Starting /dee2/code/volunteer_pipeline.sh SRR7169743 current disk space = 3050715258880 free memory = 1522769340 SRR7169743 SRAfilesize c8facd5ba4a2ee28c3e4a7a8bafc1484 SRR7169743.sra SRR7169743.sra file validated SRR7169743 is paired end SRR7169743 is conventional basespace SRR7169743 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169743_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.503 18.0 18.0 18.0 18.0 32.0 2 28.122 28.0 27.0 30.0 25.0 31.0 3 29.80275 31.0 29.0 33.0 25.0 33.0 4 32.15 33.0 33.0 33.0 31.0 33.0 5 32.79575 33.0 33.0 33.0 32.0 34.0 6 36.913 38.0 37.0 38.0 35.0 38.0 7 37.46575 38.0 38.0 38.0 37.0 38.0 8 37.6115 38.0 38.0 38.0 38.0 38.0 9 37.658 38.0 38.0 38.0 38.0 38.0 10-14 37.6819 38.0 38.0 38.0 38.0 38.0 15-19 37.693650000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.71345 38.0 38.0 38.0 38.0 38.0 25-29 37.67815 38.0 38.0 38.0 38.0 38.0 30-34 37.68285000000001 38.0 38.0 38.0 38.0 38.0 35-39 37.6684 38.0 38.0 38.0 38.0 38.0 40-44 37.61365 38.0 38.0 38.0 38.0 38.0 45-49 37.6155 38.0 38.0 38.0 38.0 38.0 50-54 37.525099999999995 38.0 38.0 38.0 38.0 38.0 55-59 37.5449 38.0 38.0 38.0 38.0 38.0 60-64 37.45270000000001 38.0 38.0 38.0 37.8 38.0 65-69 37.441500000000005 38.0 38.0 38.0 37.4 38.0 70-74 37.45985 38.0 38.0 38.0 37.4 38.0 75-79 37.397549999999995 38.0 38.0 38.0 37.2 38.0 80-84 37.30929999999999 38.0 38.0 38.0 37.0 38.0 85-89 37.24575 38.0 38.0 38.0 37.0 38.0 90-94 37.142649999999996 38.0 38.0 38.0 36.4 38.0 95-99 37.15069999999999 38.0 38.0 38.0 36.4 38.0 100-104 37.0342 38.0 38.0 38.0 36.0 38.0 105-109 36.58434999999999 38.0 38.0 38.0 35.4 38.0 110-114 36.5215 38.0 38.0 38.0 35.0 38.0 115-119 36.72795 38.0 38.0 38.0 35.0 38.0 120-124 36.6258 38.0 38.0 38.0 34.8 38.0 125-129 36.544200000000004 38.0 38.0 38.0 34.4 38.0 130-134 36.31805 38.0 38.0 38.0 34.0 38.0 135-139 36.04815 38.0 37.2 38.0 33.0 38.0 140-144 35.67785 38.0 36.0 38.0 32.2 38.0 145-149 35.3941 38.0 36.0 38.0 32.0 38.0 150-151 31.980874999999997 36.5 32.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 0.0 16 1.0 17 1.0 18 2.0 19 4.0 20 2.0 21 0.0 22 2.0 23 2.0 24 8.0 25 8.0 26 5.0 27 7.0 28 10.0 29 14.0 30 26.0 31 32.0 32 45.0 33 70.0 34 125.0 35 187.0 36 581.0 37 2866.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.27937860185417 19.268353796041094 9.621648709596592 35.83061889250814 2 22.375 16.475 33.875 27.275 3 20.599999999999998 21.25 25.575 32.574999999999996 4 21.980495123780948 30.307576894223555 21.75543885971493 25.95648912228057 5 24.15 33.275 22.875 19.7 6 18.9 36.775000000000006 24.5 19.825 7 13.600000000000001 25.474999999999998 41.625 19.3 8 17.875 26.075 31.225 24.825 9 17.2 23.674999999999997 35.675000000000004 23.45 10-14 20.119999999999997 30.505 26.27 23.105 15-19 19.650000000000002 29.28 27.439999999999998 23.630000000000003 20-24 19.830000000000002 28.999999999999996 27.565 23.605 25-29 20.02 29.635 26.650000000000002 23.695 30-34 20.03 29.080000000000002 27.415 23.474999999999998 35-39 19.93 29.24 27.37 23.46 40-44 19.939999999999998 29.13 27.66 23.27 45-49 20.01 29.565 27.24 23.185 50-54 20.085 29.439999999999998 27.474999999999998 23.0 55-59 20.16 29.535 26.889999999999997 23.415 60-64 20.0140238405289 28.884102975057598 27.141139937894422 23.960733246519084 65-69 20.53 28.99 27.1 23.380000000000003 70-74 20.29 29.525000000000002 27.034999999999997 23.150000000000002 75-79 20.419999999999998 28.384999999999998 27.095000000000002 24.099999999999998 80-84 20.349999999999998 29.360000000000003 27.325 22.965 85-89 20.44 28.360000000000003 27.345000000000002 23.855 90-94 20.225 29.15 27.07 23.555 95-99 19.575 29.07 27.66 23.695 100-104 20.839174844782697 28.069297015822155 27.598638093330663 23.492890046064492 105-109 20.29095317472344 29.37313734404203 26.867707228367934 23.468202252866597 110-114 20.904867703494244 28.47404564734397 26.62593415471622 23.995152494445566 115-119 20.775 28.58 26.87 23.775 120-124 21.345 29.275000000000002 26.029999999999998 23.35 125-129 20.73 28.59 26.775 23.905 130-134 21.245 28.415000000000003 26.86 23.48 135-139 21.33 27.905 26.33 24.435000000000002 140-144 21.095 28.265 26.279999999999998 24.36 145-149 21.77 28.610000000000003 26.290000000000003 23.330000000000002 150-151 20.6875 27.762500000000003 26.7125 24.837500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 2.0 25 2.5 26 4.5 27 6.5 28 6.0 29 9.5 30 18.5 31 26.0 32 38.5 33 57.5 34 66.5 35 74.5 36 89.5 37 117.0 38 142.0 39 161.0 40 194.0 41 223.0 42 240.5 43 256.0 44 277.0 45 276.0 46 262.0 47 250.5 48 228.5 49 197.5 50 168.5 51 142.5 52 111.5 53 80.5 54 67.0 55 59.5 56 37.0 57 26.0 58 19.5 59 13.0 60 8.0 61 7.0 62 9.0 63 6.0 64 5.0 65 4.5 66 2.0 67 0.0 68 0.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.16999999999999998 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.13999999999999999 105-109 1.015 110-114 0.98 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54785229841748 99.075 2 0.42702838482793265 0.8500000000000001 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.35 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.5375 0.0 0.0 0.0 0.0 86-87 0.6625000000000001 0.0 0.0 0.0 0.0 88-89 0.6875 0.0 0.0 0.0 0.0 90-91 0.7124999999999999 0.0 0.0 0.0 0.0 92-93 0.7875 0.0 0.0 0.0 0.0 94-95 0.8875 0.0 0.0 0.0 0.0 96-97 1.0625 0.0 0.0 0.0 0.0 98-99 1.45 0.0 0.0 0.0 0.0 100-101 1.825 0.0 0.0 0.0 0.0 102-103 2.0999999999999996 0.0 0.0 0.0 0.0 104-105 2.35 0.0 0.0 0.0 0.0 106-107 2.925 0.0 0.0 0.0 0.0 108-109 3.5125 0.0 0.0 0.0 0.0 110-111 3.8375000000000004 0.0 0.0 0.0 0.0 112-113 4.4 0.0 0.0 0.0 0.0 114-115 4.75 0.0 0.0 0.0 0.0 116-117 5.1375 0.0 0.0 0.0 0.0 118-119 5.65 0.0 0.0 0.0 0.0 120-121 6.075 0.0 0.0 0.0 0.0 122-123 6.5125 0.0 0.0 0.0 0.0 124-125 7.1125 0.0 0.0 0.0 0.0 126-127 7.7375 0.0 0.0 0.0 0.0 128-129 8.25 0.0 0.0 0.0 0.0 130-131 8.662500000000001 0.0 0.0 0.0 0.0 132-133 9.100000000000001 0.0 0.0 0.0 0.0 134-135 9.775 0.0 0.0 0.0 0.0 136-137 10.350000000000001 0.0 0.0 0.0 0.0 138-139 11.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAACCTG 10 0.006830828 145.0 9 TCCGACC 10 0.006830828 145.0 2 >>END_MODULE SRR7169743 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169743_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2155 34.0 33.0 34.0 33.0 34.0 2 33.21625 34.0 33.0 34.0 33.0 34.0 3 33.26225 34.0 33.0 34.0 33.0 34.0 4 33.2795 34.0 33.0 34.0 33.0 34.0 5 33.19175 34.0 33.0 34.0 33.0 34.0 6 37.44925 38.0 38.0 38.0 38.0 38.0 7 37.48025 38.0 38.0 38.0 38.0 38.0 8 37.462 38.0 38.0 38.0 38.0 38.0 9 37.482 38.0 38.0 38.0 38.0 38.0 10-14 37.484449999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.4393 38.0 38.0 38.0 38.0 38.0 20-24 37.41824999999999 38.0 38.0 38.0 38.0 38.0 25-29 37.37955000000001 38.0 38.0 38.0 38.0 38.0 30-34 37.362100000000005 38.0 38.0 38.0 38.0 38.0 35-39 37.31785 38.0 38.0 38.0 37.6 38.0 40-44 37.3483 38.0 38.0 38.0 37.8 38.0 45-49 37.2392 38.0 38.0 38.0 37.0 38.0 50-54 37.06635 38.0 38.0 38.0 36.6 38.0 55-59 36.95715 38.0 38.0 38.0 35.8 38.0 60-64 36.26865 38.0 37.2 38.0 33.2 38.0 65-69 37.22525 38.0 38.0 38.0 37.0 38.0 70-74 36.92035 38.0 38.0 38.0 36.6 38.0 75-79 36.01135000000001 38.0 38.0 38.0 35.4 38.0 80-84 36.5731 38.0 38.0 38.0 35.2 38.0 85-89 36.9961 38.0 38.0 38.0 36.0 38.0 90-94 36.9936 38.0 38.0 38.0 36.2 38.0 95-99 36.8772 38.0 38.0 38.0 36.0 38.0 100-104 36.5673 38.0 38.0 38.0 35.4 38.0 105-109 35.20204999999999 38.0 38.0 38.0 32.0 38.0 110-114 34.24535 38.0 37.6 38.0 22.4 38.0 115-119 33.63365 38.0 37.0 38.0 14.8 38.0 120-124 33.571999999999996 38.0 35.8 38.0 16.2 38.0 125-129 34.125750000000004 38.0 36.0 38.0 23.0 38.0 130-134 34.8766 38.0 35.8 38.0 26.8 38.0 135-139 35.166650000000004 38.0 36.0 38.0 31.0 38.0 140-144 34.313649999999996 38.0 35.0 38.0 25.6 38.0 145-149 34.41645 38.0 35.6 38.0 28.0 38.0 150-151 30.19675 35.5 28.0 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 2.0 4 2.0 5 4.0 6 1.0 7 1.0 8 0.0 9 1.0 10 2.0 11 0.0 12 1.0 13 2.0 14 0.0 15 2.0 16 1.0 17 3.0 18 1.0 19 5.0 20 7.0 21 7.0 22 12.0 23 23.0 24 14.0 25 16.0 26 17.0 27 29.0 28 30.0 29 48.0 30 64.0 31 58.0 32 93.0 33 95.0 34 132.0 35 216.0 36 551.0 37 2556.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.33383345836459 18.27956989247312 16.9792448112028 29.40735183795949 2 25.88323728388875 25.732899022801302 31.320471059884742 17.063392633425206 3 19.35483870967742 28.657164291072768 31.15778944736184 20.830207551887973 4 23.455863965991497 34.058514628657164 24.731182795698924 17.75443860965241 5 25.056264066016503 36.53413353338335 22.05551387846962 16.35408852213053 6 20.925 37.525 24.099999999999998 17.45 7 20.0 19.925 40.8 19.275000000000002 8 23.225 24.325 27.625 24.825 9 21.625 24.85 28.975 24.55 10-14 24.005000000000003 28.144999999999996 26.605 21.245 15-19 23.265 27.265 27.975 21.495 20-24 22.807280728072808 27.47274727472747 28.332833283328334 21.387138713871387 25-29 22.703405510826624 28.264239635945394 27.934190128519276 21.098164724708706 30-34 23.373506025903886 27.589138370755613 27.909186377956697 21.128169225383807 35-39 23.55971194238848 28.000600120024004 28.000600120024004 20.43908781756351 40-44 23.164632926585316 27.690538107621528 28.185637127425483 20.959191838367673 45-49 22.86843026453968 27.829174376156423 28.604290643596542 20.698104715707355 50-54 23.061153057652884 28.126406320316015 28.371418570928547 20.441022051102557 55-59 23.862386238623863 27.47274727472747 28.437843784378437 20.22702270227023 60-64 23.111155557777888 27.85639281964098 28.436421821091056 20.596029801490072 65-69 23.68618430921546 27.58137906895345 28.42642132106605 20.306015300765036 70-74 23.470824949698187 27.605633802816904 28.324949698189133 20.598591549295776 75-79 23.480862478076965 27.313525224388734 28.680491076034254 20.52512122150005 80-84 23.706614276358874 27.530099239333033 28.21016573472369 20.5531207495844 85-89 23.66973394678936 27.445489097819564 28.555711142228446 20.329065813162632 90-94 23.969793958791758 27.755551110222044 28.025605121024206 20.249049809961992 95-99 23.32 27.765 28.835 20.080000000000002 100-104 23.778714013441668 27.64068612699368 28.11214765773899 20.46845220182566 105-109 23.988169364881692 27.70340390203404 27.936903279369034 20.371523453715234 110-114 24.487179487179485 27.2275641025641 27.970085470085472 20.31517094017094 115-119 24.669412529807065 27.601344027747672 27.633860828094512 20.095382614350747 120-124 24.775401069518715 26.41176470588235 28.17647058823529 20.636363636363637 125-129 25.232857969794242 27.72193864126717 27.72193864126717 19.32326474767142 130-134 25.300840843864865 28.04491213936861 26.41357434167464 20.24067267509189 135-139 25.165 27.32 27.805000000000003 19.71 140-144 25.38253825382538 27.18771877187719 27.557755775577558 19.87198719871987 145-149 25.677567756775677 27.432743274327432 27.697769776977697 19.19191919191919 150-151 25.60929410279076 26.707917666372015 28.172749084480365 19.510039146356863 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.5 24 1.0 25 3.0 26 3.0 27 2.5 28 5.0 29 5.5 30 11.5 31 22.5 32 30.0 33 31.5 34 37.0 35 51.5 36 84.5 37 127.0 38 149.0 39 173.0 40 210.5 41 235.0 42 254.0 43 269.5 44 267.5 45 267.0 46 283.5 47 274.5 48 247.0 49 208.5 50 158.5 51 134.0 52 121.0 53 103.0 54 70.0 55 47.0 56 34.0 57 17.0 58 12.0 59 10.0 60 6.0 61 5.0 62 6.5 63 6.0 64 3.0 65 1.0 66 0.0 67 1.5 68 3.0 69 2.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.025 2 0.22499999999999998 3 0.025 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.01 25-29 0.015 30-34 0.015 35-39 0.02 40-44 0.02 45-49 0.015 50-54 0.005 55-59 0.01 60-64 0.005 65-69 0.005 70-74 0.6 75-79 3.0700000000000003 80-84 0.745 85-89 0.02 90-94 0.02 95-99 0.0 100-104 0.31 105-109 3.64 110-114 6.4 115-119 7.739999999999999 120-124 6.5 125-129 4.984999999999999 130-134 0.695 135-139 0.0 140-144 0.01 145-149 0.01 150-151 1.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.35 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.5375 0.0 0.0 0.0 0.0 86-87 0.6875 0.0 0.0 0.0 0.0 88-89 0.7124999999999999 0.0 0.0 0.0 0.0 90-91 0.7375 0.0 0.0 0.0 0.0 92-93 0.8125 0.0 0.0 0.0 0.0 94-95 0.9125 0.0 0.0 0.0 0.0 96-97 1.0625 0.0 0.0 0.0 0.0 98-99 1.4375 0.0 0.0 0.0 0.0 100-101 1.775 0.0 0.0 0.0 0.0 102-103 1.9874999999999998 0.0 0.0 0.0 0.0 104-105 2.2125000000000004 0.0 0.0 0.0 0.0 106-107 2.7625 0.0 0.0 0.0 0.0 108-109 3.2874999999999996 0.0 0.0 0.0 0.0 110-111 3.55 0.0 0.0 0.0 0.0 112-113 4.0625 0.0 0.0 0.0 0.0 114-115 4.4 0.0 0.0 0.0 0.0 116-117 4.725 0.0 0.0 0.0 0.0 118-119 5.2125 0.0 0.0 0.0 0.0 120-121 5.6125 0.0 0.0 0.0 0.0 122-123 6.0375 0.0 0.0 0.0 0.0 124-125 6.574999999999999 0.0 0.0 0.0 0.0 126-127 7.1875 0.0 0.0 0.0 0.0 128-129 7.7125 0.0 0.0 0.0 0.0 130-131 8.1375 0.0 0.0 0.0 0.0 132-133 8.600000000000001 0.0 0.0 0.0 0.0 134-135 9.225 0.0 0.0 0.0 0.0 136-137 9.7625 0.0 0.0 0.0 0.0 138-139 10.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 586935 spots for SRR7169743.sra Written 586935 spots for SRR7169743.sra Read 586935 spots for SRR7169743.sra Written 586935 spots for SRR7169743.sra Read 586935 spots for SRR7169743.sra Written 586935 spots for SRR7169743.sra Read 586935 spots for SRR7169743.sra Written 586935 spots for SRR7169743.sra Read 586935 spots for SRR7169743.sra Written 586935 spots for SRR7169743.sra Read 586935 spots for SRR7169743.sra Written 586935 spots for SRR7169743.sra Read 586935 spots for SRR7169743.sra Written 586935 spots for SRR7169743.sra Read 586935 spots for SRR7169743.sra Written 586935 spots for SRR7169743.sra Read 586935 spots for SRR7169743.sra Written 586935 spots for SRR7169743.sra Read 586935 spots for SRR7169743.sra Written 586935 spots for SRR7169743.sra Read 586935 spots for SRR7169743.sra Written 586935 spots for SRR7169743.sra Read 586935 spots for SRR7169743.sra Written 586935 spots for SRR7169743.sra Read 586935 spots for SRR7169743.sra Written 586935 spots for SRR7169743.sra Read 586935 spots for SRR7169743.sra Written 586935 spots for SRR7169743.sra Read 586935 spots for SRR7169743.sra Written 586935 spots for SRR7169743.sra Read 586935 spots for SRR7169743.sra Written 586935 spots for SRR7169743.sra Read 586935 spots for SRR7169743.sra Written 586935 spots for SRR7169743.sra Read 586935 spots for SRR7169743.sra Written 586935 spots for SRR7169743.sra Read 586935 spots for SRR7169743.sra Written 586935 spots for SRR7169743.sra Read 586944 spots for SRR7169743.sra Written 586944 spots for SRR7169743.sra SRR ids: ['SRR7169743.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__aeb4udb SRR7169743.sra spots: 11738709 blocks: [[1, 586935], [586936, 1173870], [1173871, 1760805], [1760806, 2347740], [2347741, 2934675], [2934676, 3521610], [3521611, 4108545], [4108546, 4695480], [4695481, 5282415], [5282416, 5869350], [5869351, 6456285], [6456286, 7043220], [7043221, 7630155], [7630156, 8217090], [8217091, 8804025], [8804026, 9390960], [9390961, 9977895], [9977896, 10564830], [10564831, 11151765], [11151766, 11738709]] SRR7169743 file size 3956162 SRR7169743 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169743 SRR7169743_1.fastq SRR7169743_2.fastq Input file: SRR7169743_1.fastq Paired file: SRR7169743_2.fastq trimmed: SRR7169743-trimmed-pair1.fastq, SRR7169743-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 12:41:54 2025 >> started Tue Feb 11 12:42:06 2025 >> done (12.140s) 11738709 read pairs processed; of these: 7802 ( 0.07%) short read pairs filtered out after trimming by size control 11684 ( 0.10%) empty read pairs filtered out after trimming by size control 11719223 (99.83%) read pairs available; of these: 5276522 (45.02%) trimmed read pairs available after processing 6442701 (54.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 0 0.00% 20 0 0.00% 21 1 0.00% 22 4 0.00% 23 3 0.00% 24 3 0.00% 25 4 0.00% 26 4 0.00% 27 6 0.00% 28 6 0.00% 29 8 0.00% 30 12 0.00% 31 6 0.00% 32 15 0.00% 33 11 0.00% 34 13 0.00% 35 15 0.00% 36 17 0.00% 37 24 0.00% 38 34 0.00% 39 30 0.00% 40 38 0.00% 41 67 0.00% 42 71 0.00% 43 77 0.00% 44 76 0.00% 45 85 0.00% 46 102 0.00% 47 108 0.00% 48 131 0.00% 49 163 0.00% 50 170 0.00% 51 217 0.00% 52 257 0.00% 53 285 0.00% 54 290 0.00% 55 291 0.00% 56 283 0.00% 57 328 0.00% 58 417 0.00% 59 467 0.00% 60 574 0.00% 61 669 0.01% 62 681 0.01% 63 783 0.01% 64 833 0.01% 65 946 0.01% 66 1025 0.01% 67 1153 0.01% 68 1207 0.01% 69 1429 0.01% 70 1636 0.01% 71 1893 0.02% 72 2145 0.02% 73 2404 0.02% 74 2678 0.02% 75 2916 0.02% 76 3572 0.03% 77 3699 0.03% 78 3712 0.03% 79 4024 0.03% 80 4392 0.04% 81 5013 0.04% 82 5541 0.05% 83 6199 0.05% 84 7252 0.06% 85 7913 0.07% 86 8224 0.07% 87 8723 0.07% 88 9317 0.08% 89 9930 0.08% 90 10628 0.09% 91 11497 0.10% 92 12281 0.10% 93 13374 0.11% 94 14348 0.12% 95 15129 0.13% 96 15771 0.13% 97 16234 0.14% 98 17202 0.15% 99 17467 0.15% 100 18179 0.16% 101 19209 0.16% 102 20325 0.17% 103 21597 0.18% 104 22329 0.19% 105 23398 0.20% 106 24153 0.21% 107 24569 0.21% 108 25226 0.22% 109 25345 0.22% 110 25948 0.22% 111 27107 0.23% 112 27866 0.24% 113 29036 0.25% 114 30545 0.26% 115 31385 0.27% 116 31907 0.27% 117 32376 0.28% 118 33065 0.28% 119 33242 0.28% 120 33440 0.29% 121 33981 0.29% 122 34887 0.30% 123 35944 0.31% 124 37879 0.32% 125 38218 0.33% 126 39334 0.34% 127 40744 0.35% 128 40955 0.35% 129 40938 0.35% 130 41929 0.36% 131 42683 0.36% 132 43191 0.37% 133 44669 0.38% 134 45435 0.39% 135 46726 0.40% 136 48657 0.42% 137 49832 0.43% 138 51824 0.44% 139 53608 0.46% 140 55777 0.48% 141 58958 0.50% 142 62838 0.54% 143 66581 0.57% 144 75998 0.65% 145 84282 0.72% 146 99875 0.85% 147 131235 1.12% 148 192876 1.65% 149 404909 3.46% 150 2412956 20.59% 151 6442701 54.98% 11719223 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=40 prefix-density=0.16 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGC criterion=fanout-score sequence-density=0.12 sequence-density-rank=10 fanout-score=99.76 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=18.9 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.78 fanout-score-rank=35 prefix-density=0.25 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=19 fanout-score=66.20 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=15.5 sequence=TGTTGGTGGTGG SRR7169743 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 12:42:48 Started mapping on | Feb 11 12:42:48 Finished on | Feb 11 12:43:51 Mapping speed, Million of reads per hour | 669.67 Number of input reads | 11719223 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 11139549 Uniquely mapped reads % | 95.05% Average mapped length | 290.67 Number of splices: Total | 10675615 Number of splices: Annotated (sjdb) | 10496867 Number of splices: GT/AG | 10518804 Number of splices: GC/AG | 126010 Number of splices: AT/AC | 8834 Number of splices: Non-canonical | 21967 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 209220 % of reads mapped to multiple loci | 1.79% Number of reads mapped to too many loci | 163474 % of reads mapped to too many loci | 1.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.57% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 377372 377372 377372 N_multimapping 209220 209220 209220 N_noFeature 293409 11024083 348696 N_ambiguous 103181 660 42484 UnstrandedReadsAssigned:10742959 PositiveStrandReadsAssigned:114806 NegativeStrandReadsAssigned:10748369 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169743 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169743-trimmed-pair1.fastq SRR7169743-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,719,223 reads, 10,784,373 reads pseudoaligned [quant] estimated average fragment length: 218.764 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,130 rounds 52401 SRR7169743.ke.tsv 34699 SRR7169743.se.tsv 87100 total ==> SRR7169743.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1800.24 186 10.3249 Potri.005G024800.1.v4.1 1035 817.236 42 5.13577 Potri.004G059700.1.v4.1 961 743.252 5 0.672261 Potri.007G009000.2.v4.1 1416 1198.24 0 0 Potri.003G141000.2.v4.1 2943 2725.24 241.035 8.83851 Potri.016G087400.1.v4.1 270 92.2404 1008 1092.05 Potri.015G069301.1.v4.1 564 349.457 0 0 Potri.010G195200.1.v4.1 1773 1555.24 9 0.578296 Potri.012G127500.1.v4.1 977 759.236 3529 464.492 ==> SRR7169743.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 546 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 156 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7169743 completed mapping pipeline successfully