCTCAGTTCCAGTGT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.45 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.6499999999999999 0.0 0.0 0.0 0.0 98-99 0.775 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 1.075 0.0 0.0 0.0 0.0 104-105 1.2625000000000002 0.0 0.0 0.0 0.0 106-107 1.5375 0.0 0.0 0.0 0.0 108-109 1.7875 0.0 0.0 0.0 0.0 110-111 1.9874999999999998 0.0 0.0 0.0 0.0 112-113 2.1875 0.0 0.0 0.0 0.0 114-115 2.4124999999999996 0.0 0.0 0.0 0.0 116-117 2.7375 0.0 0.0 0.0 0.0 118-119 3.0625 0.0 0.0 0.0 0.0 120-121 3.4625 0.0 0.0 0.0 0.0 122-123 3.825 0.0 0.0 0.0 0.0 124-125 4.2875 0.0 0.0 0.0 0.0 126-127 4.7125 0.0 0.0 0.0 0.0 128-129 5.175 0.0 0.0 0.0 0.0 130-131 5.6625 0.0 0.0 0.0 0.0 132-133 6.1875 0.0 0.0 0.0 0.0 134-135 6.575 0.0 0.0 0.0 0.0 136-137 7.225 0.0 0.0 0.0 0.0 138-139 7.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 140 1.03421255E-4 10.351786 140-144 >>END_MODULE SRR7169636 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169636_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.559 33.0 33.0 34.0 32.0 34.0 2 32.5565 34.0 33.0 34.0 32.0 34.0 3 32.7055 34.0 33.0 34.0 32.0 34.0 4 32.67775 34.0 33.0 34.0 32.0 34.0 5 32.6875 34.0 33.0 34.0 32.0 34.0 6 36.85125 38.0 38.0 38.0 37.0 38.0 7 36.7505 38.0 38.0 38.0 36.0 38.0 8 36.77325 38.0 38.0 38.0 37.0 38.0 9 36.7555 38.0 38.0 38.0 37.0 38.0 10-14 36.78915 38.0 38.0 38.0 37.0 38.0 15-19 36.7016 38.0 38.0 38.0 36.6 38.0 20-24 36.66414999999999 38.0 38.0 38.0 36.6 38.0 25-29 36.597950000000004 38.0 38.0 38.0 36.2 38.0 30-34 36.575300000000006 38.0 38.0 38.0 36.0 38.0 35-39 36.57195 38.0 38.0 38.0 36.0 38.0 40-44 36.5698 38.0 38.0 38.0 36.0 38.0 45-49 36.372699999999995 38.0 38.0 38.0 35.4 38.0 50-54 36.46625 38.0 38.0 38.0 36.0 38.0 55-59 36.448699999999995 38.0 38.0 38.0 35.8 38.0 60-64 36.2778 38.0 38.0 38.0 35.2 38.0 65-69 36.093050000000005 38.0 38.0 38.0 34.4 38.0 70-74 36.00595 38.0 38.0 38.0 34.2 38.0 75-79 35.94304999999999 38.0 38.0 38.0 34.2 38.0 80-84 35.851150000000004 38.0 38.0 38.0 34.0 38.0 85-89 35.863749999999996 38.0 38.0 38.0 34.0 38.0 90-94 35.58385 38.0 38.0 38.0 32.6 38.0 95-99 35.53535 38.0 38.0 38.0 31.8 38.0 100-104 35.46835 38.0 38.0 38.0 32.4 38.0 105-109 35.2815 38.0 37.8 38.0 31.0 38.0 110-114 35.061400000000006 38.0 37.2 38.0 29.8 38.0 115-119 34.8483 38.0 37.0 38.0 28.0 38.0 120-124 34.624649999999995 38.0 36.6 38.0 27.0 38.0 125-129 34.2025 38.0 36.0 38.0 23.2 38.0 130-134 33.884350000000005 38.0 35.4 38.0 19.4 38.0 135-139 33.52515 38.0 35.0 38.0 16.2 38.0 140-144 33.226 38.0 34.0 38.0 13.8 38.0 145-149 32.420300000000005 38.0 33.0 38.0 10.8 38.0 150-151 28.082875 35.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 36.0 3 9.0 4 10.0 5 2.0 6 2.0 7 2.0 8 6.0 9 4.0 10 5.0 11 2.0 12 4.0 13 2.0 14 5.0 15 10.0 16 9.0 17 20.0 18 6.0 19 6.0 20 14.0 21 16.0 22 19.0 23 18.0 24 15.0 25 15.0 26 27.0 27 27.0 28 23.0 29 33.0 30 34.0 31 47.0 32 56.0 33 81.0 34 126.0 35 203.0 36 487.0 37 2619.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.814070351758794 21.35678391959799 15.753768844221106 25.075376884422113 2 28.173607626693425 28.273958855995986 25.865529352734573 17.686904164576017 3 22.829904666332162 29.377822378324137 28.349222277972906 19.4430506773708 4 24.03411941796287 32.739588559959856 23.733065730055195 19.49322629202208 5 25.439036628198696 34.62117410938284 22.77972905168088 17.160060210737583 6 22.662321383805466 36.07420406116822 22.78766608172474 18.47580847330158 7 21.910253196289798 22.612183504637752 35.648032088242665 19.82953121082978 8 23.163700175482578 27.174730508899476 26.472800200551518 23.18876911506643 9 22.78766608172474 26.97417899222863 28.202557031837554 22.035597894209076 10-14 24.51240912509401 28.60867385309601 25.480070193030834 21.398846828779142 15-19 24.963642746100998 28.138007121006968 26.67870217140565 20.219647961486384 20-24 24.230267776552 27.92598535753686 27.098585899107412 20.74516096680373 25-29 24.917226848600382 28.12782181197953 26.382060800642122 20.572890538777965 30-34 24.745524745524747 27.82429925287068 27.182470039612898 20.247705961991677 35-39 24.69160565640357 27.294153043827095 27.023367766522917 20.990873533246415 40-44 25.055176565008026 27.86416532905297 26.971308186195824 20.109349919743178 45-49 24.39917716120616 27.404545682604986 27.02824745371532 21.168029702473532 50-54 24.77432296890672 27.657973921765294 27.36208625877633 20.205616850551657 55-59 24.390488612420988 27.586033911909304 27.801745761011336 20.22173171465837 60-64 23.29653788258906 28.19367787255394 27.651781234320122 20.85800301053688 65-69 24.33517310587055 28.063221274460616 26.92423482187657 20.67737079779227 70-74 24.629899131831184 28.117629347116978 27.334771917498873 19.91769960355297 75-79 23.737829970892303 28.07889190003011 27.551942186088528 20.63133594298906 80-84 24.43295865114412 27.604375752709753 27.749899638699315 20.212765957446805 85-89 24.371392722710166 27.457967377666247 27.904642409033876 20.26599749058971 90-94 23.697419937757253 27.77331593213533 28.164842887260317 20.364421242847104 95-99 24.2231035694563 27.802600532155232 27.993373161303282 19.980922737085194 100-104 24.695076042764644 27.756863926115543 27.561110274557045 19.986949756562765 105-109 23.89580405541056 27.880947600883353 28.402931138325638 19.820317205380444 110-114 23.912061436530642 27.746825277317672 27.902424333684685 20.438688952467 115-119 24.688755020080322 28.072289156626507 27.489959839357432 19.748995983935743 120-124 24.864430608555935 27.430206868849165 28.067885117493475 19.637477405101425 125-129 25.077819058138367 27.69856411286274 27.819058138367307 19.40455869063159 130-134 25.234865611655362 27.510675709620696 27.786988193921125 19.467470484802814 135-139 25.0 28.20474181233675 27.612015270243116 19.18324291742013 140-144 25.66705190693935 28.31013516908698 27.551379327671977 18.471433596301694 145-149 25.940812942772446 27.769682962367483 27.58880570768226 18.700698387177813 150-151 26.180633846924717 27.809094325441563 27.195289991231363 18.814981836402357 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 11.0 1 5.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 1.0 15 2.0 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.5 26 2.5 27 4.5 28 7.0 29 9.5 30 11.5 31 19.0 32 28.0 33 34.0 34 43.5 35 48.0 36 69.0 37 98.0 38 117.0 39 137.5 40 173.0 41 203.5 42 225.0 43 243.0 44 244.0 45 268.0 46 282.5 47 275.5 48 255.5 49 220.0 50 194.0 51 152.0 52 119.5 53 109.5 54 96.0 55 75.5 56 53.5 57 39.0 58 30.5 59 24.5 60 16.5 61 15.5 62 10.5 63 4.5 64 7.0 65 6.0 66 2.5 67 1.0 68 1.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5 2 0.35000000000000003 3 0.35000000000000003 4 0.35000000000000003 5 0.35000000000000003 6 0.27499999999999997 7 0.27499999999999997 8 0.27499999999999997 9 0.27499999999999997 10-14 0.27499999999999997 15-19 0.295 20-24 0.29 25-29 0.33 30-34 0.28500000000000003 35-39 0.29 40-44 0.32 45-49 0.345 50-54 0.3 55-59 0.33 60-64 0.35000000000000003 65-69 0.35000000000000003 70-74 0.365 75-79 0.37 80-84 0.36 85-89 0.375 90-94 0.38999999999999996 95-99 0.40499999999999997 100-104 0.385 105-109 0.38 110-114 0.385 115-119 0.4 120-124 0.42 125-129 0.41000000000000003 130-134 0.475 135-139 0.45999999999999996 140-144 0.49500000000000005 145-149 0.485 150-151 0.21250000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.82499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.7988755430616 96.65 2 0.8944543828264758 1.7500000000000002 3 0.17889087656529518 0.525 4 0.07666751852798365 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.051111679018655765 0.775 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 20 0.5 Illumina Single End PCR Primer 1 (100% over 50bp) NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 11 0.27499999999999997 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.425 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.6625 0.0 0.0 0.0 0.0 98-99 0.8125 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.15 0.0 0.0 0.0 0.0 104-105 1.35 0.0 0.0 0.0 0.0 106-107 1.6375 0.0 0.0 0.0 0.0 108-109 1.9125 0.0 0.0 0.0 0.0 110-111 2.1125 0.0 0.0 0.0 0.0 112-113 2.3125 0.0 0.0 0.0 0.0 114-115 2.55 0.0 0.0 0.0 0.0 116-117 2.875 0.0 0.0 0.0 0.0 118-119 3.2375 0.0 0.0 0.0 0.0 120-121 3.575 0.0 0.0 0.0 0.0 122-123 3.9 0.0 0.0 0.0 0.0 124-125 4.35 0.0 0.0 0.0 0.0 126-127 4.775 0.0 0.0 0.0 0.0 128-129 5.25 0.0 0.0 0.0 0.0 130-131 5.762499999999999 0.0 0.0 0.0 0.0 132-133 6.300000000000001 0.0 0.0 0.0 0.0 134-135 6.737500000000001 0.0 0.0 0.0 0.0 136-137 7.4125 0.0 0.0 0.0 0.0 138-139 8.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCTGTT 10 0.00682755 145.0 7 TTTTTTT 30 0.0014431519 24.166666 120-124 >>END_MODULE Read 838757 spots for SRR7169636.sra Written 838757 spots for SRR7169636.sra Read 838757 spots for SRR7169636.sra Written 838757 spots for SRR7169636.sra Read 838757 spots for SRR7169636.sra Written 838757 spots for SRR7169636.sra Read 838757 spots for SRR7169636.sra Written 838757 spots for SRR7169636.sra Read 838757 spots for SRR7169636.sra Written 838757 spots for SRR7169636.sra Read 838757 spots for SRR7169636.sra Written 838757 spots for SRR7169636.sra Read 838757 spots for SRR7169636.sra Written 838757 spots for SRR7169636.sra Read 838757 spots for SRR7169636.sra Written 838757 spots for SRR7169636.sra Read 838757 spots for SRR7169636.sra Written 838757 spots for SRR7169636.sra Read 838757 spots for SRR7169636.sra Written 838757 spots for SRR7169636.sra Read 838757 spots for SRR7169636.sra Written 838757 spots for SRR7169636.sra Read 838760 spots for SRR7169636.sra Written 838760 spots for SRR7169636.sra Read 838757 spots for SRR7169636.sra Written 838757 spots for SRR7169636.sra Read 838757 spots for SRR7169636.sra Written 838757 spots for SRR7169636.sra Read 838757 spots for SRR7169636.sra Written 838757 spots for SRR7169636.sra Read 838757 spots for SRR7169636.sra Written 838757 spots for SRR7169636.sra Read 838757 spots for SRR7169636.sra Written 838757 spots for SRR7169636.sra Read 838757 spots for SRR7169636.sra Written 838757 spots for SRR7169636.sra Read 838757 spots for SRR7169636.sra Written 838757 spots for SRR7169636.sra Read 838757 spots for SRR7169636.sra Written 838757 spots for SRR7169636.sra SRR ids: ['SRR7169636.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1f0kk101 SRR7169636.sra spots: 16775143 blocks: [[1, 838757], [838758, 1677514], [1677515, 2516271], [2516272, 3355028], [3355029, 4193785], [4193786, 5032542], [5032543, 5871299], [5871300, 6710056], [6710057, 7548813], [7548814, 8387570], [8387571, 9226327], [9226328, 10065084], [10065085, 10903841], [10903842, 11742598], [11742599, 12581355], [12581356, 13420112], [13420113, 14258869], [14258870, 15097626], [15097627, 15936383], [15936384, 16775143]] SRR7169636 file size 5662845 SRR7169636 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169636 SRR7169636_1.fastq SRR7169636_2.fastq Input file: SRR7169636_1.fastq Paired file: SRR7169636_2.fastq trimmed: SRR7169636-trimmed-pair1.fastq, SRR7169636-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 11:36:01 2025 >> started Tue Feb 11 11:36:21 2025 >> done (20.003s) 16775143 read pairs processed; of these: 57000 ( 0.34%) short read pairs filtered out after trimming by size control 210341 ( 1.25%) empty read pairs filtered out after trimming by size control 16507802 (98.41%) read pairs available; of these: 9018555 (54.63%) trimmed read pairs available after processing 7489247 (45.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 6 0.00% 20 7 0.00% 21 10 0.00% 22 27 0.00% 23 18 0.00% 24 26 0.00% 25 17 0.00% 26 18 0.00% 27 25 0.00% 28 21 0.00% 29 16 0.00% 30 25 0.00% 31 35 0.00% 32 29 0.00% 33 37 0.00% 34 38 0.00% 35 46 0.00% 36 29 0.00% 37 47 0.00% 38 55 0.00% 39 68 0.00% 40 63 0.00% 41 61 0.00% 42 77 0.00% 43 92 0.00% 44 142 0.00% 45 195 0.00% 46 215 0.00% 47 218 0.00% 48 249 0.00% 49 331 0.00% 50 379 0.00% 51 328 0.00% 52 447 0.00% 53 435 0.00% 54 393 0.00% 55 370 0.00% 56 396 0.00% 57 406 0.00% 58 503 0.00% 59 499 0.00% 60 516 0.00% 61 599 0.00% 62 807 0.00% 63 1020 0.01% 64 1100 0.01% 65 1517 0.01% 66 2713 0.02% 67 3947 0.02% 68 4282 0.03% 69 4800 0.03% 70 8589 0.05% 71 6946 0.04% 72 4583 0.03% 73 3397 0.02% 74 2928 0.02% 75 2924 0.02% 76 3095 0.02% 77 3038 0.02% 78 3301 0.02% 79 3638 0.02% 80 4057 0.02% 81 4520 0.03% 82 5181 0.03% 83 5809 0.04% 84 8497 0.05% 85 9892 0.06% 86 10556 0.06% 87 11691 0.07% 88 12695 0.08% 89 13559 0.08% 90 13714 0.08% 91 13398 0.08% 92 14256 0.09% 93 15189 0.09% 94 16044 0.10% 95 17346 0.11% 96 18025 0.11% 97 18858 0.11% 98 19463 0.12% 99 19849 0.12% 100 21219 0.13% 101 21919 0.13% 102 23726 0.14% 103 24801 0.15% 104 25959 0.16% 105 27919 0.17% 106 29743 0.18% 107 30072 0.18% 108 30996 0.19% 109 32230 0.20% 110 33125 0.20% 111 34211 0.21% 112 35554 0.22% 113 38330 0.23% 114 39896 0.24% 115 41873 0.25% 116 43677 0.26% 117 44951 0.27% 118 45080 0.27% 119 45832 0.28% 120 46890 0.28% 121 48439 0.29% 122 48920 0.30% 123 52370 0.32% 124 54812 0.33% 125 56473 0.34% 126 59238 0.36% 127 61491 0.37% 128 62970 0.38% 129 65069 0.39% 130 67412 0.41% 131 69584 0.42% 132 72337 0.44% 133 75727 0.46% 134 79906 0.48% 135 84582 0.51% 136 88445 0.54% 137 92899 0.56% 138 97893 0.59% 139 103987 0.63% 140 110023 0.67% 141 117675 0.71% 142 130470 0.79% 143 145122 0.88% 144 163430 0.99% 145 190881 1.16% 146 233794 1.42% 147 314038 1.90% 148 469819 2.85% 149 925051 5.60% 150 3834950 23.23% 151 7489247 45.37% 16507802 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=4.43 fanout-score-rank=34 prefix-density=0.58 prefix-fanout=1.0 sequence=GATCGTCGCCTTGGTGAGCCGTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=34 fanout-score=275.54 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=21.5 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=3.73 fanout-score-rank=37 prefix-density=0.73 prefix-fanout=2.9 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.09 sequence-density-rank=15 fanout-score=262.55 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=26.1 sequence=AAGAAGAAGAAG SRR7169636 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 11:37:17 Started mapping on | Feb 11 11:37:17 Finished on | Feb 11 11:42:01 Mapping speed, Million of reads per hour | 209.25 Number of input reads | 16507802 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 13907437 Uniquely mapped reads % | 84.25% Average mapped length | 291.23 Number of splices: Total | 10824839 Number of splices: Annotated (sjdb) | 10603031 Number of splices: GT/AG | 10648344 Number of splices: GC/AG | 134200 Number of splices: AT/AC | 9749 Number of splices: Non-canonical | 32546 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.03% Insertion average length | 2.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 311377 % of reads mapped to multiple loci | 1.89% Number of reads mapped to too many loci | 43626 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 13.50% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2323047 2323047 2323047 N_multimapping 311377 311377 311377 N_noFeature 382598 13706578 478007 N_ambiguous 165660 1277 59420 UnstrandedReadsAssigned:13359179 PositiveStrandReadsAssigned:199582 NegativeStrandReadsAssigned:13370010 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7169636 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169636-trimmed-pair1.fastq SRR7169636-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,507,802 reads, 13,417,361 reads pseudoaligned [quant] estimated average fragment length: 223.38 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,254 rounds 52401 SRR7169636.ke.tsv 34699 SRR7169636.se.tsv 87100 total ==> SRR7169636.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1795.62 243 8.66366 Potri.005G024800.1.v4.1 1035 812.62 45 3.54515 Potri.004G059700.1.v4.1 961 738.63 2 0.173346 Potri.007G009000.2.v4.1 1416 1193.62 0 0 Potri.003G141000.2.v4.1 2943 2720.62 213 5.01212 Potri.016G087400.1.v4.1 270 83.2261 1535.01 1180.76 Potri.015G069301.1.v4.1 564 343.378 0 0 Potri.010G195200.1.v4.1 1773 1550.62 131 5.40848 Potri.012G127500.1.v4.1 977 754.625 8954 759.618 ==> SRR7169636.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 964 Potri.001G233950.v4.1 5 Potri.001G122700.v4.1 423 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 16 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169636 completed mapping pipeline successfully