Starting /dee2/code/volunteer_pipeline.sh SRR7169638 current disk space = 3051514990592 free memory = 1474555584 SRR7169638 SRAfilesize e79494ccb0a625a1c0ce5d27880b1c28 SRR7169638.sra SRR7169638.sra file validated SRR7169638 is paired end SRR7169638 is conventional basespace SRR7169638 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169638_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.34075 34.0 33.0 34.0 32.0 34.0 2 33.179 34.0 33.0 34.0 32.0 34.0 3 33.16 34.0 33.0 34.0 31.0 34.0 4 33.314 34.0 33.0 34.0 33.0 34.0 5 33.2695 34.0 33.0 34.0 33.0 34.0 6 36.792 38.0 37.0 38.0 35.0 38.0 7 37.12375 38.0 38.0 38.0 36.0 38.0 8 37.2715 38.0 38.0 38.0 37.0 38.0 9 37.289 38.0 38.0 38.0 37.0 38.0 10-14 37.4143 38.0 38.0 38.0 37.0 38.0 15-19 37.3917 38.0 38.0 38.0 37.0 38.0 20-24 37.3794 38.0 38.0 38.0 37.0 38.0 25-29 37.34905 38.0 38.0 38.0 37.0 38.0 30-34 37.25750000000001 38.0 38.0 38.0 37.0 38.0 35-39 37.2076 38.0 38.0 38.0 36.6 38.0 40-44 36.99640000000001 38.0 38.0 38.0 36.0 38.0 45-49 36.84225 38.0 38.0 38.0 35.2 38.0 50-54 36.7663 38.0 38.0 38.0 34.8 38.0 55-59 36.71805 38.0 38.0 38.0 34.6 38.0 60-64 36.57205 38.0 38.0 38.0 34.0 38.0 65-69 36.498000000000005 38.0 38.0 38.0 34.0 38.0 70-74 36.4448 38.0 38.0 38.0 34.0 38.0 75-79 36.24535 38.0 37.6 38.0 33.4 38.0 80-84 36.2859 38.0 37.8 38.0 33.4 38.0 85-89 36.02205 38.0 37.2 38.0 32.6 38.0 90-94 35.84985 38.0 37.0 38.0 31.6 38.0 95-99 35.69785 38.0 36.8 38.0 30.8 38.0 100-104 35.436299999999996 38.0 36.4 38.0 30.0 38.0 105-109 35.2622 38.0 36.2 38.0 29.4 38.0 110-114 34.919349999999994 38.0 36.0 38.0 27.8 38.0 115-119 34.7069 38.0 35.4 38.0 26.8 38.0 120-124 34.5139 38.0 35.0 38.0 25.8 38.0 125-129 33.99755 38.0 34.4 38.0 23.0 38.0 130-134 33.74285 38.0 34.6 38.0 20.2 38.0 135-139 33.3982 38.0 34.0 38.0 17.4 38.0 140-144 32.834649999999996 38.0 33.6 38.0 14.4 38.0 145-149 31.551499999999997 37.4 32.4 38.0 11.2 38.0 150-151 28.298375 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 2.0 14 2.0 15 3.0 16 6.0 17 11.0 18 9.0 19 11.0 20 17.0 21 9.0 22 15.0 23 14.0 24 12.0 25 18.0 26 30.0 27 28.0 28 43.0 29 55.0 30 63.0 31 69.0 32 112.0 33 136.0 34 205.0 35 310.0 36 801.0 37 2016.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.93808049535604 12.977296181630546 10.810113519091848 36.27450980392157 2 25.174999999999997 14.099999999999998 30.85 29.875 3 19.725 17.575 25.7 37.0 4 23.175 25.05 22.95 28.825 5 22.35 30.425 23.075000000000003 24.15 6 20.5 32.95 24.7 21.85 7 15.35 27.375 39.85 17.424999999999997 8 19.275000000000002 27.250000000000004 30.0 23.474999999999998 9 17.5 25.15 33.575 23.775 10-14 20.09 29.835 27.41 22.665 15-19 20.41 27.72 28.075 23.794999999999998 20-24 20.095 28.910000000000004 27.205000000000002 23.79 25-29 20.625 28.835 26.86 23.68 30-34 20.02 29.095 27.515 23.369999999999997 35-39 20.18 28.785 27.195000000000004 23.84 40-44 20.18 28.560000000000002 27.595 23.665 45-49 20.1 27.715 27.82 24.365000000000002 50-54 20.005 28.64 27.279999999999998 24.075 55-59 20.26 28.555000000000003 27.235 23.95 60-64 20.474999999999998 28.425 27.52 23.580000000000002 65-69 19.89 28.455000000000002 27.250000000000004 24.404999999999998 70-74 20.23 29.134999999999998 26.68 23.955000000000002 75-79 20.43 28.425 27.500000000000004 23.645 80-84 20.035 28.16 27.57 24.235 85-89 20.445 27.950000000000003 27.045 24.560000000000002 90-94 20.28 28.365000000000002 27.175 24.18 95-99 20.669999999999998 28.735 26.584999999999997 24.01 100-104 20.79371434290862 28.210389350415372 27.004303873486137 23.991592433189872 105-109 20.07 28.470000000000002 27.445000000000004 24.015 110-114 20.59516056309804 28.0496969089725 26.947547718050195 24.407594809879267 115-119 20.929301021430003 28.07430402563589 26.977768876427 24.01862607650711 120-124 21.034983234072367 28.03663480306291 26.545217957059208 24.383164005805515 125-129 20.86625987796339 27.98839651895569 27.463238971691506 23.682104631389418 130-134 21.135 28.08 27.79 22.994999999999997 135-139 20.515 27.939999999999998 27.22 24.325 140-144 20.915 28.23 26.834999999999997 24.02 145-149 21.17 28.43 26.229999999999997 24.169999999999998 150-151 20.9125 27.200000000000003 27.575 24.3125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.5 18 0.5 19 0.0 20 0.5 21 1.0 22 0.5 23 1.0 24 2.0 25 2.0 26 4.5 27 9.0 28 12.5 29 19.5 30 20.5 31 19.0 32 27.0 33 35.5 34 47.0 35 69.0 36 84.0 37 97.0 38 115.5 39 134.0 40 163.0 41 185.5 42 224.5 43 267.5 44 281.5 45 269.0 46 259.0 47 256.5 48 244.5 49 212.5 50 178.5 51 161.0 52 132.5 53 108.0 54 98.0 55 80.5 56 52.0 57 32.5 58 18.5 59 17.0 60 16.5 61 8.0 62 5.0 63 4.0 64 4.0 65 5.0 66 4.0 67 3.0 68 2.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.09 105-109 0.0 110-114 0.19499999999999998 115-119 0.13999999999999999 120-124 0.095 125-129 0.03 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34541792547836 98.65 2 0.6042296072507553 1.2 3 0.050352467270896276 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1625 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.625 0.0 0.0 0.0 0.0 104-105 0.6875 0.0 0.0 0.0 0.0 106-107 0.875 0.0 0.0 0.0 0.0 108-109 1.0375 0.0 0.0 0.0 0.0 110-111 1.1625 0.0 0.0 0.0 0.0 112-113 1.375 0.0 0.0 0.0 0.0 114-115 1.525 0.0 0.0 0.0 0.0 116-117 1.8125 0.0 0.0 0.0 0.0 118-119 2.0875 0.0 0.0 0.0 0.0 120-121 2.425 0.0 0.0 0.0 0.0 122-123 2.625 0.0 0.0 0.0 0.0 124-125 2.7875 0.0 0.0 0.0 0.0 126-127 3.1 0.0 0.0 0.0 0.0 128-129 3.4125 0.0 0.0 0.0 0.0 130-131 3.625 0.0 0.0 0.0 0.0 132-133 3.9000000000000004 0.0 0.0 0.0 0.0 134-135 4.2 0.0 0.0 0.0 0.0 136-137 4.487500000000001 0.0 0.0 0.0 0.0 138-139 4.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCCTCT 10 0.006619789 146.50632 1 >>END_MODULE SRR7169638 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169638_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4125 33.0 33.0 34.0 32.0 34.0 2 32.71025 33.0 33.0 34.0 32.0 34.0 3 32.6975 33.0 33.0 34.0 32.0 34.0 4 32.64275 34.0 33.0 34.0 32.0 34.0 5 32.686 34.0 33.0 34.0 32.0 34.0 6 36.86775 38.0 38.0 38.0 36.0 38.0 7 36.793 38.0 38.0 38.0 36.0 38.0 8 36.80275 38.0 38.0 38.0 36.0 38.0 9 36.88025 38.0 38.0 38.0 36.0 38.0 10-14 36.765100000000004 38.0 38.0 38.0 35.4 38.0 15-19 36.711400000000005 38.0 38.0 38.0 35.4 38.0 20-24 36.7398 38.0 38.0 38.0 36.0 38.0 25-29 36.791399999999996 38.0 38.0 38.0 35.8 38.0 30-34 36.6682 38.0 38.0 38.0 35.6 38.0 35-39 36.6391 38.0 38.0 38.0 35.2 38.0 40-44 36.5505 38.0 38.0 38.0 34.8 38.0 45-49 36.637800000000006 38.0 38.0 38.0 35.0 38.0 50-54 36.353300000000004 38.0 38.0 38.0 34.6 38.0 55-59 35.93365 38.0 38.0 38.0 33.6 38.0 60-64 35.61415 38.0 38.0 38.0 32.2 38.0 65-69 35.50064999999999 38.0 38.0 38.0 31.8 38.0 70-74 35.3253 38.0 38.0 38.0 30.6 38.0 75-79 35.202 38.0 38.0 38.0 29.0 38.0 80-84 35.26385 38.0 38.0 38.0 29.0 38.0 85-89 35.33415 38.0 38.0 38.0 29.0 38.0 90-94 35.29965 38.0 37.6 38.0 29.4 38.0 95-99 35.2151 38.0 37.4 38.0 29.6 38.0 100-104 34.967600000000004 38.0 37.0 38.0 28.2 38.0 105-109 34.7832 38.0 37.0 38.0 26.8 38.0 110-114 34.7364 38.0 37.0 38.0 27.0 38.0 115-119 34.5101 38.0 36.6 38.0 25.4 38.0 120-124 34.16765 38.0 36.0 38.0 22.8 38.0 125-129 33.95905 38.0 35.4 38.0 22.6 38.0 130-134 33.6048 38.0 35.0 38.0 17.4 38.0 135-139 32.998850000000004 38.0 34.8 38.0 14.2 38.0 140-144 32.55645 38.0 34.6 38.0 13.6 38.0 145-149 31.41735 38.0 33.0 38.0 2.0 38.0 150-151 27.576124999999998 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 5.0 4 1.0 5 1.0 6 0.0 7 3.0 8 4.0 9 5.0 10 3.0 11 3.0 12 10.0 13 26.0 14 33.0 15 7.0 16 10.0 17 6.0 18 16.0 19 8.0 20 7.0 21 16.0 22 10.0 23 33.0 24 31.0 25 27.0 26 38.0 27 36.0 28 49.0 29 37.0 30 74.0 31 70.0 32 79.0 33 103.0 34 149.0 35 231.0 36 504.0 37 2358.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.31594860166289 22.95288485764676 16.855631141345427 25.875535399344923 2 29.849999999999998 26.875 27.6 15.675 3 21.375 28.999999999999996 30.0 19.625 4 23.575 33.25 23.05 20.125 5 24.45 34.525 22.825 18.2 6 21.65 37.325 22.575 18.45 7 20.075000000000003 22.475 38.224999999999994 19.225 8 21.675 25.3 27.05 25.974999999999998 9 22.075 25.474999999999998 28.825 23.625 10-14 23.248487273090966 29.269390408561286 25.983897584637695 21.498224733710057 15-19 23.43 27.725 27.185 21.66 20-24 23.405 28.055000000000003 27.105 21.435000000000002 25-29 23.285 28.49 26.955000000000002 21.27 30-34 23.7 28.34 27.21 20.75 35-39 23.305 28.275 27.584999999999997 20.835 40-44 23.915 27.955000000000002 27.51 20.62 45-49 23.655 27.935 27.339999999999996 21.07 50-54 24.15007040836854 27.625226312613155 27.026755180044255 21.19794809897405 55-59 24.0253807106599 27.79695431472081 27.20812182741117 20.96954314720812 60-64 23.36233367451382 28.362333674513817 27.256908904810643 21.01842374616172 65-69 23.41726618705036 27.893114080164437 27.667009249743064 21.022610483042136 70-74 23.805601317957166 27.471169686985174 27.502059308072486 21.22116968698517 75-79 24.289392378990733 27.97116374871267 27.281153450051495 20.45829042224511 80-84 24.08146556135503 27.837478251970115 27.121072561662064 20.959983625012793 85-89 23.965130505709624 28.068923327895597 27.304241435562805 20.66170473083197 90-94 23.759711572640025 27.70019803991266 27.542781699080894 20.997308688366427 95-99 24.009737789724603 27.945427803418372 27.44332302074352 20.601511386113504 100-104 24.36442823863061 27.529626253418414 27.50430466930011 20.601640838650866 105-109 24.602772998684344 27.613601862159697 26.965894140269203 20.817730998886752 110-114 24.36473857034605 28.315231118969436 27.395807021975244 19.92422328870927 115-119 24.49000201979398 27.60048475055544 27.893354877802462 20.016158351848112 120-124 24.252960443436635 27.397329302091205 27.553539934492317 20.796170319979844 125-129 25.10633988251975 28.25096212274661 26.48369455134697 20.159003443386673 130-134 24.84740590030519 26.8616480162767 27.594099694811803 20.696846388606307 135-139 24.654731457800512 27.375959079283884 27.406649616368284 20.562659846547316 140-144 25.14718681206164 27.61992525469718 27.031178006450624 20.20170992679056 145-149 25.36545192505662 27.573605106032527 27.151533868643195 19.909409100267656 150-151 25.258933195235628 26.657172449508025 27.62817193164164 20.45572242361471 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 1.0 16 1.0 17 1.5 18 1.5 19 4.0 20 5.5 21 4.0 22 5.0 23 6.0 24 6.5 25 5.5 26 6.0 27 9.0 28 10.5 29 12.0 30 13.0 31 13.0 32 18.0 33 24.5 34 33.0 35 48.5 36 70.0 37 92.0 38 116.5 39 150.0 40 170.0 41 198.5 42 253.5 43 288.5 44 301.0 45 293.5 46 289.0 47 275.5 48 240.5 49 219.5 50 184.5 51 140.5 52 112.5 53 97.0 54 72.5 55 47.0 56 41.0 57 34.0 58 25.5 59 17.5 60 9.5 61 7.5 62 6.0 63 3.5 64 2.5 65 2.0 66 1.5 67 1.5 68 1.0 69 1.0 70 0.5 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.015 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.58 55-59 1.5 60-64 2.3 65-69 2.7 70-74 2.88 75-79 2.9000000000000004 80-84 2.29 85-89 1.92 90-94 1.5350000000000001 95-99 1.415 100-104 1.27 105-109 1.1900000000000002 110-114 1.0250000000000001 115-119 0.98 120-124 0.775 125-129 1.26 130-134 1.7000000000000002 135-139 2.25 140-144 2.335 145-149 2.86 150-151 3.45 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.425 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.675 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 0.95 0.0 0.0 0.0 0.0 108-109 1.1 0.0 0.0 0.0 0.0 110-111 1.2125 0.0 0.0 0.0 0.0 112-113 1.3875000000000002 0.0 0.0 0.0 0.0 114-115 1.5375 0.0 0.0 0.0 0.0 116-117 1.825 0.0 0.0 0.0 0.0 118-119 2.0999999999999996 0.0 0.0 0.0 0.0 120-121 2.45 0.0 0.0 0.0 0.0 122-123 2.6500000000000004 0.0 0.0 0.0 0.0 124-125 2.8375 0.0 0.0 0.0 0.0 126-127 3.125 0.0 0.0 0.0 0.0 128-129 3.45 0.0 0.0 0.0 0.0 130-131 3.675 0.0 0.0 0.0 0.0 132-133 3.95 0.0 0.0 0.0 0.0 134-135 4.2 0.0 0.0 0.0 0.0 136-137 4.4625 0.0 0.0 0.0 0.0 138-139 4.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCCACT 10 0.0068293316 144.98734 1 CCTTGTC 10 0.007094481 143.175 8 CTCCAAC 10 0.007094481 143.175 8 ACTCTCC 10 0.007094481 143.175 5 CCACTCT 10 0.007094481 143.175 3 CACTCTC 10 0.007094481 143.175 4 AATATCT 10 0.007094481 143.175 3 GCACCCT 10 0.007094481 143.175 7 >>END_MODULE Read 832258 spots for SRR7169638.sra Written 832258 spots for SRR7169638.sra Read 832267 spots for SRR7169638.sra Written 832267 spots for SRR7169638.sra Read 832258 spots for SRR7169638.sra Written 832258 spots for SRR7169638.sra Read 832258 spots for SRR7169638.sra Written 832258 spots for SRR7169638.sra Read 832258 spots for SRR7169638.sra Written 832258 spots for SRR7169638.sra Read 832258 spots for SRR7169638.sra Written 832258 spots for SRR7169638.sra Read 832258 spots for SRR7169638.sra Written 832258 spots for SRR7169638.sra Read 832258 spots for SRR7169638.sra Written 832258 spots for SRR7169638.sra Read 832258 spots for SRR7169638.sra Written 832258 spots for SRR7169638.sra Read 832258 spots for SRR7169638.sra Written 832258 spots for SRR7169638.sra Read 832258 spots for SRR7169638.sra Written 832258 spots for SRR7169638.sra Read 832258 spots for SRR7169638.sra Written 832258 spots for SRR7169638.sra Read 832258 spots for SRR7169638.sra Written 832258 spots for SRR7169638.sra Read 832258 spots for SRR7169638.sra Written 832258 spots for SRR7169638.sra Read 832258 spots for SRR7169638.sra Written 832258 spots for SRR7169638.sra Read 832258 spots for SRR7169638.sra Written 832258 spots for SRR7169638.sra Read 832258 spots for SRR7169638.sra Written 832258 spots for SRR7169638.sra Read 832258 spots for SRR7169638.sra Written 832258 spots for SRR7169638.sra Read 832258 spots for SRR7169638.sra Written 832258 spots for SRR7169638.sra Read 832258 spots for SRR7169638.sra Written 832258 spots for SRR7169638.sra SRR ids: ['SRR7169638.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r6_3qov4 SRR7169638.sra spots: 16645169 blocks: [[1, 832258], [832259, 1664516], [1664517, 2496774], [2496775, 3329032], [3329033, 4161290], [4161291, 4993548], [4993549, 5825806], [5825807, 6658064], [6658065, 7490322], [7490323, 8322580], [8322581, 9154838], [9154839, 9987096], [9987097, 10819354], [10819355, 11651612], [11651613, 12483870], [12483871, 13316128], [13316129, 14148386], [14148387, 14980644], [14980645, 15812902], [15812903, 16645169]] SRR7169638 file size 5618801 SRR7169638 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169638 SRR7169638_1.fastq SRR7169638_2.fastq Input file: SRR7169638_1.fastq Paired file: SRR7169638_2.fastq trimmed: SRR7169638-trimmed-pair1.fastq, SRR7169638-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 11:45:45 2025 >> started Tue Feb 11 11:46:12 2025 >> done (27.007s) 16645169 read pairs processed; of these: 20830 ( 0.13%) short read pairs filtered out after trimming by size control 26757 ( 0.16%) empty read pairs filtered out after trimming by size control 16597582 (99.71%) read pairs available; of these: 8071851 (48.63%) trimmed read pairs available after processing 8525731 (51.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 8 0.00% 21 6 0.00% 22 1 0.00% 23 6 0.00% 24 5 0.00% 25 4 0.00% 26 12 0.00% 27 9 0.00% 28 6 0.00% 29 5 0.00% 30 12 0.00% 31 4 0.00% 32 16 0.00% 33 10 0.00% 34 17 0.00% 35 13 0.00% 36 12 0.00% 37 20 0.00% 38 25 0.00% 39 21 0.00% 40 30 0.00% 41 24 0.00% 42 25 0.00% 43 31 0.00% 44 53 0.00% 45 38 0.00% 46 52 0.00% 47 55 0.00% 48 61 0.00% 49 67 0.00% 50 85 0.00% 51 101 0.00% 52 106 0.00% 53 122 0.00% 54 147 0.00% 55 132 0.00% 56 145 0.00% 57 200 0.00% 58 198 0.00% 59 255 0.00% 60 273 0.00% 61 316 0.00% 62 341 0.00% 63 393 0.00% 64 431 0.00% 65 526 0.00% 66 670 0.00% 67 932 0.01% 68 1049 0.01% 69 1272 0.01% 70 1443 0.01% 71 1291 0.01% 72 1423 0.01% 73 1579 0.01% 74 1863 0.01% 75 2513 0.02% 76 2221 0.01% 77 1791 0.01% 78 2553 0.02% 79 4070 0.02% 80 6241 0.04% 81 2849 0.02% 82 3096 0.02% 83 3559 0.02% 84 4942 0.03% 85 5626 0.03% 86 6271 0.04% 87 6700 0.04% 88 6994 0.04% 89 7291 0.04% 90 7538 0.05% 91 8059 0.05% 92 8866 0.05% 93 9563 0.06% 94 10316 0.06% 95 11186 0.07% 96 12083 0.07% 97 13175 0.08% 98 14557 0.09% 99 18399 0.11% 100 21795 0.13% 101 18345 0.11% 102 15043 0.09% 103 15073 0.09% 104 16320 0.10% 105 17043 0.10% 106 17877 0.11% 107 18572 0.11% 108 19339 0.12% 109 20252 0.12% 110 21036 0.13% 111 22092 0.13% 112 23226 0.14% 113 24268 0.15% 114 25161 0.15% 115 26736 0.16% 116 27989 0.17% 117 28930 0.17% 118 30160 0.18% 119 30855 0.19% 120 31772 0.19% 121 33171 0.20% 122 34877 0.21% 123 36467 0.22% 124 38469 0.23% 125 40186 0.24% 126 42619 0.26% 127 44379 0.27% 128 46191 0.28% 129 47448 0.29% 130 50749 0.31% 131 52888 0.32% 132 55671 0.34% 133 58908 0.35% 134 62497 0.38% 135 66901 0.40% 136 71720 0.43% 137 76629 0.46% 138 82611 0.50% 139 89744 0.54% 140 97218 0.59% 141 104858 0.63% 142 116728 0.70% 143 130071 0.78% 144 149683 0.90% 145 179682 1.08% 146 218576 1.32% 147 294898 1.78% 148 441264 2.66% 149 838900 5.05% 150 3799556 22.89% 151 8525731 51.37% 16597582 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=41 prefix-density=0.23 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAAT criterion=fanout-score sequence-density=0.05 sequence-density-rank=38 fanout-score=115.27 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=16.2 sequence=TTCTTCAAGAATTTTAAGCAGTGTGCGTCGCTCCAATCATGGCATATCCACTTCATGAAAACGGCATCTGCTTTGGGCACGCTAACAAACATGTCCCCACCAACATGCTCCACACCGGGATAAGATGGGGCATCCTCAATGACGTGGGGCAGATCAAAGTTAATGCCCTTAATTGAAGGGTATTTAGAGACGATGGTGTTAACGACAGCTCCAGTCCCACCACCAACA criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=5.61 fanout-score-rank=24 prefix-density=0.34 prefix-fanout=3.8 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=44 fanout-score=164.69 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=14.2 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTACTCGAGAAGATCAAGGAGA SRR7169638 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 11:46:56 Started mapping on | Feb 11 11:46:56 Finished on | Feb 11 11:48:32 Mapping speed, Million of reads per hour | 622.41 Number of input reads | 16597582 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 15650807 Uniquely mapped reads % | 94.30% Average mapped length | 293.54 Number of splices: Total | 14600677 Number of splices: Annotated (sjdb) | 14350841 Number of splices: GT/AG | 14387346 Number of splices: GC/AG | 165994 Number of splices: AT/AC | 11325 Number of splices: Non-canonical | 36012 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 308871 % of reads mapped to multiple loci | 1.86% Number of reads mapped to too many loci | 20807 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.68% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 657323 657323 657323 N_multimapping 308871 308871 308871 N_noFeature 288586 15474376 365896 N_ambiguous 164794 1142 64734 UnstrandedReadsAssigned:15197427 PositiveStrandReadsAssigned:175289 NegativeStrandReadsAssigned:15220177 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169638 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169638-trimmed-pair1.fastq SRR7169638-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,597,582 reads, 15,151,251 reads pseudoaligned [quant] estimated average fragment length: 245.793 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,272 rounds 52401 SRR7169638.ke.tsv 34699 SRR7169638.se.tsv 87100 total ==> SRR7169638.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.21 229 7.4255 Potri.005G024800.1.v4.1 1035 790.207 30 2.18288 Potri.004G059700.1.v4.1 961 716.224 5 0.401394 Potri.007G009000.2.v4.1 1416 1171.21 0 0 Potri.003G141000.2.v4.1 2943 2698.21 295.037 6.2871 Potri.016G087400.1.v4.1 270 75.8796 1977 1498.07 Potri.015G069301.1.v4.1 564 323.08 0 0 Potri.010G195200.1.v4.1 1773 1528.21 12 0.45149 Potri.012G127500.1.v4.1 977 732.224 6978 547.944 ==> SRR7169638.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1177 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 272 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 15 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169638 completed mapping pipeline successfully