Starting /dee2/code/volunteer_pipeline.sh SRR7169744 current disk space = 3050966474752 free memory = 1440476704 SRR7169744 SRAfilesize 527a8a3fc8f42259d93a3c495cb943c9 SRR7169744.sra SRR7169744.sra file validated SRR7169744 is paired end SRR7169744 is conventional basespace SRR7169744 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169744_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.14775 18.0 18.0 25.0 18.0 32.0 2 30.3275 31.0 29.0 31.0 27.0 33.0 3 31.64675 33.0 31.0 33.0 29.0 33.0 4 32.3485 33.0 33.0 33.0 31.0 33.0 5 32.9975 33.0 33.0 34.0 33.0 34.0 6 37.035 38.0 37.0 38.0 36.0 38.0 7 37.37175 38.0 38.0 38.0 37.0 38.0 8 36.7635 38.0 38.0 38.0 35.0 38.0 9 37.4275 38.0 38.0 38.0 37.0 38.0 10-14 37.534949999999995 38.0 38.0 38.0 37.4 38.0 15-19 36.714349999999996 38.0 37.8 38.0 34.2 38.0 20-24 37.5522 38.0 38.0 38.0 37.6 38.0 25-29 37.507999999999996 38.0 38.0 38.0 37.6 38.0 30-34 37.37335 38.0 38.0 38.0 37.2 38.0 35-39 37.2564 38.0 38.0 38.0 36.8 38.0 40-44 37.02085000000001 38.0 38.0 38.0 36.0 38.0 45-49 36.72789999999999 38.0 38.0 38.0 34.8 38.0 50-54 37.2872 38.0 38.0 38.0 36.6 38.0 55-59 37.3082 38.0 38.0 38.0 36.8 38.0 60-64 37.303549999999994 38.0 38.0 38.0 36.4 38.0 65-69 37.1911 38.0 38.0 38.0 36.0 38.0 70-74 37.092699999999994 38.0 38.0 38.0 36.0 38.0 75-79 37.00175 38.0 38.0 38.0 35.8 38.0 80-84 36.937349999999995 38.0 38.0 38.0 35.6 38.0 85-89 36.8298 38.0 38.0 38.0 35.0 38.0 90-94 36.65215 38.0 38.0 38.0 34.2 38.0 95-99 36.562200000000004 38.0 37.8 38.0 34.0 38.0 100-104 36.64955 38.0 38.0 38.0 34.0 38.0 105-109 36.42435 38.0 37.6 38.0 33.8 38.0 110-114 35.86485 38.0 36.8 38.0 31.4 38.0 115-119 35.97315 38.0 36.8 38.0 32.4 38.0 120-124 35.99705 38.0 36.8 38.0 32.4 38.0 125-129 35.698150000000005 38.0 36.0 38.0 31.6 38.0 130-134 34.989 38.0 35.4 38.0 27.0 38.0 135-139 34.77575 38.0 34.8 38.0 27.0 38.0 140-144 34.692949999999996 38.0 35.0 38.0 27.4 38.0 145-149 33.917899999999996 38.0 34.8 38.0 23.6 38.0 150-151 30.25425 36.5 28.5 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 2.0 17 0.0 18 0.0 19 2.0 20 2.0 21 4.0 22 1.0 23 7.0 24 5.0 25 6.0 26 8.0 27 19.0 28 20.0 29 20.0 30 40.0 31 66.0 32 81.0 33 124.0 34 193.0 35 369.0 36 969.0 37 2060.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.69593577521324 10.260913196186653 10.411440040140493 37.63171098845961 2 22.925 15.024999999999999 33.2 28.849999999999998 3 20.02509410288582 17.66624843161857 27.55332496863237 34.75533249686324 4 22.900000000000002 27.275 22.625 27.200000000000003 5 23.0 32.300000000000004 24.65 20.05 6 19.45 35.975 23.7 20.875 7 15.625 26.625 39.95 17.8 8 17.95 25.624999999999996 31.3 25.124999999999996 9 16.975 24.325 34.775 23.925 10-14 19.575 29.909999999999997 27.435 23.080000000000002 15-19 19.935 28.525 28.189999999999998 23.35 20-24 20.09 29.26 27.67 22.98 25-29 20.36 29.34 27.3 23.0 30-34 20.185 29.12 27.310000000000002 23.385 35-39 19.545 28.585 28.194999999999997 23.674999999999997 40-44 20.185 29.330000000000002 27.715 22.770000000000003 45-49 20.18 28.305000000000003 27.595 23.919999999999998 50-54 20.375 29.134999999999998 27.12 23.369999999999997 55-59 20.145 28.18 27.67 24.005000000000003 60-64 20.32 29.14 26.845000000000002 23.695 65-69 19.7 29.215000000000003 27.365000000000002 23.72 70-74 19.885 28.48 27.6 24.035 75-79 20.315 28.325 27.71 23.65 80-84 19.765 28.165000000000003 28.134999999999998 23.935000000000002 85-89 19.965 28.299999999999997 28.12 23.615 90-94 20.34 28.055000000000003 27.505000000000003 24.099999999999998 95-99 20.25 28.005000000000003 27.87 23.875 100-104 20.845 29.075 26.205000000000002 23.875 105-109 20.574258416287332 28.642889300185082 27.06217798009104 23.720674303436546 110-114 20.455000000000002 28.935 27.134999999999998 23.474999999999998 115-119 20.94 28.67 26.75 23.64 120-124 20.91 28.405 26.935 23.75 125-129 20.575 28.155 27.16 24.11 130-134 21.27 28.48 26.41 23.84 135-139 21.12 28.265 26.525 24.09 140-144 21.67 28.244999999999997 26.115 23.97 145-149 21.385 28.465 25.605 24.545 150-151 21.925 27.787499999999998 26.0625 24.224999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.0 23 1.0 24 2.5 25 3.5 26 4.0 27 7.0 28 10.5 29 12.0 30 14.0 31 19.5 32 37.5 33 46.0 34 51.5 35 80.0 36 93.0 37 97.5 38 123.0 39 158.0 40 180.5 41 206.5 42 243.0 43 267.0 44 290.0 45 302.0 46 282.0 47 244.5 48 232.5 49 208.5 50 167.5 51 146.0 52 111.5 53 88.0 54 73.0 55 49.0 56 35.5 57 24.0 58 18.5 59 16.0 60 12.5 61 9.0 62 5.0 63 4.5 64 2.5 65 2.0 66 2.5 67 1.5 68 2.5 69 3.5 70 1.5 71 0.5 72 1.0 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.375 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.045 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57297161517207 99.1 2 0.37678975131876413 0.75 3 0.050238633509168545 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.2875 0.0 0.0 0.0 0.0 76-77 0.3375 0.0 0.0 0.0 0.0 78-79 0.3875 0.0 0.0 0.0 0.0 80-81 0.525 0.0 0.0 0.0 0.0 82-83 0.6625 0.0 0.0 0.0 0.0 84-85 0.75 0.0 0.0 0.0 0.0 86-87 0.8375 0.0 0.0 0.0 0.0 88-89 0.9625 0.0 0.0 0.0 0.0 90-91 1.1125 0.0 0.0 0.0 0.0 92-93 1.3125 0.0 0.0 0.0 0.0 94-95 1.6 0.0 0.0 0.0 0.0 96-97 1.8375 0.0 0.0 0.0 0.0 98-99 2.175 0.0 0.0 0.0 0.0 100-101 2.4125 0.0 0.0 0.0 0.0 102-103 2.7874999999999996 0.0 0.0 0.0 0.0 104-105 3.2249999999999996 0.0 0.0 0.0 0.0 106-107 3.725 0.0 0.0 0.0 0.0 108-109 4.1625 0.0 0.0 0.0 0.0 110-111 4.5875 0.0 0.0 0.0 0.0 112-113 5.2 0.0 0.0 0.0 0.0 114-115 5.824999999999999 0.0 0.0 0.0 0.0 116-117 6.4625 0.0 0.0 0.0 0.0 118-119 7.025 0.0 0.0 0.0 0.0 120-121 7.75 0.0 0.0 0.0 0.0 122-123 8.350000000000001 0.0 0.0 0.0 0.0 124-125 8.95 0.0 0.0 0.0 0.0 126-127 9.425 0.0 0.0 0.0 0.0 128-129 10.149999999999999 0.0 0.0 0.0 0.0 130-131 10.9 0.0 0.0 0.0 0.0 132-133 11.725 0.0 0.0 0.0 0.0 134-135 12.5 0.0 0.0 0.0 0.0 136-137 13.175 0.0 0.0 0.0 0.0 138-139 13.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAAACAA 10 0.006830828 145.0 4 GGGTAAG 10 0.006830828 145.0 1 >>END_MODULE SRR7169744 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169744_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9675 33.0 33.0 34.0 32.0 34.0 2 33.12275 33.0 33.0 34.0 32.0 34.0 3 33.1115 34.0 33.0 34.0 32.0 34.0 4 33.08325 34.0 33.0 34.0 32.0 34.0 5 33.10175 34.0 33.0 34.0 32.0 34.0 6 37.33875 38.0 38.0 38.0 37.0 38.0 7 37.3845 38.0 38.0 38.0 37.0 38.0 8 37.36175 38.0 38.0 38.0 37.0 38.0 9 37.3535 38.0 38.0 38.0 37.0 38.0 10-14 36.987399999999994 38.0 38.0 38.0 36.0 38.0 15-19 37.2513 38.0 38.0 38.0 37.0 38.0 20-24 37.161249999999995 38.0 38.0 38.0 36.8 38.0 25-29 37.240750000000006 38.0 38.0 38.0 37.0 38.0 30-34 36.776250000000005 38.0 37.8 38.0 35.4 38.0 35-39 37.131299999999996 38.0 38.0 38.0 36.6 38.0 40-44 36.48155 38.0 37.4 38.0 33.6 38.0 45-49 37.24165000000001 38.0 38.0 38.0 37.0 38.0 50-54 36.853049999999996 38.0 38.0 38.0 35.2 38.0 55-59 36.783 38.0 38.0 38.0 35.4 38.0 60-64 36.9777 38.0 38.0 38.0 36.0 38.0 65-69 36.71635 38.0 38.0 38.0 35.2 38.0 70-74 36.690549999999995 38.0 38.0 38.0 35.4 38.0 75-79 36.618 38.0 38.0 38.0 34.6 38.0 80-84 36.56005 38.0 37.8 38.0 34.6 38.0 85-89 36.8052 38.0 38.0 38.0 35.4 38.0 90-94 36.50055 38.0 38.0 38.0 34.4 38.0 95-99 36.65495 38.0 38.0 38.0 34.8 38.0 100-104 36.247299999999996 38.0 38.0 38.0 34.0 38.0 105-109 34.8044 38.0 36.6 38.0 26.6 38.0 110-114 34.00055 38.0 36.0 38.0 20.6 38.0 115-119 33.573 38.0 36.0 38.0 15.4 38.0 120-124 33.129 38.0 34.4 38.0 14.0 38.0 125-129 34.21725000000001 38.0 35.4 38.0 23.6 38.0 130-134 34.4137 38.0 34.8 38.0 24.6 38.0 135-139 34.550200000000004 38.0 35.2 38.0 26.2 38.0 140-144 34.46445000000001 38.0 34.8 38.0 26.6 38.0 145-149 33.8727 38.0 33.4 38.0 25.0 38.0 150-151 29.415125 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 2.0 4 1.0 5 0.0 6 1.0 7 0.0 8 0.0 9 1.0 10 3.0 11 0.0 12 0.0 13 4.0 14 4.0 15 3.0 16 1.0 17 5.0 18 5.0 19 1.0 20 4.0 21 4.0 22 6.0 23 10.0 24 14.0 25 19.0 26 29.0 27 22.0 28 27.0 29 48.0 30 75.0 31 84.0 32 121.0 33 136.0 34 198.0 35 326.0 36 657.0 37 2185.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.7 22.55 12.475 27.275 2 27.925 25.650000000000002 30.049999999999997 16.375 3 20.78019504876219 27.70692673168292 30.532633158289574 20.980245061265315 4 23.974999999999998 34.949999999999996 23.225 17.849999999999998 5 25.15 35.325 21.8 17.724999999999998 6 20.674999999999997 38.925 23.425 16.975 7 21.275 21.475 38.2 19.05 8 22.225 24.45 28.575 24.75 9 22.525000000000002 24.625 30.75 22.1 10-14 23.845 29.095 26.290000000000003 20.77 15-19 22.869999999999997 28.060000000000002 28.22 20.849999999999998 20-24 23.44 27.975 27.73 20.855 25-29 23.380000000000003 27.98 27.884999999999998 20.755000000000003 30-34 23.165 28.02 28.185 20.630000000000003 35-39 23.53 27.88 27.675 20.915 40-44 23.015 27.779999999999998 27.88 21.325 45-49 23.565 26.85 28.349999999999998 21.235 50-54 23.755000000000003 28.01 27.845 20.39 55-59 23.28 27.51 28.09 21.12 60-64 23.36 27.805000000000003 28.275 20.560000000000002 65-69 23.57 26.995 28.384999999999998 21.05 70-74 23.715890850722314 27.758828250401287 28.380818619582666 20.14446227929374 75-79 23.207490486681355 28.0242339274985 28.544962948127377 20.22331263769277 80-84 23.385846461615404 27.56689172293073 28.342085521380344 20.705176294073517 85-89 23.78 28.110000000000003 27.495000000000005 20.615 90-94 23.54 27.529999999999998 28.28 20.65 95-99 24.27 27.73 27.500000000000004 20.5 100-104 24.394515612489993 27.797237790232188 28.007405924739793 19.80084067253803 105-109 24.66618734593262 27.783483976992606 27.50102711585867 20.049301561216105 110-114 24.72204740927208 27.816236626809314 27.37046360394378 20.091252359974828 115-119 24.7916554653476 27.77568686488521 27.415452443679765 20.017205226087423 120-124 24.88886536833192 28.662150719729045 26.619390347163417 19.829593564775614 125-129 25.492705400563093 28.26721269516253 26.808292807780905 19.431789096493475 130-134 25.819856806689028 27.89766184348871 26.66099233965854 19.62148901016372 135-139 25.795 27.82 26.895000000000003 19.49 140-144 26.07 28.17 26.36 19.400000000000002 145-149 26.185000000000002 27.92 26.995 18.9 150-151 27.6875 27.187499999999996 27.575 17.549999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 1.5 24 2.0 25 1.0 26 1.5 27 3.5 28 6.0 29 9.5 30 13.5 31 18.5 32 23.5 33 35.0 34 50.5 35 66.5 36 86.0 37 104.5 38 129.0 39 158.0 40 194.5 41 223.0 42 239.0 43 258.0 44 279.0 45 297.0 46 282.5 47 264.0 48 256.5 49 214.0 50 173.5 51 144.5 52 108.0 53 79.5 54 68.5 55 56.0 56 35.5 57 27.0 58 19.5 59 13.5 60 10.0 61 5.5 62 6.0 63 9.0 64 7.5 65 4.5 66 3.0 67 2.5 68 2.5 69 2.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.32 75-79 0.13999999999999999 80-84 0.025 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.08 105-109 2.64 110-114 4.66 115-119 7.005 120-124 5.52 125-129 2.325 130-134 0.135 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67377666248431 99.3 2 0.301129234629862 0.6 3 0.0 0.0 4 0.02509410288582183 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.2875 0.0 0.0 0.0 0.0 76-77 0.3625 0.0 0.0 0.0 0.0 78-79 0.4125 0.0 0.0 0.0 0.0 80-81 0.55 0.0 0.0 0.0 0.0 82-83 0.6875 0.0 0.0 0.0 0.0 84-85 0.775 0.0 0.0 0.0 0.0 86-87 0.8625 0.0 0.0 0.0 0.0 88-89 0.9874999999999999 0.0 0.0 0.0 0.0 90-91 1.1375 0.0 0.0 0.0 0.0 92-93 1.3375 0.0 0.0 0.0 0.0 94-95 1.6125 0.0 0.0 0.0 0.0 96-97 1.8125 0.0 0.0 0.0 0.0 98-99 2.1500000000000004 0.0 0.0 0.0 0.0 100-101 2.3875 0.0 0.0 0.0 0.0 102-103 2.75 0.0 0.0 0.0 0.0 104-105 3.1375 0.0 0.0 0.0 0.0 106-107 3.5625 0.0 0.0 0.0 0.0 108-109 3.9625 0.0 0.0 0.0 0.0 110-111 4.3875 0.0 0.0 0.0 0.0 112-113 4.9375 0.0 0.0 0.0 0.0 114-115 5.5 0.0 0.0 0.0 0.0 116-117 6.0875 0.0 0.0 0.0 0.0 118-119 6.575 0.0 0.0 0.0 0.0 120-121 7.2 0.0 0.0 0.0 0.0 122-123 7.762499999999999 0.0 0.0 0.0 0.0 124-125 8.3625 0.0 0.0 0.0 0.0 126-127 8.8375 0.0 0.0 0.0 0.0 128-129 9.575 0.0 0.0 0.0 0.0 130-131 10.325 0.0 0.0 0.0 0.0 132-133 11.175 0.0 0.0 0.0 0.0 134-135 11.95 0.0 0.0 0.0 0.0 136-137 12.65 0.0 0.0 0.0 0.0 138-139 13.412500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAAAAC 10 0.007107461 143.0875 3 CACGATC 10 0.007107461 143.0875 9 GTGTAGA 20 3.7823367E-4 107.31562 145 >>END_MODULE Read 962470 spots for SRR7169744.sra Written 962470 spots for SRR7169744.sra Read 962470 spots for SRR7169744.sra Written 962470 spots for SRR7169744.sra Read 962470 spots for SRR7169744.sra Written 962470 spots for SRR7169744.sra Read 962470 spots for SRR7169744.sra Written 962470 spots for SRR7169744.sra Read 962470 spots for SRR7169744.sra Written 962470 spots for SRR7169744.sra Read 962470 spots for SRR7169744.sra Written 962470 spots for SRR7169744.sra Read 962470 spots for SRR7169744.sra Written 962470 spots for SRR7169744.sra Read 962470 spots for SRR7169744.sra Written 962470 spots for SRR7169744.sra Read 962470 spots for SRR7169744.sra Written 962470 spots for SRR7169744.sra Read 962470 spots for SRR7169744.sra Written 962470 spots for SRR7169744.sra Read 962470 spots for SRR7169744.sra Written 962470 spots for SRR7169744.sra Read 962470 spots for SRR7169744.sra Written 962470 spots for SRR7169744.sra Read 962470 spots for SRR7169744.sra Written 962470 spots for SRR7169744.sra Read 962470 spots for SRR7169744.sra Written 962470 spots for SRR7169744.sra Read 962470 spots for SRR7169744.sra Written 962470 spots for SRR7169744.sra Read 962482 spots for SRR7169744.sra Written 962482 spots for SRR7169744.sra Read 962470 spots for SRR7169744.sra Written 962470 spots for SRR7169744.sra Read 962470 spots for SRR7169744.sra Written 962470 spots for SRR7169744.sra Read 962470 spots for SRR7169744.sra Written 962470 spots for SRR7169744.sra Read 962470 spots for SRR7169744.sra Written 962470 spots for SRR7169744.sra SRR ids: ['SRR7169744.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_exhm8691 SRR7169744.sra spots: 19249412 blocks: [[1, 962470], [962471, 1924940], [1924941, 2887410], [2887411, 3849880], [3849881, 4812350], [4812351, 5774820], [5774821, 6737290], [6737291, 7699760], [7699761, 8662230], [8662231, 9624700], [9624701, 10587170], [10587171, 11549640], [11549641, 12512110], [12512111, 13474580], [13474581, 14437050], [14437051, 15399520], [15399521, 16361990], [16361991, 17324460], [17324461, 18286930], [18286931, 19249412]] SRR7169744 file size 6501293 SRR7169744 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169744 SRR7169744_1.fastq SRR7169744_2.fastq Input file: SRR7169744_1.fastq Paired file: SRR7169744_2.fastq trimmed: SRR7169744-trimmed-pair1.fastq, SRR7169744-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 12:24:06 2025 >> started Tue Feb 11 12:24:35 2025 >> done (28.211s) 19249412 read pairs processed; of these: 9143 ( 0.05%) short read pairs filtered out after trimming by size control 12409 ( 0.06%) empty read pairs filtered out after trimming by size control 19227860 (99.89%) read pairs available; of these: 10109495 (52.58%) trimmed read pairs available after processing 9118365 (47.42%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 2 0.00% 21 5 0.00% 22 3 0.00% 23 3 0.00% 24 4 0.00% 25 3 0.00% 26 3 0.00% 27 6 0.00% 28 7 0.00% 29 8 0.00% 30 8 0.00% 31 7 0.00% 32 10 0.00% 33 13 0.00% 34 7 0.00% 35 19 0.00% 36 12 0.00% 37 32 0.00% 38 28 0.00% 39 34 0.00% 40 48 0.00% 41 62 0.00% 42 86 0.00% 43 72 0.00% 44 102 0.00% 45 96 0.00% 46 127 0.00% 47 148 0.00% 48 155 0.00% 49 168 0.00% 50 231 0.00% 51 262 0.00% 52 297 0.00% 53 314 0.00% 54 354 0.00% 55 402 0.00% 56 466 0.00% 57 530 0.00% 58 609 0.00% 59 686 0.00% 60 912 0.00% 61 963 0.01% 62 1130 0.01% 63 1262 0.01% 64 1372 0.01% 65 1546 0.01% 66 1768 0.01% 67 1971 0.01% 68 2182 0.01% 69 2599 0.01% 70 2924 0.02% 71 3337 0.02% 72 3837 0.02% 73 4509 0.02% 74 4926 0.03% 75 5524 0.03% 76 6100 0.03% 77 6632 0.03% 78 7134 0.04% 79 8072 0.04% 80 9081 0.05% 81 9975 0.05% 82 11111 0.06% 83 12407 0.06% 84 14426 0.08% 85 16006 0.08% 86 17092 0.09% 87 18252 0.09% 88 19960 0.10% 89 20843 0.11% 90 21958 0.11% 91 23765 0.12% 92 25454 0.13% 93 27456 0.14% 94 29408 0.15% 95 31516 0.16% 96 33141 0.17% 97 34668 0.18% 98 35670 0.19% 99 36969 0.19% 100 38320 0.20% 101 39835 0.21% 102 41948 0.22% 103 43648 0.23% 104 45456 0.24% 105 48151 0.25% 106 50192 0.26% 107 50930 0.26% 108 52780 0.27% 109 54153 0.28% 110 54577 0.28% 111 55985 0.29% 112 58144 0.30% 113 59799 0.31% 114 61591 0.32% 115 64520 0.34% 116 65899 0.34% 117 67621 0.35% 118 69224 0.36% 119 69227 0.36% 120 70743 0.37% 121 71525 0.37% 122 73588 0.38% 123 74962 0.39% 124 77909 0.41% 125 80604 0.42% 126 82312 0.43% 127 84121 0.44% 128 86148 0.45% 129 87184 0.45% 130 89053 0.46% 131 89322 0.46% 132 91780 0.48% 133 94746 0.49% 134 95130 0.49% 135 99086 0.52% 136 101845 0.53% 137 105865 0.55% 138 110614 0.58% 139 114386 0.59% 140 119347 0.62% 141 126688 0.66% 142 135596 0.71% 143 147059 0.76% 144 165284 0.86% 145 191311 0.99% 146 235255 1.22% 147 306564 1.59% 148 433779 2.26% 149 837719 4.36% 150 4014676 20.88% 151 9118365 47.42% 19227860 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.67 fanout-score-rank=35 prefix-density=0.19 prefix-fanout=2.4 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.10 sequence-density-rank=16 fanout-score=237.51 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=27.4 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=3.58 fanout-score-rank=36 prefix-density=0.27 prefix-fanout=2.9 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=18 fanout-score=262.36 fanout-score-rank=1 prefix-density=0.95 prefix-fanout=27.3 sequence=AAGAAGAAGAAG SRR7169744 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 12:25:17 Started mapping on | Feb 11 12:25:17 Finished on | Feb 11 12:26:55 Mapping speed, Million of reads per hour | 706.33 Number of input reads | 19227860 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 18091719 Uniquely mapped reads % | 94.09% Average mapped length | 287.95 Number of splices: Total | 16034069 Number of splices: Annotated (sjdb) | 15745394 Number of splices: GT/AG | 15793459 Number of splices: GC/AG | 189521 Number of splices: AT/AC | 13502 Number of splices: Non-canonical | 37587 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 351543 % of reads mapped to multiple loci | 1.83% Number of reads mapped to too many loci | 422166 % of reads mapped to too many loci | 2.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.57% % of reads unmapped: other | 0.31% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 794048 794048 794048 N_multimapping 351543 351543 351543 N_noFeature 471651 17856864 585715 N_ambiguous 193692 1156 72041 UnstrandedReadsAssigned:17426376 PositiveStrandReadsAssigned:233699 NegativeStrandReadsAssigned:17433963 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=144 echo kmer=139 SRR7169744 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169744-trimmed-pair1.fastq SRR7169744-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,227,860 reads, 17,637,015 reads pseudoaligned [quant] estimated average fragment length: 206.076 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,067 rounds 52401 SRR7169744.ke.tsv 34699 SRR7169744.se.tsv 87100 total ==> SRR7169744.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1812.92 264 8.47347 Potri.005G024800.1.v4.1 1035 829.924 44 3.08498 Potri.004G059700.1.v4.1 961 755.929 10 0.769761 Potri.007G009000.2.v4.1 1416 1210.92 0 0 Potri.003G141000.2.v4.1 2943 2737.92 283.031 6.01519 Potri.016G087400.1.v4.1 270 96.8714 1401 841.55 Potri.015G069301.1.v4.1 564 360.75 0 0 Potri.010G195200.1.v4.1 1773 1567.92 35 1.29891 Potri.012G127500.1.v4.1 977 771.924 5635 424.773 ==> SRR7169744.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2280 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 272 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 15 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169744 completed mapping pipeline successfully