Starting /dee2/code/volunteer_pipeline.sh SRR7169738 current disk space = 3051504803840 free memory = 1412914204 SRR7169738 SRAfilesize ec35e4e306e6edc5f8f4c2def78a1800 SRR7169738.sra SRR7169738.sra file validated SRR7169738 is paired end SRR7169738 is conventional basespace SRR7169738 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169738_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.04425 27.0 18.0 33.0 18.0 33.0 2 24.24625 25.0 18.0 29.0 18.0 33.0 3 28.6625 29.0 27.0 31.0 25.0 33.0 4 31.291 31.0 31.0 33.0 29.0 33.0 5 32.3485 33.0 32.0 33.0 32.0 33.0 6 36.72525 38.0 37.0 38.0 34.0 38.0 7 37.1675 38.0 38.0 38.0 36.0 38.0 8 37.49675 38.0 38.0 38.0 37.0 38.0 9 37.635 38.0 38.0 38.0 38.0 38.0 10-14 37.675850000000004 38.0 38.0 38.0 37.8 38.0 15-19 37.6776 38.0 38.0 38.0 38.0 38.0 20-24 37.66755 38.0 38.0 38.0 38.0 38.0 25-29 37.5139 38.0 38.0 38.0 37.4 38.0 30-34 37.580200000000005 38.0 38.0 38.0 38.0 38.0 35-39 37.451499999999996 38.0 38.0 38.0 37.6 38.0 40-44 37.44945 38.0 38.0 38.0 37.4 38.0 45-49 37.4433 38.0 38.0 38.0 37.4 38.0 50-54 37.4321 38.0 38.0 38.0 37.0 38.0 55-59 37.4094 38.0 38.0 38.0 37.0 38.0 60-64 37.3178 38.0 38.0 38.0 36.8 38.0 65-69 37.03915 38.0 38.0 38.0 36.0 38.0 70-74 37.2271 38.0 38.0 38.0 36.2 38.0 75-79 36.5201 38.0 37.4 38.0 33.4 38.0 80-84 37.06715 38.0 38.0 38.0 35.8 38.0 85-89 36.887600000000006 38.0 38.0 38.0 35.2 38.0 90-94 36.86015 38.0 38.0 38.0 35.2 38.0 95-99 36.9178 38.0 38.0 38.0 35.6 38.0 100-104 36.7315 38.0 38.0 38.0 35.0 38.0 105-109 36.6246 38.0 38.0 38.0 34.4 38.0 110-114 36.14985 38.0 37.6 38.0 32.4 38.0 115-119 34.97135 38.0 35.4 38.0 26.8 38.0 120-124 36.03015 38.0 36.8 38.0 33.0 38.0 125-129 35.8099 38.0 36.6 38.0 32.2 38.0 130-134 35.32915 38.0 35.6 38.0 29.6 38.0 135-139 35.2068 38.0 35.4 38.0 29.2 38.0 140-144 34.014649999999996 38.0 34.4 38.0 23.0 38.0 145-149 34.32940000000001 38.0 35.0 38.0 26.8 38.0 150-151 29.680875 36.0 28.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 2.0 13 1.0 14 0.0 15 1.0 16 0.0 17 2.0 18 2.0 19 2.0 20 2.0 21 6.0 22 3.0 23 2.0 24 5.0 25 7.0 26 11.0 27 15.0 28 10.0 29 16.0 30 33.0 31 47.0 32 56.0 33 100.0 34 188.0 35 366.0 36 1113.0 37 2009.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.65300477747046 11.440784510937894 10.208700025144582 38.697510686447075 2 23.425 14.35 34.875 27.35 3 20.625 19.375 26.25 33.75 4 22.1 29.75 23.3 24.85 5 20.775 33.025 24.675 21.525 6 18.7 36.175000000000004 24.55 20.575 7 13.8 25.825 42.1 18.275 8 17.825 25.424999999999997 30.75 26.0 9 17.9 26.174999999999997 32.300000000000004 23.625 10-14 20.61 29.549999999999997 26.540000000000003 23.3 15-19 19.855 28.435 27.865000000000002 23.845 20-24 20.52 28.63 27.279999999999998 23.57 25-29 20.32 28.895 27.800000000000004 22.985 30-34 20.01 28.345 27.775 23.87 35-39 19.73 29.005 27.6 23.665 40-44 20.29 28.485 27.529999999999998 23.695 45-49 20.235 28.875 27.384999999999998 23.505000000000003 50-54 20.21 28.71 27.615000000000002 23.465 55-59 20.455000000000002 28.610000000000003 27.115000000000002 23.82 60-64 20.335 28.4 27.279999999999998 23.985 65-69 19.895 28.754999999999995 27.584999999999997 23.765 70-74 20.74 28.575 27.395000000000003 23.29 75-79 20.385 28.555000000000003 27.279999999999998 23.78 80-84 20.05 28.689999999999998 27.325 23.935000000000002 85-89 20.445 28.23 27.750000000000004 23.575 90-94 20.580000000000002 28.199999999999996 27.735 23.485 95-99 20.76 28.46 27.965 22.814999999999998 100-104 21.044999999999998 28.585 26.865 23.505000000000003 105-109 21.060000000000002 28.215 26.97 23.755000000000003 110-114 20.915 29.01 27.37 22.705000000000002 115-119 20.745 28.775000000000002 27.61 22.869999999999997 120-124 20.661033051652584 28.131406570328515 27.42137106855343 23.78618930946547 125-129 20.72 28.27 27.400000000000002 23.61 130-134 21.375 28.79 26.655 23.18 135-139 20.990000000000002 28.54 26.529999999999998 23.94 140-144 21.085 27.815 27.325 23.775 145-149 20.674999999999997 28.48 26.845000000000002 24.0 150-151 20.724999999999998 28.825 26.1125 24.337500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.5 23 1.5 24 0.0 25 2.5 26 4.5 27 9.5 28 13.0 29 13.0 30 21.0 31 22.5 32 23.5 33 40.5 34 50.5 35 59.5 36 90.5 37 114.5 38 124.0 39 151.5 40 183.0 41 204.0 42 234.0 43 260.0 44 282.5 45 281.0 46 267.0 47 263.0 48 238.5 49 210.5 50 188.0 51 151.0 52 125.0 53 105.5 54 70.0 55 45.0 56 35.0 57 27.0 58 18.5 59 15.0 60 13.5 61 10.5 62 7.0 63 4.5 64 3.5 65 4.0 66 3.5 67 2.5 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.005 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0125 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.36250000000000004 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.6125 0.0 0.0 0.0 0.0 90-91 0.6625000000000001 0.0 0.0 0.0 0.0 92-93 0.7625 0.0 0.0 0.0 0.0 94-95 0.8125 0.0 0.0 0.0 0.0 96-97 0.925 0.0 0.0 0.0 0.0 98-99 1.1125 0.0 0.0 0.0 0.0 100-101 1.2625 0.0 0.0 0.0 0.0 102-103 1.5 0.0 0.0 0.0 0.0 104-105 1.8375 0.0 0.0 0.0 0.0 106-107 2.1 0.0 0.0 0.0 0.0 108-109 2.4125 0.0 0.0 0.0 0.0 110-111 2.5625 0.0 0.0 0.0 0.0 112-113 2.8499999999999996 0.0 0.0 0.0 0.0 114-115 3.0999999999999996 0.0 0.0 0.0 0.0 116-117 3.4124999999999996 0.0 0.0 0.0 0.0 118-119 3.9625000000000004 0.0 0.0 0.0 0.0 120-121 4.375 0.0 0.0 0.0 0.0 122-123 4.987500000000001 0.0 0.0 0.0 0.0 124-125 5.675000000000001 0.0 0.0 0.0 0.0 126-127 6.2875 0.0 0.0 0.0 0.0 128-129 6.675 0.0 0.0 0.0 0.0 130-131 7.1875 0.0 0.0 0.0 0.0 132-133 7.725 0.0 0.0 0.0 0.0 134-135 8.25 0.0 0.0 0.0 0.0 136-137 8.9375 0.0 0.0 0.0 0.0 138-139 9.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169738 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169738_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9725 33.0 33.0 34.0 32.0 34.0 2 33.20825 34.0 33.0 34.0 33.0 34.0 3 33.1805 34.0 33.0 34.0 33.0 34.0 4 33.16125 34.0 33.0 34.0 33.0 34.0 5 33.2195 34.0 33.0 34.0 33.0 34.0 6 37.3615 38.0 38.0 38.0 37.0 38.0 7 37.455 38.0 38.0 38.0 38.0 38.0 8 37.46625 38.0 38.0 38.0 38.0 38.0 9 37.2115 38.0 38.0 38.0 37.0 38.0 10-14 37.3673 38.0 38.0 38.0 37.6 38.0 15-19 36.74640000000001 38.0 37.8 38.0 34.8 38.0 20-24 37.26255 38.0 38.0 38.0 37.2 38.0 25-29 36.29765 38.0 37.6 38.0 32.2 38.0 30-34 37.220150000000004 38.0 38.0 38.0 37.0 38.0 35-39 37.33625000000001 38.0 38.0 38.0 37.2 38.0 40-44 37.2624 38.0 38.0 38.0 37.2 38.0 45-49 37.19175 38.0 38.0 38.0 36.6 38.0 50-54 37.18320000000001 38.0 38.0 38.0 36.8 38.0 55-59 37.11024999999999 38.0 38.0 38.0 36.6 38.0 60-64 37.01875 38.0 38.0 38.0 36.2 38.0 65-69 35.607150000000004 38.0 36.4 38.0 28.4 38.0 70-74 36.006099999999996 38.0 37.2 38.0 31.4 38.0 75-79 36.80975 38.0 38.0 38.0 35.8 38.0 80-84 36.19175 38.0 37.4 38.0 30.8 38.0 85-89 36.75675 38.0 38.0 38.0 35.2 38.0 90-94 36.795249999999996 38.0 38.0 38.0 35.8 38.0 95-99 36.74655 38.0 38.0 38.0 35.2 38.0 100-104 36.472899999999996 38.0 38.0 38.0 34.8 38.0 105-109 35.5558 38.0 37.2 38.0 30.4 38.0 110-114 35.4092 38.0 37.0 38.0 30.6 38.0 115-119 34.3128 38.0 36.2 38.0 24.4 38.0 120-124 34.3083 38.0 35.8 38.0 24.2 38.0 125-129 34.32185 38.0 35.4 38.0 23.8 38.0 130-134 35.0588 38.0 35.8 38.0 29.2 38.0 135-139 34.935050000000004 38.0 35.6 38.0 28.8 38.0 140-144 34.6085 38.0 34.8 38.0 27.8 38.0 145-149 33.878400000000006 38.0 33.8 38.0 24.0 38.0 150-151 29.561 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 1.0 4 1.0 5 0.0 6 0.0 7 1.0 8 2.0 9 0.0 10 1.0 11 1.0 12 2.0 13 1.0 14 3.0 15 2.0 16 5.0 17 2.0 18 3.0 19 6.0 20 4.0 21 10.0 22 9.0 23 7.0 24 11.0 25 14.0 26 17.0 27 15.0 28 24.0 29 39.0 30 38.0 31 65.0 32 113.0 33 125.0 34 180.0 35 306.0 36 726.0 37 2260.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.90267700775582 19.614711033274958 14.911183387540655 28.57142857142857 2 26.05 26.424999999999997 31.65 15.875 3 20.325 28.625 30.95 20.1 4 23.775 34.1 22.5 19.625 5 24.6 36.15 22.525000000000002 16.725 6 21.0 36.925000000000004 23.65 18.425 7 19.725 20.875 39.425 19.975 8 21.85 24.825 27.725 25.6 9 21.7 25.275 29.099999999999998 23.925 10-14 23.32 28.84 26.240000000000002 21.6 15-19 23.01 27.644999999999996 28.29 21.055 20-24 23.595 27.77 27.884999999999998 20.75 25-29 23.095 28.610000000000003 27.3 20.995 30-34 22.53 28.189999999999998 28.49 20.79 35-39 23.064999999999998 28.499999999999996 28.000000000000004 20.435 40-44 22.900000000000002 28.075 28.01 21.015 45-49 22.735 28.21 28.060000000000002 20.995 50-54 22.675 28.475 27.805000000000003 21.044999999999998 55-59 23.150000000000002 28.18 27.794999999999998 20.875 60-64 22.685 28.345 28.615000000000002 20.355 65-69 23.119999999999997 27.88 28.444999999999997 20.555 70-74 23.085 27.694999999999997 28.37 20.849999999999998 75-79 22.69034005416792 27.665763867990773 28.799277761059283 20.844618316782025 80-84 22.86 27.32 28.384999999999998 21.435000000000002 85-89 23.525 27.76 28.29 20.424999999999997 90-94 23.95 27.73 28.185 20.135 95-99 23.43 28.360000000000003 27.900000000000002 20.31 100-104 23.763763763763766 27.782782782782782 28.32832832832833 20.125125125125127 105-109 23.5167043456418 27.77694046721929 28.22406430545089 20.482290881688016 110-114 23.870738275494134 27.793303185813727 27.72216858899446 20.61378994969768 115-119 24.528301886792452 27.704142626955665 28.197931285409844 19.56962420084204 120-124 24.42779643502971 27.796435029708082 27.636269697752518 20.139498837509688 125-129 25.104517181604972 27.449780768838583 27.48546956255736 19.960232486999082 130-134 24.90241217095386 28.100290261235113 26.964267841056948 20.03302972675408 135-139 24.925 27.839999999999996 27.36 19.875 140-144 25.509999999999998 27.655 27.045 19.79 145-149 25.580000000000002 28.17 26.56 19.689999999999998 150-151 25.575 28.075 26.900000000000002 19.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 2.0 23 3.0 24 1.5 25 1.0 26 1.0 27 5.0 28 6.0 29 7.5 30 12.0 31 21.5 32 29.0 33 36.0 34 49.0 35 58.5 36 81.5 37 107.0 38 138.5 39 179.0 40 207.5 41 236.0 42 258.5 43 289.5 44 296.5 45 279.5 46 278.0 47 258.5 48 227.0 49 196.0 50 172.5 51 139.5 52 105.5 53 85.5 54 65.5 55 45.0 56 35.0 57 27.5 58 14.0 59 12.0 60 9.0 61 7.0 62 6.5 63 3.0 64 1.5 65 0.5 66 1.5 67 1.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.31 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.1 105-109 0.475 110-114 1.595 115-119 3.805 120-124 3.225 125-129 1.9300000000000002 130-134 0.09 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0125 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.5125 0.0 0.0 0.0 0.0 88-89 0.675 0.0 0.0 0.0 0.0 90-91 0.7375 0.0 0.0 0.0 0.0 92-93 0.8374999999999999 0.0 0.0 0.0 0.0 94-95 0.9 0.0 0.0 0.0 0.0 96-97 1.025 0.0 0.0 0.0 0.0 98-99 1.1875 0.0 0.0 0.0 0.0 100-101 1.3 0.0 0.0 0.0 0.0 102-103 1.5125 0.0 0.0 0.0 0.0 104-105 1.8625 0.0 0.0 0.0 0.0 106-107 2.125 0.0 0.0 0.0 0.0 108-109 2.425 0.0 0.0 0.0 0.0 110-111 2.575 0.0 0.0 0.0 0.0 112-113 2.9000000000000004 0.0 0.0 0.0 0.0 114-115 3.125 0.0 0.0 0.0 0.0 116-117 3.4 0.0 0.0 0.0 0.0 118-119 3.8875 0.0 0.0 0.0 0.0 120-121 4.25 0.0 0.0 0.0 0.0 122-123 4.800000000000001 0.0 0.0 0.0 0.0 124-125 5.5 0.0 0.0 0.0 0.0 126-127 6.1 0.0 0.0 0.0 0.0 128-129 6.475 0.0 0.0 0.0 0.0 130-131 7.012499999999999 0.0 0.0 0.0 0.0 132-133 7.5625 0.0 0.0 0.0 0.0 134-135 8.125 0.0 0.0 0.0 0.0 136-137 8.825 0.0 0.0 0.0 0.0 138-139 9.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTAGAA 10 0.0069303843 144.3 7 TCTCTTG 10 0.0069303843 144.3 7 AATGCCA 10 0.0069303843 144.3 7 >>END_MODULE Read 734210 spots for SRR7169738.sra Written 734210 spots for SRR7169738.sra Read 734210 spots for SRR7169738.sra Written 734210 spots for SRR7169738.sra Read 734210 spots for SRR7169738.sra Written 734210 spots for SRR7169738.sra Read 734210 spots for SRR7169738.sra Written 734210 spots for SRR7169738.sra Read 734210 spots for SRR7169738.sra Written 734210 spots for SRR7169738.sra Read 734210 spots for SRR7169738.sra Written 734210 spots for SRR7169738.sra Read 734210 spots for SRR7169738.sra Written 734210 spots for SRR7169738.sra Read 734210 spots for SRR7169738.sra Written 734210 spots for SRR7169738.sra Read 734210 spots for SRR7169738.sra Written 734210 spots for SRR7169738.sra Read 734210 spots for SRR7169738.sra Written 734210 spots for SRR7169738.sra Read 734210 spots for SRR7169738.sra Written 734210 spots for SRR7169738.sra Read 734210 spots for SRR7169738.sra Written 734210 spots for SRR7169738.sra Read 734210 spots for SRR7169738.sra Written 734210 spots for SRR7169738.sra Read 734210 spots for SRR7169738.sra Written 734210 spots for SRR7169738.sra Read 734210 spots for SRR7169738.sra Written 734210 spots for SRR7169738.sra Read 734210 spots for SRR7169738.sra Written 734210 spots for SRR7169738.sra Read 734210 spots for SRR7169738.sra Written 734210 spots for SRR7169738.sra Read 734210 spots for SRR7169738.sra Written 734210 spots for SRR7169738.sra Read 734210 spots for SRR7169738.sra Written 734210 spots for SRR7169738.sra Read 734226 spots for SRR7169738.sra Written 734226 spots for SRR7169738.sra SRR ids: ['SRR7169738.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pya00wlu SRR7169738.sra spots: 14684216 blocks: [[1, 734210], [734211, 1468420], [1468421, 2202630], [2202631, 2936840], [2936841, 3671050], [3671051, 4405260], [4405261, 5139470], [5139471, 5873680], [5873681, 6607890], [6607891, 7342100], [7342101, 8076310], [8076311, 8810520], [8810521, 9544730], [9544731, 10278940], [10278941, 11013150], [11013151, 11747360], [11747361, 12481570], [12481571, 13215780], [13215781, 13949990], [13949991, 14684216]] SRR7169738 file size 4954298 SRR7169738 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169738 SRR7169738_1.fastq SRR7169738_2.fastq Input file: SRR7169738_1.fastq Paired file: SRR7169738_2.fastq trimmed: SRR7169738-trimmed-pair1.fastq, SRR7169738-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 11:42:44 2025 >> started Tue Feb 11 11:43:12 2025 >> done (28.254s) 14684216 read pairs processed; of these: 7926 ( 0.05%) short read pairs filtered out after trimming by size control 8400 ( 0.06%) empty read pairs filtered out after trimming by size control 14667890 (99.89%) read pairs available; of these: 6962595 (47.47%) trimmed read pairs available after processing 7705295 (52.53%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 3 0.00% 21 6 0.00% 22 3 0.00% 23 1 0.00% 24 0 0.00% 25 3 0.00% 26 5 0.00% 27 3 0.00% 28 7 0.00% 29 5 0.00% 30 6 0.00% 31 6 0.00% 32 8 0.00% 33 7 0.00% 34 6 0.00% 35 11 0.00% 36 14 0.00% 37 15 0.00% 38 12 0.00% 39 17 0.00% 40 30 0.00% 41 36 0.00% 42 36 0.00% 43 40 0.00% 44 38 0.00% 45 50 0.00% 46 65 0.00% 47 60 0.00% 48 75 0.00% 49 73 0.00% 50 110 0.00% 51 113 0.00% 52 139 0.00% 53 138 0.00% 54 188 0.00% 55 150 0.00% 56 190 0.00% 57 228 0.00% 58 256 0.00% 59 292 0.00% 60 333 0.00% 61 442 0.00% 62 462 0.00% 63 545 0.00% 64 633 0.00% 65 651 0.00% 66 723 0.00% 67 805 0.01% 68 955 0.01% 69 1034 0.01% 70 1170 0.01% 71 1434 0.01% 72 1623 0.01% 73 1800 0.01% 74 2187 0.01% 75 2277 0.02% 76 2678 0.02% 77 2724 0.02% 78 3016 0.02% 79 3451 0.02% 80 3730 0.03% 81 4349 0.03% 82 4837 0.03% 83 5318 0.04% 84 6451 0.04% 85 7334 0.05% 86 7887 0.05% 87 8292 0.06% 88 9117 0.06% 89 9376 0.06% 90 10341 0.07% 91 11265 0.08% 92 11990 0.08% 93 13423 0.09% 94 14167 0.10% 95 15292 0.10% 96 16062 0.11% 97 16734 0.11% 98 17349 0.12% 99 18090 0.12% 100 19272 0.13% 101 19920 0.14% 102 21202 0.14% 103 22819 0.16% 104 24068 0.16% 105 25332 0.17% 106 26146 0.18% 107 26990 0.18% 108 27649 0.19% 109 28567 0.19% 110 28765 0.20% 111 29993 0.20% 112 31667 0.22% 113 33078 0.23% 114 34440 0.23% 115 35983 0.25% 116 36644 0.25% 117 37685 0.26% 118 37977 0.26% 119 38755 0.26% 120 39468 0.27% 121 40900 0.28% 122 42450 0.29% 123 43798 0.30% 124 45378 0.31% 125 47300 0.32% 126 48521 0.33% 127 50463 0.34% 128 50475 0.34% 129 51681 0.35% 130 53074 0.36% 131 53789 0.37% 132 55825 0.38% 133 57697 0.39% 134 59045 0.40% 135 61613 0.42% 136 64547 0.44% 137 66683 0.45% 138 69481 0.47% 139 72517 0.49% 140 75870 0.52% 141 80841 0.55% 142 88046 0.60% 143 96546 0.66% 144 110144 0.75% 145 129304 0.88% 146 155837 1.06% 147 205227 1.40% 148 305667 2.08% 149 601504 4.10% 150 3209159 21.88% 151 7705295 52.53% 14667890 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.74 fanout-score-rank=34 prefix-density=0.18 prefix-fanout=2.4 sequence=CTGGCCATTCAATGTGACATCCTCTTGAGTGGCTTTCAAAAGCCTGATAAAAACGCTGAACTGACCACCTTTTTCTAGGACTTTGGTGACATTGGTTGGACCGGGTGGTGCTGGGGCTGCAGCTGGTGACTGAGCTAGGGTTGGAGGGCAATGAAGAAG criterion=fanout-score sequence-density=0.10 sequence-density-rank=23 fanout-score=240.75 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=28.7 sequence=TTCTTCTTCTTT criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.79 fanout-score-rank=35 prefix-density=0.32 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.11 sequence-density-rank=14 fanout-score=254.81 fanout-score-rank=1 prefix-density=1.01 prefix-fanout=27.2 sequence=AAGAAGAAGAAG SRR7169738 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 11:44:08 Started mapping on | Feb 11 11:44:09 Finished on | Feb 11 11:45:52 Mapping speed, Million of reads per hour | 512.66 Number of input reads | 14667890 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 13997818 Uniquely mapped reads % | 95.43% Average mapped length | 291.57 Number of splices: Total | 13162187 Number of splices: Annotated (sjdb) | 12936774 Number of splices: GT/AG | 12965730 Number of splices: GC/AG | 158099 Number of splices: AT/AC | 10970 Number of splices: Non-canonical | 27388 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 271317 % of reads mapped to multiple loci | 1.85% Number of reads mapped to too many loci | 93556 % of reads mapped to too many loci | 0.64% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.99% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 407216 407216 407216 N_multimapping 271317 271317 271317 N_noFeature 363744 13848198 440209 N_ambiguous 128679 814 54910 UnstrandedReadsAssigned:13505395 PositiveStrandReadsAssigned:148806 NegativeStrandReadsAssigned:13502699 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169738 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169738-trimmed-pair1.fastq SRR7169738-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,667,890 reads, 13,489,847 reads pseudoaligned [quant] estimated average fragment length: 221.059 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,056 rounds 52401 SRR7169738.ke.tsv 34699 SRR7169738.se.tsv 87100 total ==> SRR7169738.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1797.94 255 10.9803 Potri.005G024800.1.v4.1 1035 814.941 37 3.51498 Potri.004G059700.1.v4.1 961 740.947 5 0.522433 Potri.007G009000.2.v4.1 1416 1195.94 0 0 Potri.003G141000.2.v4.1 2943 2722.94 224.052 6.37029 Potri.016G087400.1.v4.1 270 89.0288 1293.57 1124.88 Potri.015G069301.1.v4.1 564 346.145 0 0 Potri.010G195200.1.v4.1 1773 1552.94 14 0.697944 Potri.012G127500.1.v4.1 977 756.947 4749 485.718 ==> SRR7169738.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1213 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 237 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169738 completed mapping pipeline successfully