Starting /dee2/code/volunteer_pipeline.sh SRR7169741 current disk space = 3051084791808 free memory = 1156931456 SRR7169741 SRAfilesize 0dd2c9181923ddd695bbf1ca912253c9 SRR7169741.sra SRR7169741.sra file validated SRR7169741 is paired end SRR7169741 is conventional basespace SRR7169741 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169741_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.32775 18.0 18.0 18.0 18.0 28.0 2 26.817 27.0 27.0 28.0 25.0 30.0 3 28.1495 29.0 27.0 31.0 25.0 31.0 4 31.26625 31.0 31.0 33.0 29.0 33.0 5 32.343 33.0 32.0 33.0 32.0 33.0 6 36.269 37.0 36.0 38.0 34.0 38.0 7 37.0415 38.0 37.0 38.0 35.0 38.0 8 37.4755 38.0 38.0 38.0 37.0 38.0 9 37.6155 38.0 38.0 38.0 37.0 38.0 10-14 37.595499999999994 38.0 38.0 38.0 37.4 38.0 15-19 37.638000000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.72645 38.0 38.0 38.0 38.0 38.0 25-29 37.69199999999999 38.0 38.0 38.0 38.0 38.0 30-34 37.65095000000001 38.0 38.0 38.0 38.0 38.0 35-39 37.463550000000005 38.0 38.0 38.0 37.6 38.0 40-44 37.4673 38.0 38.0 38.0 37.6 38.0 45-49 37.4671 38.0 38.0 38.0 37.4 38.0 50-54 37.22815 38.0 38.0 38.0 36.4 38.0 55-59 37.41915 38.0 38.0 38.0 37.0 38.0 60-64 37.41545 38.0 38.0 38.0 37.0 38.0 65-69 37.0711 38.0 38.0 38.0 36.0 38.0 70-74 37.27085 38.0 38.0 38.0 36.6 38.0 75-79 37.18435 38.0 38.0 38.0 36.0 38.0 80-84 37.03025 38.0 38.0 38.0 35.8 38.0 85-89 36.863299999999995 38.0 38.0 38.0 35.4 38.0 90-94 36.87285 38.0 38.0 38.0 35.2 38.0 95-99 36.86535 38.0 38.0 38.0 35.4 38.0 100-104 36.71195 38.0 38.0 38.0 35.0 38.0 105-109 36.59335 38.0 38.0 38.0 34.6 38.0 110-114 36.19015 38.0 37.8 38.0 33.8 38.0 115-119 35.7194 38.0 36.4 38.0 30.6 38.0 120-124 36.30030000000001 38.0 37.2 38.0 34.0 38.0 125-129 35.2112 38.0 35.4 38.0 27.6 38.0 130-134 35.1918 38.0 35.4 38.0 27.6 38.0 135-139 35.533100000000005 38.0 36.0 38.0 31.4 38.0 140-144 35.03835 38.0 35.2 38.0 29.2 38.0 145-149 34.5865 38.0 35.0 38.0 27.8 38.0 150-151 30.657625 36.5 29.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 4.0 17 1.0 18 4.0 19 2.0 20 1.0 21 3.0 22 2.0 23 3.0 24 4.0 25 5.0 26 5.0 27 9.0 28 17.0 29 16.0 30 27.0 31 43.0 32 64.0 33 101.0 34 168.0 35 340.0 36 1030.0 37 2149.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 13.8184584178499 47.33772819472616 8.291075050709939 30.552738336713997 2 21.375 15.2 34.975 28.449999999999996 3 20.25 20.075000000000003 25.85 33.825 4 22.45 28.675 23.425 25.45 5 22.5 32.475 25.474999999999998 19.55 6 19.3 35.25 24.775 20.674999999999997 7 14.725 27.35 39.4 18.525 8 17.5 25.3 32.074999999999996 25.124999999999996 9 17.849999999999998 24.0 33.725 24.425 10-14 20.395 29.439999999999998 26.71 23.455000000000002 15-19 20.005 28.425 27.384999999999998 24.185000000000002 20-24 20.435 28.945 27.439999999999998 23.18 25-29 20.505000000000003 29.110000000000003 27.134999999999998 23.25 30-34 19.98 29.525000000000002 27.395000000000003 23.1 35-39 20.369999999999997 28.735 27.450000000000003 23.445 40-44 20.294999999999998 28.58 27.189999999999998 23.935000000000002 45-49 20.29 28.560000000000002 26.810000000000002 24.34 50-54 20.115 28.4 27.405 24.08 55-59 19.895 29.005 27.21 23.89 60-64 20.335 28.09 27.47 24.104999999999997 65-69 20.415 28.17 27.88 23.535 70-74 20.415 28.525 27.250000000000004 23.810000000000002 75-79 20.424999999999997 28.005000000000003 27.189999999999998 24.38 80-84 20.205000000000002 28.470000000000002 27.24 24.085 85-89 20.035 28.294999999999998 27.915 23.755000000000003 90-94 20.76 28.865000000000002 27.11 23.265 95-99 20.71 28.315 27.339999999999996 23.635 100-104 21.425 28.235 26.96 23.380000000000003 105-109 20.575 28.32 27.185 23.919999999999998 110-114 21.074088987316287 28.029997986712303 27.491443527280047 23.404469498691363 115-119 21.560000000000002 29.044999999999998 26.51 22.884999999999998 120-124 21.25 28.560000000000002 26.55 23.64 125-129 21.584999999999997 27.255000000000003 27.400000000000002 23.76 130-134 20.575 28.444999999999997 26.634999999999998 24.345 135-139 21.075 28.155 26.41 24.36 140-144 21.185000000000002 28.17 27.105 23.54 145-149 21.545 28.49 26.445 23.52 150-151 22.0625 27.6625 26.75 23.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 1.5 24 2.0 25 2.5 26 4.5 27 6.5 28 6.5 29 9.5 30 13.0 31 23.0 32 34.5 33 44.5 34 57.0 35 76.5 36 92.0 37 107.0 38 130.5 39 165.0 40 210.5 41 234.0 42 241.5 43 264.0 44 283.5 45 274.0 46 258.0 47 244.5 48 223.5 49 193.5 50 159.5 51 135.5 52 114.0 53 93.5 54 71.5 55 48.5 56 34.0 57 29.5 58 25.0 59 19.0 60 17.0 61 11.5 62 7.5 63 5.5 64 6.0 65 5.0 66 3.0 67 2.0 68 1.0 69 1.0 70 2.0 71 1.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4000000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.66 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.38749999999999996 0.0 0.0 0.0 0.0 86-87 0.6125 0.0 0.0 0.0 0.0 88-89 0.75 0.0 0.0 0.0 0.0 90-91 0.8500000000000001 0.0 0.0 0.0 0.0 92-93 1.075 0.0 0.0 0.0 0.0 94-95 1.2625000000000002 0.0 0.0 0.0 0.0 96-97 1.35 0.0 0.0 0.0 0.0 98-99 1.625 0.0 0.0 0.0 0.0 100-101 1.8875000000000002 0.0 0.0 0.0 0.0 102-103 2.125 0.0 0.0 0.0 0.0 104-105 2.3875 0.0 0.0 0.0 0.0 106-107 2.7125000000000004 0.0 0.0 0.0 0.0 108-109 3.0875 0.0 0.0 0.0 0.0 110-111 3.4875 0.0125 0.0 0.0 0.0 112-113 4.05 0.025 0.0 0.0 0.0 114-115 4.387499999999999 0.025 0.0 0.0 0.0 116-117 4.725 0.025 0.0 0.0 0.0 118-119 5.2875 0.025 0.0 0.0 0.0 120-121 5.725 0.025 0.0 0.0 0.0 122-123 6.449999999999999 0.025 0.0 0.0 0.0 124-125 6.925 0.025 0.0 0.0 0.0 126-127 7.6625 0.025 0.0 0.0 0.0 128-129 8.2625 0.025 0.0 0.0 0.0 130-131 8.95 0.025 0.0 0.0 0.0 132-133 9.6375 0.025 0.0 0.0 0.0 134-135 10.2875 0.025 0.0 0.0 0.0 136-137 10.975000000000001 0.025 0.0 0.0 0.0 138-139 11.75 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACACAG 10 0.006846698 144.88751 8 CATACAA 10 0.006846698 144.88751 3 >>END_MODULE SRR7169741 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169741_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82825 33.0 33.0 34.0 32.0 34.0 2 32.989 33.0 33.0 34.0 32.0 34.0 3 32.03075 33.0 33.0 34.0 28.0 34.0 4 32.34225 33.0 33.0 34.0 31.0 34.0 5 32.94625 33.0 33.0 34.0 32.0 34.0 6 37.30075 38.0 38.0 38.0 37.0 38.0 7 37.435 38.0 38.0 38.0 37.0 38.0 8 37.4065 38.0 38.0 38.0 38.0 38.0 9 37.39225 38.0 38.0 38.0 38.0 38.0 10-14 37.36749999999999 38.0 38.0 38.0 37.8 38.0 15-19 37.37585 38.0 38.0 38.0 38.0 38.0 20-24 36.88365 38.0 37.8 38.0 35.4 38.0 25-29 37.357150000000004 38.0 38.0 38.0 37.6 38.0 30-34 37.363550000000004 38.0 38.0 38.0 37.8 38.0 35-39 37.370250000000006 38.0 38.0 38.0 38.0 38.0 40-44 37.29834999999999 38.0 38.0 38.0 37.0 38.0 45-49 37.33305 38.0 38.0 38.0 37.4 38.0 50-54 37.31295000000001 38.0 38.0 38.0 37.2 38.0 55-59 37.2041 38.0 38.0 38.0 37.0 38.0 60-64 37.12825 38.0 38.0 38.0 36.6 38.0 65-69 37.0423 38.0 38.0 38.0 36.2 38.0 70-74 36.98175 38.0 38.0 38.0 36.0 38.0 75-79 36.4981 38.0 38.0 38.0 35.8 38.0 80-84 36.19835 38.0 37.4 38.0 33.4 38.0 85-89 36.69785 38.0 38.0 38.0 35.2 38.0 90-94 36.89555 38.0 38.0 38.0 36.0 38.0 95-99 36.789550000000006 38.0 38.0 38.0 35.4 38.0 100-104 36.55625 38.0 38.0 38.0 34.8 38.0 105-109 35.08605 38.0 36.6 38.0 27.8 38.0 110-114 34.55159999999999 38.0 37.0 38.0 26.4 38.0 115-119 33.9116 38.0 36.8 38.0 19.8 38.0 120-124 33.717099999999995 38.0 36.0 38.0 18.0 38.0 125-129 33.92805 38.0 36.0 38.0 20.2 38.0 130-134 34.752300000000005 38.0 36.0 38.0 26.0 38.0 135-139 34.967650000000006 38.0 36.0 38.0 29.2 38.0 140-144 34.9156 38.0 36.0 38.0 30.2 38.0 145-149 34.23335 38.0 34.0 38.0 28.0 38.0 150-151 29.7895 35.5 27.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 1.0 4 3.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 2.0 13 3.0 14 2.0 15 1.0 16 3.0 17 3.0 18 3.0 19 4.0 20 6.0 21 6.0 22 12.0 23 11.0 24 13.0 25 12.0 26 14.0 27 13.0 28 22.0 29 53.0 30 79.0 31 72.0 32 100.0 33 121.0 34 130.0 35 247.0 36 611.0 37 2445.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.975 19.575 15.0 30.45 2 25.25 25.874999999999996 31.2 17.675 3 21.075 27.55 30.3 21.075 4 23.425 34.525 22.650000000000002 19.400000000000002 5 24.6 36.449999999999996 22.1 16.85 6 19.8 38.7 23.075000000000003 18.425 7 20.125 20.575 39.125 20.175 8 22.575 24.6 28.325 24.5 9 23.275000000000002 24.3 28.675 23.75 10-14 24.05 28.860000000000003 26.31 20.78 15-19 23.65 27.805000000000003 27.43 21.115000000000002 20-24 23.105 28.199999999999996 27.57 21.125 25-29 23.69 27.365000000000002 27.694999999999997 21.25 30-34 22.919999999999998 28.499999999999996 27.82 20.76 35-39 23.135 28.849999999999998 27.245 20.77 40-44 23.455000000000002 27.639999999999997 27.735 21.17 45-49 23.345 28.194999999999997 27.51 20.95 50-54 23.405 27.47 27.985 21.14 55-59 23.635 27.29 28.199999999999996 20.875 60-64 23.775 27.27 28.075 20.880000000000003 65-69 23.26 27.93 28.345 20.465 70-74 23.805 27.485 27.655 21.055 75-79 23.51540332387515 28.136400486420754 27.903323875152008 20.444872314552086 80-84 23.497735279315553 28.06240563663815 27.976849521892298 20.463009562154 85-89 24.060000000000002 27.560000000000002 27.515 20.865000000000002 90-94 23.625 27.83 28.084999999999997 20.46 95-99 24.19 27.67 27.505000000000003 20.635 100-104 23.82286715036277 27.440580435326495 27.820865649236925 20.915686765073804 105-109 24.174879959565327 27.495577457669953 27.985847864543846 20.343694718220874 110-114 24.01298565294795 28.05529374803644 27.673054770133 20.258665828882606 115-119 24.487282463186077 28.19277108433735 26.832663989290495 20.487282463186077 120-124 24.37977099236641 27.666454622561492 27.157548770144192 20.796225614927906 125-129 25.2051024188853 27.862171174509076 26.459535277616048 20.473191128989573 130-134 25.42604990870359 27.784540474741327 27.023737066342058 19.765672550213026 135-139 25.064999999999998 27.365000000000002 27.089999999999996 20.48 140-144 25.6 27.339999999999996 27.24 19.82 145-149 26.145000000000003 27.345000000000002 26.825 19.685 150-151 26.8625 27.525 26.275 19.3375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.5 27 3.0 28 3.0 29 3.5 30 10.5 31 16.5 32 20.0 33 30.0 34 41.0 35 60.0 36 82.0 37 93.5 38 134.5 39 172.0 40 186.0 41 239.0 42 281.5 43 275.0 44 271.5 45 285.5 46 285.0 47 263.5 48 232.5 49 204.5 50 171.0 51 129.5 52 111.5 53 97.5 54 71.0 55 52.5 56 39.0 57 30.5 58 24.0 59 21.5 60 14.5 61 6.5 62 5.5 63 5.0 64 5.5 65 3.5 66 3.0 67 3.0 68 3.0 69 2.5 70 1.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 1.32 80-84 0.65 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.075 105-109 1.075 110-114 4.51 115-119 6.625 120-124 5.680000000000001 125-129 5.535 130-134 1.4200000000000002 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.38749999999999996 0.0 0.0 0.0 0.0 86-87 0.6125 0.0 0.0 0.0 0.0 88-89 0.75 0.0 0.0 0.0 0.0 90-91 0.8500000000000001 0.0 0.0 0.0 0.0 92-93 1.075 0.0 0.0 0.0 0.0 94-95 1.2625000000000002 0.0 0.0 0.0 0.0 96-97 1.35 0.0 0.0 0.0 0.0 98-99 1.625 0.0 0.0 0.0 0.0 100-101 1.8875000000000002 0.0 0.0 0.0 0.0 102-103 2.1125 0.0 0.0 0.0 0.0 104-105 2.3625 0.0 0.0 0.0 0.0 106-107 2.675 0.0 0.0 0.0 0.0 108-109 3.0125 0.0 0.0 0.0 0.0 110-111 3.3875 0.0 0.0 0.0 0.0 112-113 3.8875 0.0 0.0 0.0 0.0 114-115 4.1875 0.0 0.0 0.0 0.0 116-117 4.487500000000001 0.0 0.0 0.0 0.0 118-119 4.9125 0.0 0.0 0.0 0.0 120-121 5.3 0.0 0.0 0.0 0.0 122-123 5.949999999999999 0.0 0.0 0.0 0.0 124-125 6.35 0.0 0.0 0.0 0.0 126-127 7.0875 0.0 0.0 0.0 0.0 128-129 7.6375 0.0 0.0 0.0 0.0 130-131 8.274999999999999 0.0 0.0 0.0 0.0 132-133 8.9375 0.0 0.0 0.0 0.0 134-135 9.5375 0.0 0.0 0.0 0.0 136-137 10.2125 0.0 0.0 0.0 0.0 138-139 10.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTGGAA 10 0.0070981868 143.15001 2 CTTTGGA 10 0.0070981868 143.15001 1 TTGGAAT 10 0.0070981868 143.15001 3 GGAAACT 10 0.0070981868 143.15001 1 >>END_MODULE Read 708982 spots for SRR7169741.sra Written 708982 spots for SRR7169741.sra Read 708982 spots for SRR7169741.sra Written 708982 spots for SRR7169741.sra Read 708982 spots for SRR7169741.sra Written 708982 spots for SRR7169741.sra Read 708982 spots for SRR7169741.sra Written 708982 spots for SRR7169741.sra Read 708982 spots for SRR7169741.sra Written 708982 spots for SRR7169741.sra Read 708982 spots for SRR7169741.sra Written 708982 spots for SRR7169741.sra Read 708982 spots for SRR7169741.sra Written 708982 spots for SRR7169741.sra Read 708982 spots for SRR7169741.sra Written 708982 spots for SRR7169741.sra Read 708982 spots for SRR7169741.sra Written 708982 spots for SRR7169741.sra Read 708982 spots for SRR7169741.sra Written 708982 spots for SRR7169741.sra Read 708982 spots for SRR7169741.sra Written 708982 spots for SRR7169741.sra Read 708982 spots for SRR7169741.sra Written 708982 spots for SRR7169741.sra Read 708982 spots for SRR7169741.sra Written 708982 spots for SRR7169741.sra Read 708982 spots for SRR7169741.sra Written 708982 spots for SRR7169741.sra Read 708982 spots for SRR7169741.sra Written 708982 spots for SRR7169741.sra Read 708982 spots for SRR7169741.sra Written 708982 spots for SRR7169741.sra Read 708982 spots for SRR7169741.sra Written 708982 spots for SRR7169741.sra Read 708982 spots for SRR7169741.sra Written 708982 spots for SRR7169741.sra Read 708982 spots for SRR7169741.sra Written 708982 spots for SRR7169741.sra Read 708982 spots for SRR7169741.sra Written 708982 spots for SRR7169741.sra SRR ids: ['SRR7169741.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gbj7mn4p SRR7169741.sra spots: 14179640 blocks: [[1, 708982], [708983, 1417964], [1417965, 2126946], [2126947, 2835928], [2835929, 3544910], [3544911, 4253892], [4253893, 4962874], [4962875, 5671856], [5671857, 6380838], [6380839, 7089820], [7089821, 7798802], [7798803, 8507784], [8507785, 9216766], [9216767, 9925748], [9925749, 10634730], [10634731, 11343712], [11343713, 12052694], [12052695, 12761676], [12761677, 13470658], [13470659, 14179640]] SRR7169741 file size 4783314 SRR7169741 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169741 SRR7169741_1.fastq SRR7169741_2.fastq Input file: SRR7169741_1.fastq Paired file: SRR7169741_2.fastq trimmed: SRR7169741-trimmed-pair1.fastq, SRR7169741-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 12:10:58 2025 >> started Tue Feb 11 12:11:14 2025 >> done (16.129s) 14179640 read pairs processed; of these: 8264 ( 0.06%) short read pairs filtered out after trimming by size control 14296 ( 0.10%) empty read pairs filtered out after trimming by size control 14157080 (99.84%) read pairs available; of these: 6922872 (48.90%) trimmed read pairs available after processing 7234208 (51.10%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 5 0.00% 21 3 0.00% 22 3 0.00% 23 2 0.00% 24 2 0.00% 25 2 0.00% 26 2 0.00% 27 4 0.00% 28 11 0.00% 29 3 0.00% 30 6 0.00% 31 7 0.00% 32 9 0.00% 33 7 0.00% 34 10 0.00% 35 17 0.00% 36 11 0.00% 37 19 0.00% 38 21 0.00% 39 27 0.00% 40 38 0.00% 41 42 0.00% 42 46 0.00% 43 60 0.00% 44 47 0.00% 45 53 0.00% 46 55 0.00% 47 76 0.00% 48 100 0.00% 49 118 0.00% 50 147 0.00% 51 150 0.00% 52 167 0.00% 53 192 0.00% 54 207 0.00% 55 251 0.00% 56 253 0.00% 57 288 0.00% 58 321 0.00% 59 368 0.00% 60 483 0.00% 61 529 0.00% 62 576 0.00% 63 698 0.00% 64 759 0.01% 65 875 0.01% 66 882 0.01% 67 1012 0.01% 68 1149 0.01% 69 1292 0.01% 70 1534 0.01% 71 1738 0.01% 72 1981 0.01% 73 2305 0.02% 74 2624 0.02% 75 2985 0.02% 76 3491 0.02% 77 3868 0.03% 78 4090 0.03% 79 4296 0.03% 80 4799 0.03% 81 5214 0.04% 82 6015 0.04% 83 6767 0.05% 84 7847 0.06% 85 8925 0.06% 86 9611 0.07% 87 10122 0.07% 88 11250 0.08% 89 11764 0.08% 90 12265 0.09% 91 13424 0.09% 92 14561 0.10% 93 15744 0.11% 94 17222 0.12% 95 17947 0.13% 96 18804 0.13% 97 19720 0.14% 98 20757 0.15% 99 21589 0.15% 100 22474 0.16% 101 23843 0.17% 102 24846 0.18% 103 26493 0.19% 104 28229 0.20% 105 29291 0.21% 106 30497 0.22% 107 31472 0.22% 108 32105 0.23% 109 33231 0.23% 110 33615 0.24% 111 34603 0.24% 112 35807 0.25% 113 37239 0.26% 114 38710 0.27% 115 40336 0.28% 116 41638 0.29% 117 42715 0.30% 118 43575 0.31% 119 43560 0.31% 120 44663 0.32% 121 45554 0.32% 122 46398 0.33% 123 47782 0.34% 124 49592 0.35% 125 51427 0.36% 126 52341 0.37% 127 53963 0.38% 128 54736 0.39% 129 56092 0.40% 130 57315 0.40% 131 58136 0.41% 132 58765 0.42% 133 60770 0.43% 134 62175 0.44% 135 64527 0.46% 136 66455 0.47% 137 68886 0.49% 138 71570 0.51% 139 74744 0.53% 140 77496 0.55% 141 82946 0.59% 142 89032 0.63% 143 93512 0.66% 144 105671 0.75% 145 122417 0.86% 146 145072 1.02% 147 194291 1.37% 148 284076 2.01% 149 561395 3.97% 150 3052128 21.56% 151 7234208 51.10% 14157080 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=39 prefix-density=0.16 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACGAACTGGATTGTGCGCTTGGTCTTGATGGTAGCCACAGCTGCATTCACATCCTTGGGCACAACATCACCTCTATACATCAGGCAGCAAGCCATGTACTTGCCATGACGTGGGTCACACTTGGCCATCATGGATGATGGCTCAAAAGCACTGTTGGTTATCTCAGCCACAGAGAGCTGCTCATGGTATGCCTTCTCTGCGGAGATGACAGGGGCATA criterion=fanout-score sequence-density=0.10 sequence-density-rank=9 fanout-score=271.75 fanout-score-rank=1 prefix-density=0.95 prefix-fanout=28.6 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=3.07 fanout-score-rank=38 prefix-density=0.23 prefix-fanout=2.6 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=10 fanout-score=313.84 fanout-score-rank=1 prefix-density=1.02 prefix-fanout=29.0 sequence=AAGAAGAAGAAG SRR7169741 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 12:12:02 Started mapping on | Feb 11 12:12:03 Finished on | Feb 11 12:13:31 Mapping speed, Million of reads per hour | 579.15 Number of input reads | 14157080 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 13370656 Uniquely mapped reads % | 94.45% Average mapped length | 290.13 Number of splices: Total | 12303952 Number of splices: Annotated (sjdb) | 12090861 Number of splices: GT/AG | 12109899 Number of splices: GC/AG | 153676 Number of splices: AT/AC | 10432 Number of splices: Non-canonical | 29945 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 267120 % of reads mapped to multiple loci | 1.89% Number of reads mapped to too many loci | 152263 % of reads mapped to too many loci | 1.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.40% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 527580 527580 527580 N_multimapping 267120 267120 267120 N_noFeature 331544 13236390 391595 N_ambiguous 125512 670 50857 UnstrandedReadsAssigned:12913600 PositiveStrandReadsAssigned:133596 NegativeStrandReadsAssigned:12928204 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169741 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169741-trimmed-pair1.fastq SRR7169741-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,157,080 reads, 12,977,805 reads pseudoaligned [quant] estimated average fragment length: 210.503 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,178 rounds 52401 SRR7169741.ke.tsv 34699 SRR7169741.se.tsv 87100 total ==> SRR7169741.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1808.5 233 10.056 Potri.005G024800.1.v4.1 1035 825.497 63 5.95681 Potri.004G059700.1.v4.1 961 751.503 9 0.934761 Potri.007G009000.2.v4.1 1416 1206.5 0 0 Potri.003G141000.2.v4.1 2943 2733.5 276.043 7.88217 Potri.016G087400.1.v4.1 270 92.5083 1285.53 1084.65 Potri.015G069301.1.v4.1 564 356.298 0 0 Potri.010G195200.1.v4.1 1773 1563.5 26 1.29797 Potri.012G127500.1.v4.1 977 767.497 6723 683.715 ==> SRR7169741.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 939 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 243 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169741 completed mapping pipeline successfully