Starting /dee2/code/volunteer_pipeline.sh SRR7169742 current disk space = 3051241320448 free memory = 1414312696 SRR7169742 SRAfilesize c189823254c94d824188d459f12d2bf4 SRR7169742.sra SRR7169742.sra file validated SRR7169742 is paired end SRR7169742 is conventional basespace SRR7169742 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169742_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.47575 18.0 18.0 18.0 18.0 28.0 2 27.3555 27.0 27.0 28.0 25.0 30.0 3 28.922 29.0 28.0 31.0 25.0 33.0 4 31.71475 33.0 31.0 33.0 29.0 33.0 5 32.50675 33.0 33.0 33.0 32.0 33.0 6 36.3955 38.0 36.0 38.0 34.0 38.0 7 36.991 38.0 37.0 38.0 35.0 38.0 8 37.4315 38.0 38.0 38.0 37.0 38.0 9 37.5975 38.0 38.0 38.0 37.0 38.0 10-14 37.596399999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.613150000000005 38.0 38.0 38.0 37.6 38.0 20-24 37.66765 38.0 38.0 38.0 38.0 38.0 25-29 37.5419 38.0 38.0 38.0 37.6 38.0 30-34 37.56805 38.0 38.0 38.0 38.0 38.0 35-39 37.46045 38.0 38.0 38.0 37.6 38.0 40-44 37.39965 38.0 38.0 38.0 37.2 38.0 45-49 37.45835 38.0 38.0 38.0 37.0 38.0 50-54 37.44815 38.0 38.0 38.0 37.2 38.0 55-59 37.37245 38.0 38.0 38.0 36.8 38.0 60-64 37.32345 38.0 38.0 38.0 37.0 38.0 65-69 37.112399999999994 38.0 38.0 38.0 36.0 38.0 70-74 37.25765 38.0 38.0 38.0 36.4 38.0 75-79 36.5177 38.0 37.4 38.0 33.6 38.0 80-84 37.022149999999996 38.0 38.0 38.0 36.0 38.0 85-89 36.84165 38.0 38.0 38.0 35.2 38.0 90-94 36.78005 38.0 38.0 38.0 35.0 38.0 95-99 36.77405 38.0 38.0 38.0 35.0 38.0 100-104 36.72115 38.0 38.0 38.0 34.8 38.0 105-109 36.58795 38.0 38.0 38.0 34.4 38.0 110-114 36.0319 38.0 37.2 38.0 31.8 38.0 115-119 35.00245 38.0 35.2 38.0 27.0 38.0 120-124 36.132 38.0 36.8 38.0 33.8 38.0 125-129 35.8673 38.0 36.6 38.0 32.2 38.0 130-134 35.41955 38.0 35.6 38.0 29.8 38.0 135-139 35.2636 38.0 35.6 38.0 30.2 38.0 140-144 34.12075 38.0 34.4 38.0 24.0 38.0 145-149 34.40245 38.0 35.0 38.0 27.2 38.0 150-151 30.04775 36.0 28.0 38.0 13.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 0.0 16 0.0 17 3.0 18 2.0 19 4.0 20 1.0 21 2.0 22 4.0 23 3.0 24 7.0 25 4.0 26 10.0 27 17.0 28 16.0 29 29.0 30 28.0 31 45.0 32 57.0 33 110.0 34 178.0 35 327.0 36 1171.0 37 1980.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 13.954659949622167 47.83375314861461 9.697732997481108 28.513853904282115 2 22.05 15.45 31.974999999999998 30.525000000000002 3 21.525 21.375 25.650000000000002 31.45 4 23.35 28.225 23.075000000000003 25.35 5 22.425 32.550000000000004 23.75 21.275 6 20.325 35.925000000000004 24.6 19.15 7 15.6 26.325 40.8 17.275 8 18.099999999999998 25.55 30.4 25.95 9 17.45 26.05 33.025 23.474999999999998 10-14 20.05 30.395 26.174999999999997 23.380000000000003 15-19 19.695 30.2 26.43 23.674999999999997 20-24 19.8 29.535 27.275 23.39 25-29 19.515 29.65 27.155 23.68 30-34 20.165 29.445 26.345000000000002 24.044999999999998 35-39 19.355 29.349999999999998 27.055 24.240000000000002 40-44 20.43 29.315 27.175 23.080000000000002 45-49 20.145 29.175 26.924999999999997 23.755000000000003 50-54 20.105 28.93 27.095000000000002 23.87 55-59 20.34 28.96 26.924999999999997 23.775 60-64 19.865 29.815 26.224999999999998 24.095 65-69 19.82 29.054999999999996 26.889999999999997 24.235 70-74 20.23 28.854999999999997 27.055 23.86 75-79 19.88 29.43 27.22 23.47 80-84 19.82 29.049999999999997 27.310000000000002 23.82 85-89 20.74 28.395 26.63 24.235 90-94 20.61 28.055000000000003 27.200000000000003 24.135 95-99 20.905 28.605000000000004 26.93 23.56 100-104 20.880000000000003 28.99 26.865 23.265 105-109 20.415 28.499999999999996 26.634999999999998 24.45 110-114 21.195 28.76 25.95 24.095 115-119 21.015 28.849999999999998 26.575 23.56 120-124 21.20606030301515 28.86144307215361 25.911295564778236 24.021201060053002 125-129 21.05 28.060000000000002 26.775 24.115000000000002 130-134 20.985 28.449999999999996 25.900000000000002 24.665 135-139 21.4 27.694999999999997 26.534999999999997 24.37 140-144 21.37 28.02 26.02 24.59 145-149 20.96 28.49 25.929999999999996 24.62 150-151 21.349999999999998 28.4 25.224999999999998 25.025 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 1.5 24 2.5 25 3.0 26 3.5 27 8.0 28 15.0 29 18.5 30 22.0 31 27.5 32 37.5 33 55.0 34 67.0 35 69.5 36 87.0 37 115.5 38 141.0 39 165.0 40 192.5 41 223.5 42 254.5 43 268.0 44 255.0 45 252.5 46 246.0 47 229.0 48 231.0 49 205.0 50 155.5 51 130.5 52 117.0 53 98.5 54 72.5 55 54.0 56 42.5 57 30.0 58 27.5 59 22.5 60 14.0 61 12.5 62 8.5 63 4.5 64 2.0 65 1.0 66 3.0 67 2.0 68 0.5 69 0.5 70 0.5 71 1.0 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.005 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49710837314558 98.925 2 0.4777470455116922 0.95 3 0.0 0.0 4 0.0 0.0 5 0.025144581342720643 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGATTCCATCTCGTAT 5 0.125 TruSeq Adapter, Index 9 (97% over 35bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0125 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.32499999999999996 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.7125 0.0 0.0 0.0 0.0 92-93 0.925 0.0 0.0 0.0 0.0 94-95 1.1375000000000002 0.0 0.0 0.0 0.0 96-97 1.2875 0.0 0.0 0.0 0.0 98-99 1.6375 0.0 0.0 0.0 0.0 100-101 1.7625000000000002 0.0 0.0 0.0 0.0 102-103 2.025 0.0 0.0 0.0 0.0 104-105 2.4 0.0 0.0 0.0 0.0 106-107 2.775 0.0 0.0 0.0 0.0 108-109 3.0999999999999996 0.0 0.0 0.0 0.0 110-111 3.475 0.0 0.0 0.0 0.0 112-113 3.875 0.0 0.0 0.0 0.0 114-115 4.6125 0.0 0.0 0.0 0.0 116-117 5.199999999999999 0.0 0.0 0.0 0.0 118-119 5.85 0.0 0.0 0.0 0.0 120-121 6.35 0.0 0.0 0.0 0.0 122-123 7.1 0.0 0.0 0.0 0.0 124-125 7.7 0.0 0.0 0.0 0.0 126-127 8.2625 0.0 0.0 0.0 0.0 128-129 8.9375 0.0 0.0 0.0 0.0 130-131 9.5625 0.0 0.0 0.0 0.0 132-133 10.3125 0.0 0.0 0.0 0.0 134-135 10.9625 0.0 0.0 0.0 0.0 136-137 11.774999999999999 0.0 0.0 0.0 0.0 138-139 12.975000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCAGAG 10 0.006832588 144.9875 2 >>END_MODULE SRR7169742 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169742_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.98 33.0 33.0 34.0 32.0 34.0 2 33.05625 34.0 33.0 34.0 33.0 34.0 3 33.14825 34.0 33.0 34.0 33.0 34.0 4 33.114 34.0 33.0 34.0 33.0 34.0 5 33.12475 34.0 33.0 34.0 33.0 34.0 6 37.293 38.0 38.0 38.0 37.0 38.0 7 37.28475 38.0 38.0 38.0 37.0 38.0 8 37.365 38.0 38.0 38.0 38.0 38.0 9 37.2505 38.0 38.0 38.0 37.0 38.0 10-14 37.2593 38.0 38.0 38.0 37.8 38.0 15-19 36.68345 38.0 37.8 38.0 35.2 38.0 20-24 37.12985 38.0 38.0 38.0 37.2 38.0 25-29 36.07875 38.0 37.4 38.0 32.0 38.0 30-34 37.1301 38.0 38.0 38.0 36.8 38.0 35-39 37.20455 38.0 38.0 38.0 37.4 38.0 40-44 37.1322 38.0 38.0 38.0 37.0 38.0 45-49 37.046499999999995 38.0 38.0 38.0 36.6 38.0 50-54 37.057599999999994 38.0 38.0 38.0 36.8 38.0 55-59 36.97485 38.0 38.0 38.0 36.6 38.0 60-64 36.9415 38.0 38.0 38.0 36.6 38.0 65-69 35.490700000000004 38.0 36.6 38.0 28.6 38.0 70-74 35.95739999999999 38.0 37.2 38.0 31.8 38.0 75-79 36.7188 38.0 38.0 38.0 36.0 38.0 80-84 36.3058 38.0 37.6 38.0 33.6 38.0 85-89 36.723349999999996 38.0 38.0 38.0 35.8 38.0 90-94 36.703799999999994 38.0 38.0 38.0 36.0 38.0 95-99 36.60985 38.0 38.0 38.0 35.6 38.0 100-104 36.34134999999999 38.0 38.0 38.0 34.4 38.0 105-109 35.552949999999996 38.0 37.2 38.0 30.8 38.0 110-114 35.4564 38.0 37.2 38.0 31.6 38.0 115-119 34.2924 38.0 36.6 38.0 22.6 38.0 120-124 34.360850000000006 38.0 36.0 38.0 24.8 38.0 125-129 34.4474 38.0 35.6 38.0 24.2 38.0 130-134 35.18295 38.0 36.0 38.0 29.6 38.0 135-139 35.034800000000004 38.0 35.8 38.0 29.4 38.0 140-144 34.783950000000004 38.0 35.4 38.0 29.0 38.0 145-149 34.0996 38.0 33.8 38.0 26.4 38.0 150-151 29.69175 35.5 27.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 3.0 4 4.0 5 1.0 6 2.0 7 2.0 8 0.0 9 2.0 10 2.0 11 0.0 12 0.0 13 1.0 14 3.0 15 2.0 16 2.0 17 7.0 18 6.0 19 5.0 20 8.0 21 9.0 22 10.0 23 9.0 24 7.0 25 11.0 26 10.0 27 24.0 28 12.0 29 29.0 30 44.0 31 60.0 32 92.0 33 101.0 34 160.0 35 275.0 36 758.0 37 2325.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.675 18.525 15.775 26.025 2 27.575 26.35 27.200000000000003 18.875 3 22.1 28.775000000000002 29.799999999999997 19.325 4 25.55 33.0 22.725 18.725 5 25.374999999999996 34.825 20.525 19.275000000000002 6 22.55 36.125 23.325000000000003 18.0 7 21.099999999999998 22.175 37.425000000000004 19.3 8 23.775 25.900000000000002 26.5 23.825 9 23.075000000000003 26.0 29.025000000000002 21.9 10-14 24.555 28.4 25.490000000000002 21.555 15-19 24.7 27.63 26.895000000000003 20.775 20-24 23.985 27.735 27.189999999999998 21.09 25-29 24.22 27.68 27.105 20.995 30-34 23.630000000000003 28.165000000000003 26.924999999999997 21.279999999999998 35-39 23.73 27.76 27.339999999999996 21.17 40-44 23.775 27.72 27.74 20.765 45-49 24.015 27.445000000000004 27.565 20.974999999999998 50-54 24.33 27.26 27.71 20.7 55-59 24.085 26.345000000000002 28.560000000000002 21.01 60-64 24.585 27.3 27.750000000000004 20.365 65-69 23.84 27.665 27.894999999999996 20.599999999999998 70-74 23.645 27.58 27.815 20.96 75-79 23.94825251968109 26.851526851526852 28.265556836985407 20.93466379180665 80-84 24.29 27.779999999999998 28.02 19.91 85-89 23.830000000000002 27.83 28.015 20.325 90-94 23.735 27.67 28.199999999999996 20.395 95-99 23.845 27.72 27.67 20.765 100-104 24.282925364168793 27.641788056264705 27.641788056264705 20.433498523301797 105-109 24.236641221374043 27.62153475291282 27.8023302531137 20.339493772599436 110-114 24.57644313685706 27.574312671198133 27.315613269757534 20.533630922187278 115-119 25.081788440567067 28.010593550397257 27.268006439216908 19.63961156981877 120-124 24.78694282320128 27.085377821393525 27.612210113113996 20.515469242291203 125-129 25.258440698681063 27.69771350002546 27.02551306207669 20.018332739216785 130-134 25.508058864751227 26.794473921313443 27.25998598458304 20.437481229352287 135-139 25.715 27.46 26.99 19.835 140-144 26.105 26.6 27.49 19.805 145-149 26.419999999999998 26.775 27.075 19.73 150-151 26.3625 26.3625 27.5875 19.6875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 1.0 23 1.5 24 0.5 25 1.0 26 1.5 27 2.5 28 5.0 29 4.0 30 5.0 31 9.5 32 15.5 33 20.0 34 27.0 35 41.5 36 67.0 37 89.0 38 111.0 39 144.5 40 182.0 41 213.0 42 260.5 43 292.5 44 290.0 45 286.0 46 288.0 47 273.5 48 250.0 49 221.5 50 179.0 51 150.5 52 129.5 53 109.5 54 81.5 55 61.5 56 50.0 57 36.5 58 23.0 59 19.5 60 17.5 61 13.0 62 7.5 63 3.0 64 2.5 65 1.5 66 1.0 67 2.0 68 1.5 69 0.5 70 1.5 71 1.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.28500000000000003 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.11499999999999999 105-109 0.44 110-114 1.43 115-119 3.7150000000000003 120-124 3.195 125-129 1.815 130-134 0.11 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52225295448831 98.95 2 0.4274578828262509 0.8500000000000001 3 0.025144581342720643 0.075 4 0.0 0.0 5 0.025144581342720643 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGCCTCTATGTGTAGATCT 5 0.125 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0125 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.32499999999999996 0.0 0.0 0.0 0.0 88-89 0.48750000000000004 0.0 0.0 0.0 0.0 90-91 0.7375 0.0 0.0 0.0 0.0 92-93 0.95 0.0 0.0 0.0 0.0 94-95 1.1625 0.0 0.0 0.0 0.0 96-97 1.3 0.0 0.0 0.0 0.0 98-99 1.6625 0.0 0.0 0.0 0.0 100-101 1.7875 0.0 0.0 0.0 0.0 102-103 2.0625 0.0 0.0 0.0 0.0 104-105 2.5 0.0 0.0 0.0 0.0 106-107 2.9124999999999996 0.0 0.0 0.0 0.0 108-109 3.2375 0.0 0.0 0.0 0.0 110-111 3.5875 0.0 0.0 0.0 0.0 112-113 3.9625 0.0 0.0 0.0 0.0 114-115 4.5875 0.0 0.0 0.0 0.0 116-117 5.1375 0.0 0.0 0.0 0.0 118-119 5.75 0.0 0.0 0.0 0.0 120-121 6.199999999999999 0.0 0.0 0.0 0.0 122-123 6.85 0.0 0.0 0.0 0.0 124-125 7.449999999999999 0.0 0.0 0.0 0.0 126-127 7.9625 0.0 0.0 0.0 0.0 128-129 8.6375 0.0 0.0 0.0 0.0 130-131 9.274999999999999 0.0 0.0 0.0 0.0 132-133 10.0125 0.0 0.0 0.0 0.0 134-135 10.7 0.0 0.0 0.0 0.0 136-137 11.575 0.0 0.0 0.0 0.0 138-139 12.774999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATCTT 10 0.0070428792 143.525 4 >>END_MODULE Read 688032 spots for SRR7169742.sra Written 688032 spots for SRR7169742.sra Read 688032 spots for SRR7169742.sra Written 688032 spots for SRR7169742.sra Read 688032 spots for SRR7169742.sra Written 688032 spots for SRR7169742.sra Read 688032 spots for SRR7169742.sra Written 688032 spots for SRR7169742.sra Read 688032 spots for SRR7169742.sra Written 688032 spots for SRR7169742.sra Read 688032 spots for SRR7169742.sra Written 688032 spots for SRR7169742.sra Read 688032 spots for SRR7169742.sra Written 688032 spots for SRR7169742.sra Read 688032 spots for SRR7169742.sra Written 688032 spots for SRR7169742.sra Read 688032 spots for SRR7169742.sra Written 688032 spots for SRR7169742.sra Read 688032 spots for SRR7169742.sra Written 688032 spots for SRR7169742.sra Read 688042 spots for SRR7169742.sra Written 688042 spots for SRR7169742.sra Read 688032 spots for SRR7169742.sra Written 688032 spots for SRR7169742.sra Read 688032 spots for SRR7169742.sra Written 688032 spots for SRR7169742.sra Read 688032 spots for SRR7169742.sra Written 688032 spots for SRR7169742.sra Read 688032 spots for SRR7169742.sra Written 688032 spots for SRR7169742.sra Read 688032 spots for SRR7169742.sra Written 688032 spots for SRR7169742.sra Read 688032 spots for SRR7169742.sra Written 688032 spots for SRR7169742.sra Read 688032 spots for SRR7169742.sra Written 688032 spots for SRR7169742.sra Read 688032 spots for SRR7169742.sra Written 688032 spots for SRR7169742.sra Read 688032 spots for SRR7169742.sra Written 688032 spots for SRR7169742.sra SRR ids: ['SRR7169742.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fr__aa9a SRR7169742.sra spots: 13760650 blocks: [[1, 688032], [688033, 1376064], [1376065, 2064096], [2064097, 2752128], [2752129, 3440160], [3440161, 4128192], [4128193, 4816224], [4816225, 5504256], [5504257, 6192288], [6192289, 6880320], [6880321, 7568352], [7568353, 8256384], [8256385, 8944416], [8944417, 9632448], [9632449, 10320480], [10320481, 11008512], [11008513, 11696544], [11696545, 12384576], [12384577, 13072608], [13072609, 13760650]] SRR7169742 file size 4641332 SRR7169742 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169742 SRR7169742_1.fastq SRR7169742_2.fastq Input file: SRR7169742_1.fastq Paired file: SRR7169742_2.fastq trimmed: SRR7169742-trimmed-pair1.fastq, SRR7169742-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 11:58:41 2025 >> started Tue Feb 11 11:59:05 2025 >> done (23.790s) 13760650 read pairs processed; of these: 23046 ( 0.17%) short read pairs filtered out after trimming by size control 31402 ( 0.23%) empty read pairs filtered out after trimming by size control 13706202 (99.60%) read pairs available; of these: 6859100 (50.04%) trimmed read pairs available after processing 6847102 (49.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 5 0.00% 20 3 0.00% 21 1 0.00% 22 0 0.00% 23 8 0.00% 24 8 0.00% 25 6 0.00% 26 5 0.00% 27 8 0.00% 28 12 0.00% 29 11 0.00% 30 10 0.00% 31 14 0.00% 32 11 0.00% 33 7 0.00% 34 15 0.00% 35 12 0.00% 36 13 0.00% 37 22 0.00% 38 25 0.00% 39 40 0.00% 40 38 0.00% 41 34 0.00% 42 52 0.00% 43 48 0.00% 44 55 0.00% 45 70 0.00% 46 62 0.00% 47 89 0.00% 48 102 0.00% 49 100 0.00% 50 154 0.00% 51 159 0.00% 52 166 0.00% 53 204 0.00% 54 215 0.00% 55 216 0.00% 56 284 0.00% 57 275 0.00% 58 303 0.00% 59 379 0.00% 60 411 0.00% 61 497 0.00% 62 590 0.00% 63 738 0.01% 64 725 0.01% 65 778 0.01% 66 842 0.01% 67 917 0.01% 68 1109 0.01% 69 1269 0.01% 70 1457 0.01% 71 1642 0.01% 72 1918 0.01% 73 2272 0.02% 74 2498 0.02% 75 2856 0.02% 76 4115 0.03% 77 4689 0.03% 78 3916 0.03% 79 4126 0.03% 80 4670 0.03% 81 5007 0.04% 82 5869 0.04% 83 6416 0.05% 84 8256 0.06% 85 9424 0.07% 86 9816 0.07% 87 10777 0.08% 88 11382 0.08% 89 11947 0.09% 90 12712 0.09% 91 13560 0.10% 92 14784 0.11% 93 16071 0.12% 94 17363 0.13% 95 18704 0.14% 96 19374 0.14% 97 20363 0.15% 98 21042 0.15% 99 21735 0.16% 100 23308 0.17% 101 24134 0.18% 102 26147 0.19% 103 27537 0.20% 104 29155 0.21% 105 30728 0.22% 106 32387 0.24% 107 32978 0.24% 108 33789 0.25% 109 35047 0.26% 110 35847 0.26% 111 37126 0.27% 112 38541 0.28% 113 40355 0.29% 114 42237 0.31% 115 44376 0.32% 116 45521 0.33% 117 46856 0.34% 118 47502 0.35% 119 48130 0.35% 120 48448 0.35% 121 49998 0.36% 122 51645 0.38% 123 53255 0.39% 124 55593 0.41% 125 56904 0.42% 126 59220 0.43% 127 60908 0.44% 128 61244 0.45% 129 62183 0.45% 130 63311 0.46% 131 64095 0.47% 132 65576 0.48% 133 68236 0.50% 134 69727 0.51% 135 72724 0.53% 136 74319 0.54% 137 77320 0.56% 138 79758 0.58% 139 81768 0.60% 140 83823 0.61% 141 88695 0.65% 142 93785 0.68% 143 100631 0.73% 144 111068 0.81% 145 126953 0.93% 146 146942 1.07% 147 186172 1.36% 148 269316 1.96% 149 515066 3.76% 150 2838837 20.71% 151 6847102 49.96% 13706202 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=39 prefix-density=0.30 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACGAACTGGATTGTGCGCTTGGTCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=125.43 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=9.6 sequence=CATCAATCTCACATTTAGAAAAGGAGCTGCCCAAATGCAAGAGCAACGAGAGAAGCAAGAACAGCCGGCACAAAAGTGGTGGCATCGGAGGTAGGGCTAGGTGCTGGGGCCTCCGCTGCTGCTACATTTTGGACGGCTGAAACAGCCATGAGCACAACCACGATAGCCAAAAACACTCTCATCTTCAATGCCTCCATTGTGAAAAACTTTCTTGCTGGAAAAAACAGAGGCGTGGAGGGAGAAGAGAAAATGCAAGATTTCAGACAACGGG criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=41 prefix-density=0.30 prefix-fanout=1.9 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=163.41 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=13.3 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGAT SRR7169742 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 12:00:01 Started mapping on | Feb 11 12:00:02 Finished on | Feb 11 12:02:16 Mapping speed, Million of reads per hour | 368.23 Number of input reads | 13706202 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 12815857 Uniquely mapped reads % | 93.50% Average mapped length | 289.12 Number of splices: Total | 10534154 Number of splices: Annotated (sjdb) | 10338634 Number of splices: GT/AG | 10377572 Number of splices: GC/AG | 123207 Number of splices: AT/AC | 8427 Number of splices: Non-canonical | 24948 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.80 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 254448 % of reads mapped to multiple loci | 1.86% Number of reads mapped to too many loci | 76215 % of reads mapped to too many loci | 0.56% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.99% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 652914 652914 652914 N_multimapping 254448 254448 254448 N_noFeature 269267 12647892 340759 N_ambiguous 146816 707 49889 UnstrandedReadsAssigned:12399774 PositiveStrandReadsAssigned:167258 NegativeStrandReadsAssigned:12425209 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7169742 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169742-trimmed-pair1.fastq SRR7169742-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,706,202 reads, 12,417,503 reads pseudoaligned [quant] estimated average fragment length: 201.415 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,030 rounds 52401 SRR7169742.ke.tsv 34699 SRR7169742.se.tsv 87100 total ==> SRR7169742.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1817.58 220 8.74623 Potri.005G024800.1.v4.1 1035 834.585 43 3.72298 Potri.004G059700.1.v4.1 961 760.585 1 0.0950047 Potri.007G009000.2.v4.1 1416 1215.58 0 0 Potri.003G141000.2.v4.1 2943 2742.58 234.037 6.1662 Potri.016G087400.1.v4.1 270 94.3841 1324 1013.64 Potri.015G069301.1.v4.1 564 364.456 0 0 Potri.010G195200.1.v4.1 1773 1572.58 10 0.459493 Potri.012G127500.1.v4.1 977 776.585 5228 486.452 ==> SRR7169742.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 798 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 192 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 16 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7169742 completed mapping pipeline successfully