Starting /dee2/code/volunteer_pipeline.sh SRR7169739 current disk space = 3050950742016 free memory = 1449523488 SRR7169739 SRAfilesize 6cd7c1b6312fa7a4946c0680127b7b49 SRR7169739.sra SRR7169739.sra file validated SRR7169739 is paired end SRR7169739 is conventional basespace SRR7169739 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169739_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.62325 32.0 31.0 33.0 25.0 33.0 2 28.8435 31.0 27.0 33.0 18.0 33.0 3 30.88825 33.0 31.0 33.0 27.0 33.0 4 32.166 33.0 33.0 33.0 30.0 34.0 5 32.6305 33.0 33.0 33.0 32.0 34.0 6 36.63625 38.0 37.0 38.0 34.0 38.0 7 36.96975 38.0 38.0 38.0 35.0 38.0 8 37.30325 38.0 38.0 38.0 37.0 38.0 9 37.46825 38.0 38.0 38.0 37.0 38.0 10-14 37.544349999999994 38.0 38.0 38.0 37.8 38.0 15-19 37.560050000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.58075 38.0 38.0 38.0 38.0 38.0 25-29 37.562349999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.5471 38.0 38.0 38.0 38.0 38.0 35-39 37.479150000000004 38.0 38.0 38.0 38.0 38.0 40-44 37.488150000000005 38.0 38.0 38.0 38.0 38.0 45-49 37.395700000000005 38.0 38.0 38.0 37.6 38.0 50-54 37.39855 38.0 38.0 38.0 37.4 38.0 55-59 37.37545 38.0 38.0 38.0 37.0 38.0 60-64 36.760000000000005 38.0 37.8 38.0 34.8 38.0 65-69 37.1496 38.0 38.0 38.0 36.6 38.0 70-74 37.25985 38.0 38.0 38.0 36.8 38.0 75-79 37.2068 38.0 38.0 38.0 37.0 38.0 80-84 37.12285 38.0 38.0 38.0 36.6 38.0 85-89 37.06230000000001 38.0 38.0 38.0 36.2 38.0 90-94 36.8459 38.0 38.0 38.0 35.6 38.0 95-99 36.926899999999996 38.0 38.0 38.0 36.0 38.0 100-104 36.9525 38.0 38.0 38.0 36.0 38.0 105-109 36.730450000000005 38.0 38.0 38.0 35.4 38.0 110-114 36.5209 38.0 38.0 38.0 34.8 38.0 115-119 36.60665 38.0 38.0 38.0 34.8 38.0 120-124 36.53595 38.0 38.0 38.0 34.2 38.0 125-129 36.484700000000004 38.0 38.0 38.0 34.0 38.0 130-134 36.11990000000001 38.0 37.8 38.0 33.4 38.0 135-139 35.899550000000005 38.0 37.2 38.0 32.8 38.0 140-144 35.72795 38.0 36.8 38.0 32.6 38.0 145-149 35.14954999999999 38.0 36.0 38.0 30.4 38.0 150-151 31.237125 35.5 31.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 1.0 10 1.0 11 1.0 12 0.0 13 0.0 14 2.0 15 2.0 16 1.0 17 1.0 18 0.0 19 2.0 20 1.0 21 1.0 22 5.0 23 4.0 24 2.0 25 6.0 26 10.0 27 11.0 28 19.0 29 27.0 30 38.0 31 45.0 32 62.0 33 84.0 34 104.0 35 195.0 36 557.0 37 2817.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.46358613761929 10.622802611752888 5.575087895529885 36.33852335509794 2 21.0 14.075 34.300000000000004 30.625000000000004 3 18.45 22.725 28.9 29.925 4 24.25 29.225 21.6 24.925 5 22.8 34.25 24.2 18.75 6 18.725 34.025 25.55 21.7 7 14.825 27.250000000000004 41.5 16.425 8 17.4 24.3 34.0 24.3 9 18.025 22.45 33.975 25.55 10-14 20.04 31.209999999999997 26.87 21.88 15-19 20.13 29.57 27.18 23.119999999999997 20-24 19.905 28.910000000000004 27.389999999999997 23.794999999999998 25-29 20.044999999999998 29.115000000000002 27.515 23.325000000000003 30-34 20.22702270227023 28.69286928692869 27.30773077307731 23.77237723772377 35-39 19.806980698069808 29.03290329032903 27.702770277027707 23.457345734573458 40-44 20.669999999999998 28.33 27.11 23.89 45-49 20.369999999999997 29.145 26.595000000000002 23.89 50-54 20.41 29.080000000000002 26.97 23.54 55-59 20.505000000000003 28.915000000000003 26.91 23.669999999999998 60-64 20.150000000000002 28.810000000000002 27.605 23.435 65-69 20.52 28.575 27.12 23.785 70-74 20.585 29.235 26.745 23.435 75-79 21.01 28.09 26.834999999999997 24.065 80-84 20.695 28.810000000000002 27.01 23.485 85-89 20.775 28.675 27.04 23.51 90-94 20.155 28.93 26.71 24.205 95-99 20.82 28.975 26.784999999999997 23.419999999999998 100-104 21.00630189056717 29.223767130139045 26.062818845653695 23.70711213364009 105-109 21.55691628187111 28.623770327243527 26.46556916281871 23.353744228066653 110-114 20.95036746199537 28.78787878787879 26.890164099466425 23.37158965065942 115-119 21.095 29.134999999999998 26.135 23.635 120-124 21.435000000000002 28.685 26.165 23.715 125-129 20.805 28.749999999999996 26.44 24.005000000000003 130-134 21.625 28.735 26.205000000000002 23.435 135-139 21.12 28.62 25.955000000000002 24.305 140-144 21.38 28.275 26.06 24.285 145-149 21.605 28.46 26.245 23.69 150-151 20.43010752688172 29.782445611402853 25.23130782695674 24.55613903475869 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.5 23 1.5 24 2.5 25 4.0 26 5.5 27 7.5 28 7.5 29 11.5 30 15.5 31 18.0 32 32.0 33 47.0 34 48.5 35 64.5 36 91.5 37 115.5 38 137.0 39 162.0 40 185.5 41 194.0 42 220.5 43 245.5 44 252.5 45 274.5 46 269.5 47 251.0 48 254.0 49 223.0 50 176.5 51 145.0 52 122.5 53 106.0 54 83.5 55 61.5 56 46.5 57 33.0 58 23.0 59 13.5 60 9.0 61 8.0 62 4.5 63 4.5 64 4.0 65 4.5 66 4.0 67 1.5 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.44999999999999996 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.01 35-39 0.01 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.03 105-109 0.38 110-114 0.67 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26933736457546 98.5 2 0.6802721088435374 1.35 3 0.05039052658100278 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1875 0.0 0.0 0.0 0.0 70-71 0.2375 0.0 0.0 0.0 0.0 72-73 0.3 0.0 0.0 0.0 0.0 74-75 0.38749999999999996 0.0 0.0 0.0 0.0 76-77 0.4375 0.0 0.0 0.0 0.0 78-79 0.5125 0.0 0.0 0.0 0.0 80-81 0.625 0.0 0.0 0.0 0.0 82-83 0.7250000000000001 0.0 0.0 0.0 0.0 84-85 0.8125 0.0 0.0 0.0 0.0 86-87 0.925 0.0 0.0 0.0 0.0 88-89 1.1124999999999998 0.0 0.0 0.0 0.0 90-91 1.325 0.0 0.0 0.0 0.0 92-93 1.6 0.0 0.0 0.0 0.0 94-95 1.95 0.0 0.0 0.0 0.0 96-97 2.3625 0.0 0.0 0.0 0.0 98-99 2.6625 0.0 0.0 0.0 0.0 100-101 2.9375 0.0 0.0 0.0 0.0 102-103 3.35 0.0 0.0 0.0 0.0 104-105 3.725 0.0 0.0 0.0 0.0 106-107 4.275 0.0 0.0 0.0 0.0 108-109 4.7125 0.0 0.0 0.0 0.0 110-111 5.125 0.0 0.0 0.0 0.0 112-113 5.775 0.0 0.0 0.0 0.0 114-115 6.275 0.0 0.0 0.0 0.0 116-117 6.75 0.0 0.0 0.0 0.0 118-119 7.2875 0.0 0.0 0.0 0.0 120-121 7.85 0.0 0.0 0.0 0.0 122-123 8.587499999999999 0.0 0.0 0.0 0.0 124-125 9.525 0.0 0.0 0.0 0.0 126-127 10.350000000000001 0.0 0.0 0.0 0.0 128-129 11.1125 0.0 0.0 0.0 0.0 130-131 11.7625 0.0 0.0 0.0 0.0 132-133 12.55 0.0 0.0 0.0 0.0 134-135 13.225000000000001 0.0 0.0 0.0 0.0 136-137 13.975000000000001 0.0 0.0 0.0 0.0 138-139 14.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169739 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169739_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0485 33.0 33.0 34.0 32.0 34.0 2 33.20675 34.0 33.0 34.0 33.0 34.0 3 33.17075 34.0 33.0 34.0 33.0 34.0 4 33.0705 34.0 33.0 34.0 33.0 34.0 5 33.0595 34.0 33.0 34.0 33.0 34.0 6 37.2485 38.0 38.0 38.0 37.0 38.0 7 37.34225 38.0 38.0 38.0 38.0 38.0 8 37.35825 38.0 38.0 38.0 38.0 38.0 9 37.32575 38.0 38.0 38.0 38.0 38.0 10-14 37.227599999999995 38.0 38.0 38.0 37.2 38.0 15-19 37.24335 38.0 38.0 38.0 37.2 38.0 20-24 37.24365 38.0 38.0 38.0 37.4 38.0 25-29 37.22330000000001 38.0 38.0 38.0 37.0 38.0 30-34 37.172900000000006 38.0 38.0 38.0 37.0 38.0 35-39 36.7642 38.0 38.0 38.0 35.4 38.0 40-44 37.1183 38.0 38.0 38.0 37.0 38.0 45-49 37.18105 38.0 38.0 38.0 37.0 38.0 50-54 37.1225 38.0 38.0 38.0 37.0 38.0 55-59 37.03175 38.0 38.0 38.0 36.8 38.0 60-64 37.119600000000005 38.0 38.0 38.0 37.0 38.0 65-69 37.06045 38.0 38.0 38.0 37.0 38.0 70-74 36.5955 38.0 38.0 38.0 36.2 38.0 75-79 35.46505 38.0 38.0 38.0 33.4 38.0 80-84 36.195800000000006 38.0 38.0 38.0 33.4 38.0 85-89 36.8951 38.0 38.0 38.0 36.0 38.0 90-94 36.84645 38.0 38.0 38.0 36.0 38.0 95-99 36.6316 38.0 38.0 38.0 35.4 38.0 100-104 36.494150000000005 38.0 38.0 38.0 34.6 38.0 105-109 35.10295 38.0 37.8 38.0 29.6 38.0 110-114 33.7853 38.0 37.0 38.0 18.0 38.0 115-119 32.68294999999999 38.0 36.2 38.0 2.0 38.0 120-124 33.14805 38.0 35.8 38.0 12.0 38.0 125-129 33.3264 38.0 35.2 38.0 17.4 38.0 130-134 35.0803 38.0 36.0 38.0 28.0 38.0 135-139 35.15804999999999 38.0 36.0 38.0 31.0 38.0 140-144 34.86015 38.0 36.0 38.0 29.8 38.0 145-149 34.057 38.0 35.2 38.0 25.4 38.0 150-151 30.032249999999998 35.5 27.5 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 5.0 4 1.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 1.0 13 1.0 14 4.0 15 5.0 16 4.0 17 5.0 18 5.0 19 10.0 20 8.0 21 10.0 22 15.0 23 10.0 24 9.0 25 22.0 26 20.0 27 32.0 28 51.0 29 74.0 30 77.0 31 77.0 32 84.0 33 99.0 34 115.0 35 249.0 36 448.0 37 2552.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.725 18.725 12.174999999999999 23.375 2 28.875 19.425 33.825 17.875 3 19.339504628471353 24.91868901676257 37.3530147610708 18.388791593695274 4 25.41906429822367 33.35001250938204 22.71703777833375 18.513885414060546 5 25.41906429822367 36.22717037778334 22.066549912434326 16.28721541155867 6 20.7 38.75 22.75 17.8 7 20.375 19.475 40.575 19.575 8 21.475 24.3 29.099999999999998 25.124999999999996 9 21.4 24.349999999999998 29.75 24.5 10-14 23.535 28.675 26.775 21.015 15-19 23.515 27.224999999999998 27.72 21.54 20-24 23.23848577286593 28.34425163774566 27.30409561434215 21.11316697504626 25-29 23.755000000000003 27.965 27.750000000000004 20.53 30-34 23.268490273541033 27.954193128969347 27.71915787368105 21.05815872380857 35-39 22.929490066556575 28.544262623229745 27.593454436270832 20.93279287394285 40-44 22.81526687009154 27.822520134060326 28.502826271822318 20.85938672402581 45-49 22.89843476521478 27.56413462019303 28.494274141121167 21.04315647347102 50-54 23.205442449102094 27.5423940773348 28.02261017457856 21.229553298984545 55-59 23.68855328299245 27.774166124918736 27.549132369855478 20.988148222233335 60-64 23.380000000000003 27.51 28.405 20.705000000000002 65-69 23.26 27.435 28.93 20.375 70-74 23.69819341126461 27.437882698244014 28.55118668083599 20.31273720965538 75-79 23.53982300884956 27.345132743362832 28.474752732951586 20.640291514836022 80-84 23.016154352559884 27.49784777434547 28.343545855066594 21.142452018028056 85-89 23.788568285242786 27.689153373005954 28.069210381557237 20.45306796019403 90-94 23.525 27.41 28.575 20.49 95-99 24.175 27.355 28.18 20.29 100-104 24.68734367183592 27.373686843421712 27.77888944472236 20.16008004002001 105-109 24.285418392709197 27.36122618061309 28.169014084507044 20.184341342170672 110-114 25.00940809633891 27.77270039245202 26.907155529272618 20.310735981936457 115-119 24.959670690326526 27.913444957445627 27.72431440173555 19.402569950492296 120-124 25.074272133095665 28.1369848214768 27.310538540485062 19.47820450494247 125-129 24.914098429983614 27.81624993392187 27.530792408944336 19.738859227150183 130-134 25.779604933319966 27.89531735686353 26.837461145091744 19.487616564724757 135-139 26.090000000000003 28.249999999999996 26.83 18.83 140-144 26.265 27.52 27.565 18.65 145-149 27.345000000000002 27.994999999999997 26.179999999999996 18.48 150-151 27.689417658108955 27.977457733249842 25.96117720726362 18.371947401377582 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 1.0 20 1.0 21 1.0 22 2.0 23 1.5 24 0.5 25 2.0 26 2.0 27 4.0 28 7.0 29 7.0 30 13.0 31 20.0 32 25.0 33 40.5 34 54.0 35 63.5 36 78.5 37 101.5 38 124.0 39 163.5 40 200.5 41 204.5 42 240.0 43 283.5 44 287.0 45 279.5 46 265.5 47 256.0 48 254.5 49 223.5 50 182.0 51 150.5 52 115.0 53 83.5 54 64.5 55 54.5 56 42.5 57 31.0 58 20.5 59 12.5 60 10.0 61 6.0 62 3.0 63 4.0 64 2.5 65 1.5 66 1.5 67 2.0 68 2.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.075 4 0.075 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.015 25-29 0.0 30-34 0.015 35-39 0.08499999999999999 40-44 0.045 45-49 0.015 50-54 0.045 55-59 0.015 60-64 0.0 65-69 0.0 70-74 1.195 75-79 3.95 80-84 1.265 85-89 0.015 90-94 0.0 95-99 0.0 100-104 0.05 105-109 3.44 110-114 6.995 115-119 10.115 120-124 7.435 125-129 5.415 130-134 0.27 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.1875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42152917505031 98.825 2 0.5533199195171026 1.0999999999999999 3 0.025150905432595575 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.21250000000000002 0.0 0.0 0.0 0.0 72-73 0.275 0.0 0.0 0.0 0.0 74-75 0.35 0.0 0.0 0.0 0.0 76-77 0.3875 0.0 0.0 0.0 0.0 78-79 0.4625 0.0 0.0 0.0 0.0 80-81 0.575 0.0 0.0 0.0 0.0 82-83 0.675 0.0 0.0 0.0 0.0 84-85 0.7625 0.0 0.0 0.0 0.0 86-87 0.875 0.0 0.0 0.0 0.0 88-89 1.0625 0.0 0.0 0.0 0.0 90-91 1.275 0.0 0.0 0.0 0.0 92-93 1.55 0.0 0.0 0.0 0.0 94-95 1.8875 0.0 0.0 0.0 0.0 96-97 2.25 0.0 0.0 0.0 0.0 98-99 2.5375 0.0 0.0 0.0 0.0 100-101 2.7375 0.0 0.0 0.0 0.0 102-103 3.1125 0.0 0.0 0.0 0.0 104-105 3.45 0.0 0.0 0.0 0.0 106-107 3.925 0.0 0.0 0.0 0.0 108-109 4.324999999999999 0.0 0.0 0.0 0.0 110-111 4.675 0.0 0.0 0.0 0.0 112-113 5.300000000000001 0.0 0.0 0.0 0.0 114-115 5.775 0.0 0.0 0.0 0.0 116-117 6.25 0.0 0.0 0.0 0.0 118-119 6.7 0.0 0.0 0.0 0.0 120-121 7.175 0.0 0.0 0.0 0.0 122-123 7.8374999999999995 0.0 0.0 0.0 0.0 124-125 8.75 0.0 0.0 0.0 0.0 126-127 9.4875 0.0 0.0 0.0 0.0 128-129 10.1875 0.0 0.0 0.0 0.0 130-131 10.85 0.0 0.0 0.0 0.0 132-133 11.662500000000001 0.0 0.0 0.0 0.0 134-135 12.3375 0.0 0.0 0.0 0.0 136-137 13.0875 0.0 0.0 0.0 0.0 138-139 13.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGATCTA 10 0.007290621 141.875 4 GTGTAGG 60 0.0051913233 14.187501 135-139 >>END_MODULE Read 788698 spots for SRR7169739.sra Written 788698 spots for SRR7169739.sra Read 788698 spots for SRR7169739.sra Written 788698 spots for SRR7169739.sra Read 788698 spots for SRR7169739.sra Written 788698 spots for SRR7169739.sra Read 788698 spots for SRR7169739.sra Written 788698 spots for SRR7169739.sra Read 788698 spots for SRR7169739.sra Written 788698 spots for SRR7169739.sra Read 788698 spots for SRR7169739.sra Written 788698 spots for SRR7169739.sra Read 788698 spots for SRR7169739.sra Written 788698 spots for SRR7169739.sra Read 788698 spots for SRR7169739.sra Written 788698 spots for SRR7169739.sra Read 788698 spots for SRR7169739.sra Written 788698 spots for SRR7169739.sra Read 788698 spots for SRR7169739.sra Written 788698 spots for SRR7169739.sra Read 788698 spots for SRR7169739.sra Written 788698 spots for SRR7169739.sra Read 788698 spots for SRR7169739.sra Written 788698 spots for SRR7169739.sra Read 788698 spots for SRR7169739.sra Written 788698 spots for SRR7169739.sra Read 788698 spots for SRR7169739.sra Written 788698 spots for SRR7169739.sra Read 788698 spots for SRR7169739.sra Written 788698 spots for SRR7169739.sra Read 788716 spots for SRR7169739.sra Written 788716 spots for SRR7169739.sra Read 788698 spots for SRR7169739.sra Written 788698 spots for SRR7169739.sra Read 788698 spots for SRR7169739.sra Written 788698 spots for SRR7169739.sra Read 788698 spots for SRR7169739.sra Written 788698 spots for SRR7169739.sra Read 788698 spots for SRR7169739.sra Written 788698 spots for SRR7169739.sra SRR ids: ['SRR7169739.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_y4gyah7y SRR7169739.sra spots: 15773978 blocks: [[1, 788698], [788699, 1577396], [1577397, 2366094], [2366095, 3154792], [3154793, 3943490], [3943491, 4732188], [4732189, 5520886], [5520887, 6309584], [6309585, 7098282], [7098283, 7886980], [7886981, 8675678], [8675679, 9464376], [9464377, 10253074], [10253075, 11041772], [11041773, 11830470], [11830471, 12619168], [12619169, 13407866], [13407867, 14196564], [14196565, 14985262], [14985263, 15773978]] SRR7169739 file size 5323583 SRR7169739 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169739 SRR7169739_1.fastq SRR7169739_2.fastq Input file: SRR7169739_1.fastq Paired file: SRR7169739_2.fastq trimmed: SRR7169739-trimmed-pair1.fastq, SRR7169739-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 12:19:28 2025 >> started Tue Feb 11 12:19:46 2025 >> done (18.034s) 15773978 read pairs processed; of these: 11252 ( 0.07%) short read pairs filtered out after trimming by size control 11346 ( 0.07%) empty read pairs filtered out after trimming by size control 15751380 (99.86%) read pairs available; of these: 7442787 (47.25%) trimmed read pairs available after processing 8308593 (52.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 4 0.00% 21 3 0.00% 22 4 0.00% 23 4 0.00% 24 4 0.00% 25 6 0.00% 26 3 0.00% 27 7 0.00% 28 7 0.00% 29 5 0.00% 30 7 0.00% 31 9 0.00% 32 8 0.00% 33 9 0.00% 34 15 0.00% 35 20 0.00% 36 21 0.00% 37 18 0.00% 38 26 0.00% 39 50 0.00% 40 47 0.00% 41 69 0.00% 42 58 0.00% 43 70 0.00% 44 55 0.00% 45 95 0.00% 46 84 0.00% 47 120 0.00% 48 143 0.00% 49 166 0.00% 50 233 0.00% 51 238 0.00% 52 296 0.00% 53 310 0.00% 54 344 0.00% 55 370 0.00% 56 473 0.00% 57 509 0.00% 58 624 0.00% 59 734 0.00% 60 837 0.01% 61 977 0.01% 62 1177 0.01% 63 1363 0.01% 64 1424 0.01% 65 1555 0.01% 66 1757 0.01% 67 1940 0.01% 68 2162 0.01% 69 2615 0.02% 70 3047 0.02% 71 3541 0.02% 72 4192 0.03% 73 4676 0.03% 74 5154 0.03% 75 5570 0.04% 76 6212 0.04% 77 6448 0.04% 78 6975 0.04% 79 7664 0.05% 80 8658 0.05% 81 9944 0.06% 82 11261 0.07% 83 12333 0.08% 84 14092 0.09% 85 14976 0.10% 86 15297 0.10% 87 16264 0.10% 88 17204 0.11% 89 17676 0.11% 90 19081 0.12% 91 20266 0.13% 92 22054 0.14% 93 24473 0.16% 94 25626 0.16% 95 26697 0.17% 96 27538 0.17% 97 27973 0.18% 98 28644 0.18% 99 29060 0.18% 100 30050 0.19% 101 31589 0.20% 102 33849 0.21% 103 36056 0.23% 104 37334 0.24% 105 39190 0.25% 106 39879 0.25% 107 39863 0.25% 108 40362 0.26% 109 40653 0.26% 110 41311 0.26% 111 43134 0.27% 112 44599 0.28% 113 46228 0.29% 114 48542 0.31% 115 50998 0.32% 116 51305 0.33% 117 52032 0.33% 118 52084 0.33% 119 51658 0.33% 120 52692 0.33% 121 53557 0.34% 122 55177 0.35% 123 57102 0.36% 124 59621 0.38% 125 61642 0.39% 126 64743 0.41% 127 65104 0.41% 128 65651 0.42% 129 65698 0.42% 130 65784 0.42% 131 66136 0.42% 132 68008 0.43% 133 69823 0.44% 134 71316 0.45% 135 74284 0.47% 136 76846 0.49% 137 79353 0.50% 138 82212 0.52% 139 83565 0.53% 140 86634 0.55% 141 90455 0.57% 142 94794 0.60% 143 100643 0.64% 144 113308 0.72% 145 130374 0.83% 146 145927 0.93% 147 186785 1.19% 148 263220 1.67% 149 488965 3.10% 150 3088975 19.61% 151 8308593 52.75% 15751380 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.55 fanout-score-rank=33 prefix-density=0.27 prefix-fanout=2.3 sequence=CTGGCCATTCAATGTGACATCCTCTTGAGTGGCTTTCAAAAGCCTGATAAAAACGCTGAACTGACCACCTTTTTCTAGGACTTTGGTGACATTGGTTGGACCGGGTGGTGCTGGGGCTGCAGCTGGTGACTGAGCTAGGGTTGGAGGGCAATGAAGAAGGAAGAATAGAATAAAAGAAGCTGAGAACAGAAATTGTGGCACCATTTTAGTGGTTTTTGGATGAGGTGGGCTATATTGCTGCTACTAGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=43 fanout-score=187.30 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=15.1 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=39 prefix-density=0.23 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.15 sequence-density-rank=8 fanout-score=39.99 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=11.5 sequence=TGTTGGTGGTGG SRR7169739 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 12:20:29 Started mapping on | Feb 11 12:20:30 Finished on | Feb 11 12:21:52 Mapping speed, Million of reads per hour | 691.52 Number of input reads | 15751380 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 15089953 Uniquely mapped reads % | 95.80% Average mapped length | 288.10 Number of splices: Total | 13411471 Number of splices: Annotated (sjdb) | 13176599 Number of splices: GT/AG | 13212598 Number of splices: GC/AG | 152108 Number of splices: AT/AC | 12742 Number of splices: Non-canonical | 34023 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 264960 % of reads mapped to multiple loci | 1.68% Number of reads mapped to too many loci | 89067 % of reads mapped to too many loci | 0.57% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.85% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 405820 405820 405820 N_multimapping 264960 264960 264960 N_noFeature 416355 14903253 491921 N_ambiguous 166492 846 54824 UnstrandedReadsAssigned:14507106 PositiveStrandReadsAssigned:185854 NegativeStrandReadsAssigned:14543208 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7169739 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169739-trimmed-pair1.fastq SRR7169739-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,751,380 reads, 14,486,084 reads pseudoaligned [quant] estimated average fragment length: 204.876 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 987 rounds 52401 SRR7169739.ke.tsv 34699 SRR7169739.se.tsv 87100 total ==> SRR7169739.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1814.12 272 11.2633 Potri.005G024800.1.v4.1 1035 831.124 16 1.44617 Potri.004G059700.1.v4.1 961 757.137 6 0.595307 Potri.007G009000.2.v4.1 1416 1212.12 0 0 Potri.003G141000.2.v4.1 2943 2739.12 242.063 6.63867 Potri.016G087400.1.v4.1 270 97.6259 1294 995.712 Potri.015G069301.1.v4.1 564 361.649 0 0 Potri.010G195200.1.v4.1 1773 1569.12 15 0.718122 Potri.012G127500.1.v4.1 977 773.131 3971 385.844 ==> SRR7169739.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1394 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 211 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169739 completed mapping pipeline successfully