Starting /dee2/code/volunteer_pipeline.sh SRR7169740 current disk space = 3050667687936 free memory = 1578790880 SRR7169740 SRAfilesize 6e627cecd97dfad267d1efe60c619982 SRR7169740.sra SRR7169740.sra file validated SRR7169740 is paired end SRR7169740 is conventional basespace SRR7169740 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169740_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.5235 18.0 18.0 18.0 18.0 28.0 2 27.353 27.0 27.0 28.0 25.0 30.0 3 28.708 29.0 27.0 31.0 25.0 33.0 4 31.67325 33.0 31.0 33.0 29.0 33.0 5 32.49225 33.0 33.0 33.0 32.0 33.0 6 36.308 38.0 36.0 38.0 34.0 38.0 7 37.02025 38.0 37.0 38.0 35.0 38.0 8 37.38825 38.0 38.0 38.0 36.0 38.0 9 37.55925 38.0 38.0 38.0 37.0 38.0 10-14 37.61129999999999 38.0 38.0 38.0 37.2 38.0 15-19 37.5881 38.0 38.0 38.0 37.4 38.0 20-24 37.643600000000006 38.0 38.0 38.0 38.0 38.0 25-29 37.5832 38.0 38.0 38.0 37.6 38.0 30-34 37.56505 38.0 38.0 38.0 37.8 38.0 35-39 37.455650000000006 38.0 38.0 38.0 37.2 38.0 40-44 37.41865 38.0 38.0 38.0 37.0 38.0 45-49 37.3918 38.0 38.0 38.0 37.0 38.0 50-54 37.437200000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.39245 38.0 38.0 38.0 37.0 38.0 60-64 37.29025 38.0 38.0 38.0 37.0 38.0 65-69 36.99575 38.0 38.0 38.0 35.6 38.0 70-74 37.13955 38.0 38.0 38.0 36.0 38.0 75-79 36.4788 38.0 37.4 38.0 33.2 38.0 80-84 36.97175 38.0 38.0 38.0 35.6 38.0 85-89 36.8628 38.0 38.0 38.0 35.2 38.0 90-94 36.78395 38.0 38.0 38.0 35.0 38.0 95-99 36.826 38.0 38.0 38.0 35.0 38.0 100-104 36.7621 38.0 38.0 38.0 35.0 38.0 105-109 36.5607 38.0 38.0 38.0 34.2 38.0 110-114 36.067 38.0 37.0 38.0 32.4 38.0 115-119 34.986599999999996 38.0 35.4 38.0 27.0 38.0 120-124 36.0551 38.0 36.8 38.0 33.2 38.0 125-129 35.7817 38.0 36.2 38.0 31.8 38.0 130-134 35.4049 38.0 35.6 38.0 30.4 38.0 135-139 35.134049999999995 38.0 35.4 38.0 29.4 38.0 140-144 33.9601 38.0 34.2 38.0 23.0 38.0 145-149 34.161950000000004 38.0 34.8 38.0 26.2 38.0 150-151 29.834125 36.0 28.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 2.0 12 0.0 13 2.0 14 1.0 15 0.0 16 0.0 17 2.0 18 1.0 19 3.0 20 0.0 21 4.0 22 2.0 23 1.0 24 2.0 25 7.0 26 8.0 27 11.0 28 14.0 29 31.0 30 34.0 31 47.0 32 69.0 33 109.0 34 177.0 35 373.0 36 1231.0 37 1869.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 12.247983870967742 51.68850806451613 7.963709677419355 28.099798387096776 2 24.4 14.399999999999999 33.275 27.925 3 19.7 19.825 25.45 35.025 4 23.7 27.025 22.2 27.075 5 21.625 34.25 23.1 21.025 6 18.825 35.825 24.875 20.474999999999998 7 14.625 25.174999999999997 41.6 18.6 8 17.974999999999998 25.5 30.975 25.55 9 16.925 24.275 33.625 25.174999999999997 10-14 20.369999999999997 30.53 26.265 22.835 15-19 20.415 28.910000000000004 27.325 23.35 20-24 19.994999999999997 29.99 27.41 22.605 25-29 19.855 29.970000000000002 27.29 22.884999999999998 30-34 19.835 29.035 27.195000000000004 23.935000000000002 35-39 20.57 29.03 27.185 23.215 40-44 19.71 29.145 27.665 23.48 45-49 20.39 28.585 27.77 23.255 50-54 20.62 29.03 27.195000000000004 23.155 55-59 20.055 29.325000000000003 26.900000000000002 23.72 60-64 20.43 28.715000000000003 27.284999999999997 23.57 65-69 20.03 28.88 27.37 23.72 70-74 21.565 28.53 27.01 22.895 75-79 20.875 29.065 27.13 22.93 80-84 20.485 29.17 26.97 23.375 85-89 20.65 29.49 26.52 23.34 90-94 20.945 28.999999999999996 26.88 23.175 95-99 20.225 29.185 27.0 23.59 100-104 20.674999999999997 28.675 27.139999999999997 23.51 105-109 20.91 29.075 26.705000000000002 23.31 110-114 21.02 29.360000000000003 26.235000000000003 23.385 115-119 20.794999999999998 28.985 26.729999999999997 23.49 120-124 20.358053708056207 29.844476671500725 26.278941841276193 23.518527779166874 125-129 20.965 29.035 26.490000000000002 23.51 130-134 21.17 29.39 25.974999999999998 23.465 135-139 21.095 28.449999999999996 26.455000000000002 24.0 140-144 20.935000000000002 28.65 26.645000000000003 23.77 145-149 20.724999999999998 28.549999999999997 26.915 23.810000000000002 150-151 19.55 29.2 26.6125 24.637500000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 2.0 24 3.0 25 5.0 26 6.0 27 10.0 28 11.5 29 16.0 30 25.5 31 27.0 32 30.0 33 40.0 34 58.0 35 77.0 36 90.0 37 103.5 38 125.5 39 173.0 40 212.0 41 234.0 42 244.5 43 250.0 44 280.5 45 275.0 46 264.0 47 251.5 48 220.5 49 203.0 50 180.5 51 158.5 52 117.0 53 76.0 54 61.5 55 53.5 56 35.5 57 19.5 58 16.5 59 13.5 60 8.5 61 6.5 62 3.5 63 1.5 64 1.5 65 1.0 66 0.5 67 0.5 68 1.5 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.015 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54785229841748 99.075 2 0.42702838482793265 0.8500000000000001 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.36250000000000004 0.0 0.0 0.0 0.0 88-89 0.45 0.0 0.0 0.0 0.0 90-91 0.5375 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.9125 0.0 0.0 0.0 0.0 98-99 1.125 0.0 0.0 0.0 0.0 100-101 1.3375 0.0 0.0 0.0 0.0 102-103 1.5875 0.0 0.0 0.0 0.0 104-105 1.8125 0.0 0.0 0.0 0.0 106-107 2.1375 0.0 0.0 0.0 0.0 108-109 2.35 0.0 0.0 0.0 0.0 110-111 2.8375000000000004 0.0 0.0 0.0 0.0 112-113 3.275 0.0 0.0 0.0 0.0 114-115 3.6125 0.0 0.0 0.0 0.0 116-117 4.0375 0.0 0.0 0.0 0.0 118-119 4.4625 0.0 0.0 0.0 0.0 120-121 4.9125 0.0 0.0 0.0 0.0 122-123 5.324999999999999 0.0 0.0 0.0 0.0 124-125 5.8375 0.0 0.0 0.0 0.0 126-127 6.2875 0.0 0.0 0.0 0.0 128-129 6.85 0.0 0.0 0.0 0.0 130-131 7.225 0.0 0.0 0.0 0.0 132-133 7.75 0.0 0.0 0.0 0.0 134-135 8.4125 0.0 0.0 0.0 0.0 136-137 9.0 0.0 0.0 0.0 0.0 138-139 9.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTTCAA 10 0.006832588 144.9875 8 >>END_MODULE SRR7169740 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169740_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.01125 33.0 33.0 34.0 32.0 34.0 2 33.1935 34.0 33.0 34.0 33.0 34.0 3 33.1735 34.0 33.0 34.0 33.0 34.0 4 33.1425 34.0 33.0 34.0 33.0 34.0 5 33.1665 34.0 33.0 34.0 33.0 34.0 6 37.43125 38.0 38.0 38.0 38.0 38.0 7 37.48875 38.0 38.0 38.0 38.0 38.0 8 37.5075 38.0 38.0 38.0 38.0 38.0 9 37.38775 38.0 38.0 38.0 37.0 38.0 10-14 37.41930000000001 38.0 38.0 38.0 37.6 38.0 15-19 36.815200000000004 38.0 37.8 38.0 35.0 38.0 20-24 37.29105 38.0 38.0 38.0 37.2 38.0 25-29 36.0392 38.0 37.2 38.0 31.2 38.0 30-34 37.254650000000005 38.0 38.0 38.0 36.8 38.0 35-39 37.38 38.0 38.0 38.0 37.0 38.0 40-44 37.314499999999995 38.0 38.0 38.0 37.0 38.0 45-49 37.16525 38.0 38.0 38.0 36.6 38.0 50-54 37.1772 38.0 38.0 38.0 36.8 38.0 55-59 37.10865 38.0 38.0 38.0 36.6 38.0 60-64 37.102700000000006 38.0 38.0 38.0 36.4 38.0 65-69 35.3007 38.0 35.6 38.0 28.0 38.0 70-74 35.8985 38.0 37.2 38.0 31.0 38.0 75-79 36.7681 38.0 38.0 38.0 35.8 38.0 80-84 36.4987 38.0 37.6 38.0 33.8 38.0 85-89 36.802550000000004 38.0 38.0 38.0 35.4 38.0 90-94 36.7872 38.0 38.0 38.0 35.6 38.0 95-99 36.72865 38.0 38.0 38.0 35.2 38.0 100-104 36.47025 38.0 38.0 38.0 34.2 38.0 105-109 35.46855 38.0 36.8 38.0 30.0 38.0 110-114 35.41275 38.0 37.0 38.0 30.6 38.0 115-119 34.10015 38.0 35.8 38.0 22.2 38.0 120-124 34.08775 38.0 35.6 38.0 23.4 38.0 125-129 34.20175 38.0 35.2 38.0 23.6 38.0 130-134 35.05749999999999 38.0 35.6 38.0 28.6 38.0 135-139 35.04260000000001 38.0 35.8 38.0 29.2 38.0 140-144 34.6849 38.0 34.8 38.0 28.0 38.0 145-149 33.937 38.0 33.8 38.0 25.2 38.0 150-151 29.40925 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 2.0 4 0.0 5 1.0 6 0.0 7 1.0 8 0.0 9 0.0 10 1.0 11 3.0 12 2.0 13 0.0 14 2.0 15 5.0 16 0.0 17 1.0 18 1.0 19 3.0 20 6.0 21 4.0 22 8.0 23 11.0 24 12.0 25 9.0 26 13.0 27 21.0 28 21.0 29 39.0 30 77.0 31 60.0 32 107.0 33 123.0 34 181.0 35 347.0 36 806.0 37 2130.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.934483620905226 20.655163790947736 12.728182045511376 28.68217054263566 2 27.725 25.174999999999997 32.175 14.924999999999999 3 20.575 27.05 32.05 20.325 4 24.05 33.175 23.474999999999998 19.3 5 23.849999999999998 35.875 22.3 17.974999999999998 6 21.75 37.625 22.85 17.775 7 19.400000000000002 20.95 38.975 20.674999999999997 8 21.25 25.35 29.275000000000002 24.125 9 21.825 24.8 30.25 23.125 10-14 23.315 28.29 27.3 21.095 15-19 23.455000000000002 27.215 28.470000000000002 20.86 20-24 22.58 28.48 27.925 21.015 25-29 23.235 28.310000000000002 27.63 20.825 30-34 23.16 28.310000000000002 27.744999999999997 20.785 35-39 23.189999999999998 28.105000000000004 28.23 20.474999999999998 40-44 23.31 27.55 28.71 20.43 45-49 23.1 27.065 28.935 20.9 50-54 22.39 28.275 28.325 21.01 55-59 22.945 27.334999999999997 29.134999999999998 20.585 60-64 22.66 27.375 28.825 21.14 65-69 22.925 27.355 28.725 20.995 70-74 23.575 27.415 28.51 20.5 75-79 23.303405728043337 27.36118774138536 28.840848673320963 20.49455785725034 80-84 23.605 27.58 28.84 19.975 85-89 23.57 27.115000000000002 28.34 20.974999999999998 90-94 23.474999999999998 27.515 28.04 20.97 95-99 23.169999999999998 28.249999999999996 27.894999999999996 20.685000000000002 100-104 23.824780976220275 27.429286608260327 27.814768460575717 20.93116395494368 105-109 23.816701839011152 27.31886242588685 28.012260074364388 20.852175660737615 110-114 24.12057747051647 28.004270028466856 27.333265555103704 20.541886945912974 115-119 24.412900532303517 27.03788748564868 27.888529381066697 20.660682600981108 120-124 24.14812509724599 27.51413308438359 27.711218297806127 20.626523520564284 125-129 24.474167857872168 27.573003879926482 27.44026955278742 20.512558709413927 130-134 25.241551939924907 27.163954943679595 27.52941176470588 20.065081351689614 135-139 24.575 27.534999999999997 28.025 19.865 140-144 24.98 26.795 27.775 20.45 145-149 25.6 27.11 27.465 19.825 150-151 25.224999999999998 26.5125 28.237499999999997 20.025000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 1.0 23 1.0 24 0.0 25 1.0 26 2.5 27 3.0 28 6.0 29 7.5 30 12.0 31 15.5 32 24.0 33 36.0 34 47.5 35 71.5 36 92.0 37 102.0 38 130.5 39 167.0 40 208.0 41 245.5 42 258.5 43 286.5 44 299.0 45 287.5 46 288.5 47 268.5 48 229.5 49 191.5 50 151.5 51 129.0 52 113.0 53 80.5 54 63.0 55 49.5 56 31.5 57 25.5 58 19.0 59 12.5 60 8.0 61 6.5 62 6.0 63 7.5 64 4.0 65 0.5 66 1.5 67 2.0 68 1.0 69 1.5 70 2.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.315 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.125 105-109 0.49 110-114 1.6400000000000001 115-119 4.19 120-124 3.595 125-129 2.06 130-134 0.125 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29453262786596 98.52499999999999 2 0.6298815822625347 1.25 3 0.07558578987150416 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.425 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.8875 0.0 0.0 0.0 0.0 98-99 1.0750000000000002 0.0 0.0 0.0 0.0 100-101 1.275 0.0 0.0 0.0 0.0 102-103 1.5 0.0 0.0 0.0 0.0 104-105 1.7000000000000002 0.0 0.0 0.0 0.0 106-107 2.0 0.0 0.0 0.0 0.0 108-109 2.2 0.0 0.0 0.0 0.0 110-111 2.6624999999999996 0.0 0.0 0.0 0.0 112-113 3.0625 0.0 0.0 0.0 0.0 114-115 3.425 0.0 0.0 0.0 0.0 116-117 3.825 0.0 0.0 0.0 0.0 118-119 4.2375 0.0 0.0 0.0 0.0 120-121 4.6625 0.0 0.0 0.0 0.0 122-123 5.0875 0.0 0.0 0.0 0.0 124-125 5.612500000000001 0.0 0.0 0.0 0.0 126-127 6.0875 0.0 0.0 0.0 0.0 128-129 6.5875 0.0 0.0 0.0 0.0 130-131 6.95 0.0 0.0 0.0 0.0 132-133 7.45 0.0 0.0 0.0 0.0 134-135 8.1375 0.0 0.0 0.0 0.0 136-137 8.7875 0.0 0.0 0.0 0.0 138-139 9.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGGTGG 10 0.0070063258 143.775 9 >>END_MODULE Read 776434 spots for SRR7169740.sra Written 776434 spots for SRR7169740.sra Read 776434 spots for SRR7169740.sra Written 776434 spots for SRR7169740.sra Read 776434 spots for SRR7169740.sra Written 776434 spots for SRR7169740.sra Read 776434 spots for SRR7169740.sra Written 776434 spots for SRR7169740.sra Read 776434 spots for SRR7169740.sra Written 776434 spots for SRR7169740.sra Read 776434 spots for SRR7169740.sra Written 776434 spots for SRR7169740.sra Read 776434 spots for SRR7169740.sra Written 776434 spots for SRR7169740.sra Read 776434 spots for SRR7169740.sra Written 776434 spots for SRR7169740.sra Read 776434 spots for SRR7169740.sra Written 776434 spots for SRR7169740.sra Read 776434 spots for SRR7169740.sra Written 776434 spots for SRR7169740.sra Read 776434 spots for SRR7169740.sra Written 776434 spots for SRR7169740.sra Read 776434 spots for SRR7169740.sra Written 776434 spots for SRR7169740.sra Read 776434 spots for SRR7169740.sra Written 776434 spots for SRR7169740.sra Read 776446 spots for SRR7169740.sra Written 776446 spots for SRR7169740.sra Read 776434 spots for SRR7169740.sra Written 776434 spots for SRR7169740.sra Read 776434 spots for SRR7169740.sra Written 776434 spots for SRR7169740.sra Read 776434 spots for SRR7169740.sra Written 776434 spots for SRR7169740.sra Read 776434 spots for SRR7169740.sra Written 776434 spots for SRR7169740.sra Read 776434 spots for SRR7169740.sra Written 776434 spots for SRR7169740.sra Read 776434 spots for SRR7169740.sra Written 776434 spots for SRR7169740.sra SRR ids: ['SRR7169740.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_s641k6x_ SRR7169740.sra spots: 15528692 blocks: [[1, 776434], [776435, 1552868], [1552869, 2329302], [2329303, 3105736], [3105737, 3882170], [3882171, 4658604], [4658605, 5435038], [5435039, 6211472], [6211473, 6987906], [6987907, 7764340], [7764341, 8540774], [8540775, 9317208], [9317209, 10093642], [10093643, 10870076], [10870077, 11646510], [11646511, 12422944], [12422945, 13199378], [13199379, 13975812], [13975813, 14752246], [14752247, 15528692]] SRR7169740 file size 5240463 SRR7169740 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169740 SRR7169740_1.fastq SRR7169740_2.fastq Input file: SRR7169740_1.fastq Paired file: SRR7169740_2.fastq trimmed: SRR7169740-trimmed-pair1.fastq, SRR7169740-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 12:56:49 2025 >> started Tue Feb 11 12:57:06 2025 >> done (17.581s) 15528692 read pairs processed; of these: 5981 ( 0.04%) short read pairs filtered out after trimming by size control 5892 ( 0.04%) empty read pairs filtered out after trimming by size control 15516819 (99.92%) read pairs available; of these: 7518862 (48.46%) trimmed read pairs available after processing 7997957 (51.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 4 0.00% 21 2 0.00% 22 2 0.00% 23 3 0.00% 24 1 0.00% 25 2 0.00% 26 3 0.00% 27 3 0.00% 28 2 0.00% 29 8 0.00% 30 3 0.00% 31 8 0.00% 32 6 0.00% 33 6 0.00% 34 8 0.00% 35 10 0.00% 36 15 0.00% 37 13 0.00% 38 9 0.00% 39 13 0.00% 40 28 0.00% 41 25 0.00% 42 21 0.00% 43 27 0.00% 44 40 0.00% 45 44 0.00% 46 44 0.00% 47 51 0.00% 48 54 0.00% 49 69 0.00% 50 98 0.00% 51 89 0.00% 52 107 0.00% 53 114 0.00% 54 131 0.00% 55 166 0.00% 56 194 0.00% 57 180 0.00% 58 209 0.00% 59 253 0.00% 60 305 0.00% 61 358 0.00% 62 399 0.00% 63 459 0.00% 64 559 0.00% 65 597 0.00% 66 630 0.00% 67 743 0.00% 68 915 0.01% 69 925 0.01% 70 1132 0.01% 71 1340 0.01% 72 1544 0.01% 73 1694 0.01% 74 1937 0.01% 75 2243 0.01% 76 2410 0.02% 77 2647 0.02% 78 2909 0.02% 79 3322 0.02% 80 3708 0.02% 81 4199 0.03% 82 4703 0.03% 83 5364 0.03% 84 6136 0.04% 85 6970 0.04% 86 7681 0.05% 87 8370 0.05% 88 8877 0.06% 89 9464 0.06% 90 10446 0.07% 91 11110 0.07% 92 12181 0.08% 93 13201 0.09% 94 14321 0.09% 95 15293 0.10% 96 16607 0.11% 97 17341 0.11% 98 17952 0.12% 99 18871 0.12% 100 19880 0.13% 101 20696 0.13% 102 22149 0.14% 103 23098 0.15% 104 24954 0.16% 105 26327 0.17% 106 27430 0.18% 107 28470 0.18% 108 29013 0.19% 109 29878 0.19% 110 31464 0.20% 111 32372 0.21% 112 33982 0.22% 113 34775 0.22% 114 36843 0.24% 115 38264 0.25% 116 38920 0.25% 117 40869 0.26% 118 41715 0.27% 119 41980 0.27% 120 43021 0.28% 121 44373 0.29% 122 45846 0.30% 123 46834 0.30% 124 48778 0.31% 125 50537 0.33% 126 52459 0.34% 127 54580 0.35% 128 55274 0.36% 129 56364 0.36% 130 57379 0.37% 131 59267 0.38% 132 60144 0.39% 133 62281 0.40% 134 64426 0.42% 135 66206 0.43% 136 69939 0.45% 137 71978 0.46% 138 74854 0.48% 139 79148 0.51% 140 82775 0.53% 141 88382 0.57% 142 95892 0.62% 143 104913 0.68% 144 119050 0.77% 145 138184 0.89% 146 167872 1.08% 147 222360 1.43% 148 334386 2.15% 149 664645 4.28% 150 3471705 22.37% 151 7997957 51.54% 15516819 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.46 fanout-score-rank=35 prefix-density=0.27 prefix-fanout=2.3 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.10 sequence-density-rank=26 fanout-score=72.51 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=17.6 sequence=CAAAATCATAGCCCACTTAAAAAAACGAGAGCAATCCATGCAATAACCTCATCAAAACCTTCTGTGTCACAAAGAATATATTGCTGCAACCATGCAAACTCCAAAGAACACAACATTGTTCAGAACAGTAAAGCTTACTGCCCCAGAAGTATCCGCAGGAGATTCTGGACTCGCTGCAGCTTTGGATCTCTTCTTTGGCTTTTCAGGTGCTGGTGCTGGAGTAGGAGGTTTAGGTGTAAAGATATCAAGAGGAAGAAGCACCTTGTCAACCTGATAAACAGCTAACTGGTTATCAGTGTAGATAGTGCCGGATACGCTTGTATTTGTAAGCCCTGTAGTTATATTCACAGAGTTTCCTGTGGTGGTTACATTAAGCTCTAACCTGCCACCTGATCCTGCTTGTGTGGTCAGAGGGTTGCTCACAGTCTGGAACTGGGAACTTGATAGAAATTGTGGTATAATGTGAAACTGTACTAGCTCAGCCTTTTCTTGATCGCTTAGGGAGTTGAGG criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=33 prefix-density=0.27 prefix-fanout=2.3 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.16 sequence-density-rank=9 fanout-score=38.58 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=12.0 sequence=TGTTGGTGGTGGTACTGGA SRR7169740 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 12:57:47 Started mapping on | Feb 11 12:57:48 Finished on | Feb 11 12:59:00 Mapping speed, Million of reads per hour | 775.84 Number of input reads | 15516819 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 14881870 Uniquely mapped reads % | 95.91% Average mapped length | 291.58 Number of splices: Total | 13522002 Number of splices: Annotated (sjdb) | 13292866 Number of splices: GT/AG | 13337960 Number of splices: GC/AG | 145082 Number of splices: AT/AC | 11259 Number of splices: Non-canonical | 27701 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 256720 % of reads mapped to multiple loci | 1.65% Number of reads mapped to too many loci | 128257 % of reads mapped to too many loci | 0.83% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.48% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 385003 385003 385003 N_multimapping 256720 256720 256720 N_noFeature 381861 14665366 489210 N_ambiguous 166526 1122 56440 UnstrandedReadsAssigned:14333483 PositiveStrandReadsAssigned:215382 NegativeStrandReadsAssigned:14336220 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169740 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169740-trimmed-pair1.fastq SRR7169740-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,516,819 reads, 14,328,364 reads pseudoaligned [quant] estimated average fragment length: 219.135 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,157 rounds 52401 SRR7169740.ke.tsv 34699 SRR7169740.se.tsv 87100 total ==> SRR7169740.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1799.87 267 11.7798 Potri.005G024800.1.v4.1 1035 816.865 18 1.7498 Potri.004G059700.1.v4.1 961 742.877 1 0.106893 Potri.007G009000.2.v4.1 1416 1197.87 0 0 Potri.003G141000.2.v4.1 2943 2724.87 240.054 6.99568 Potri.016G087400.1.v4.1 270 89.8494 1132 1000.45 Potri.015G069301.1.v4.1 564 348.367 0 0 Potri.010G195200.1.v4.1 1773 1554.87 6 0.306425 Potri.012G127500.1.v4.1 977 758.865 1799 188.249 ==> SRR7169740.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1485 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 237 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 2 SRR7169740 completed mapping pipeline successfully