Starting /dee2/code/volunteer_pipeline.sh SRR7169745 current disk space = 3050618646528 free memory = 1490978732 SRR7169745 SRAfilesize e351ae6c4a3cfb767d448b39b19dc5e5 SRR7169745.sra SRR7169745.sra file validated SRR7169745 is paired end SRR7169745 is conventional basespace SRR7169745 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169745_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.979 18.0 18.0 18.0 18.0 32.0 2 29.00175 28.0 27.0 32.0 25.0 32.0 3 30.7525 31.0 30.0 33.0 27.0 33.0 4 31.9705 33.0 31.0 33.0 30.0 33.0 5 32.40875 33.0 33.0 33.0 32.0 34.0 6 36.3605 38.0 36.0 38.0 34.0 38.0 7 36.9275 38.0 37.0 38.0 35.0 38.0 8 37.2645 38.0 38.0 38.0 36.0 38.0 9 37.398 38.0 38.0 38.0 37.0 38.0 10-14 37.497949999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.523649999999996 38.0 38.0 38.0 37.4 38.0 20-24 37.5638 38.0 38.0 38.0 37.8 38.0 25-29 37.57520000000001 38.0 38.0 38.0 38.0 38.0 30-34 37.563100000000006 38.0 38.0 38.0 38.0 38.0 35-39 37.49285 38.0 38.0 38.0 37.6 38.0 40-44 37.43155 38.0 38.0 38.0 37.0 38.0 45-49 37.4788 38.0 38.0 38.0 37.6 38.0 50-54 37.359049999999996 38.0 38.0 38.0 36.8 38.0 55-59 37.18765 38.0 38.0 38.0 36.8 38.0 60-64 37.21395 38.0 38.0 38.0 36.6 38.0 65-69 37.2455 38.0 38.0 38.0 36.6 38.0 70-74 37.29335 38.0 38.0 38.0 37.0 38.0 75-79 37.1928 38.0 38.0 38.0 36.2 38.0 80-84 37.09805000000001 38.0 38.0 38.0 36.0 38.0 85-89 36.92945 38.0 38.0 38.0 35.8 38.0 90-94 36.864999999999995 38.0 38.0 38.0 35.6 38.0 95-99 36.886649999999996 38.0 38.0 38.0 35.4 38.0 100-104 36.8759 38.0 38.0 38.0 35.0 38.0 105-109 36.57785 38.0 38.0 38.0 34.4 38.0 110-114 36.3755 38.0 38.0 38.0 34.0 38.0 115-119 36.38525 38.0 37.8 38.0 34.0 38.0 120-124 36.32765 38.0 37.8 38.0 33.8 38.0 125-129 36.23635 38.0 37.4 38.0 34.0 38.0 130-134 35.85585 38.0 36.6 38.0 32.6 38.0 135-139 35.61345 38.0 36.0 38.0 31.8 38.0 140-144 35.22515 38.0 36.0 38.0 29.8 38.0 145-149 35.017 38.0 36.0 38.0 30.6 38.0 150-151 31.276625000000003 36.5 30.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 1.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 1.0 20 2.0 21 2.0 22 7.0 23 4.0 24 6.0 25 4.0 26 17.0 27 11.0 28 19.0 29 20.0 30 34.0 31 38.0 32 54.0 33 97.0 34 142.0 35 250.0 36 723.0 37 2564.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.7160030052592 14.47533183070373 9.216128224392687 38.592536939644376 2 21.45 16.025 34.975 27.55 3 19.45 21.125 25.474999999999998 33.95 4 22.025 30.025000000000002 22.875 25.074999999999996 5 22.425 33.825 23.625 20.125 6 19.675 35.975 24.725 19.625 7 14.45 24.925 42.625 18.0 8 18.179544886221557 24.831207801950487 31.48287071767942 25.506376594148538 9 17.65 24.8 32.75 24.8 10-14 19.755 30.04 26.575 23.630000000000003 15-19 19.54 29.175 27.589999999999996 23.695 20-24 20.175 28.92 28.110000000000003 22.795 25-29 19.84 29.65 27.0 23.51 30-34 19.915 28.685 27.43 23.97 35-39 19.955000000000002 29.15 27.060000000000002 23.835 40-44 20.369999999999997 29.365000000000002 26.625 23.64 45-49 20.195 28.505000000000003 27.625 23.674999999999997 50-54 20.025000000000002 28.754999999999995 27.775 23.445 55-59 20.0 28.799999999999997 27.534999999999997 23.665 60-64 19.865 28.665000000000003 27.905 23.565 65-69 19.725 29.15 26.93 24.195 70-74 19.97 28.78 27.92 23.330000000000002 75-79 19.73 28.62 27.855 23.794999999999998 80-84 20.285 28.125 27.785 23.805 85-89 20.49 28.54 27.265 23.705000000000002 90-94 20.365 28.825 27.07 23.74 95-99 20.34 27.994999999999997 27.815 23.849999999999998 100-104 20.28 28.494999999999997 27.744999999999997 23.48 105-109 20.496613995485326 28.94908452470529 26.917481815901677 23.636819663907698 110-114 20.488882196456355 28.861115293881447 27.425588515785776 23.224413993876425 115-119 21.006050302515124 28.651432571628582 27.146357317865892 23.196159807990398 120-124 20.669999999999998 28.665000000000003 26.685 23.98 125-129 20.57602880144007 28.816440822041102 26.511325566278316 24.09620481024051 130-134 20.392039203920394 29.05290529052905 26.742674267426743 23.812381238123812 135-139 20.63603180159008 28.296414820741038 26.75133756687834 24.31621581079054 140-144 20.672067206720673 28.972897289728973 26.67766776677668 23.67736773677368 145-149 20.825 28.655 26.76 23.76 150-151 21.038148843026892 28.242651657285805 26.59161976235147 24.127579737335836 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 0.5 25 0.5 26 2.5 27 6.5 28 11.0 29 12.0 30 14.0 31 21.5 32 34.5 33 45.5 34 56.5 35 70.5 36 83.5 37 103.5 38 135.5 39 169.5 40 200.0 41 215.5 42 226.5 43 257.5 44 269.5 45 262.5 46 269.0 47 264.5 48 262.5 49 238.5 50 178.0 51 144.0 52 121.5 53 96.5 54 74.5 55 48.5 56 29.0 57 21.5 58 15.0 59 8.0 60 6.5 61 6.0 62 3.5 63 1.0 64 2.0 65 3.5 66 3.0 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.025 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.325 110-114 0.385 115-119 0.005 120-124 0.0 125-129 0.005 130-134 0.01 135-139 0.005 140-144 0.01 145-149 0.0 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 98.9638615112459 97.89999999999999 2 0.9855951478392722 1.95 3 0.050543340914834464 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.425 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.6625 0.0 0.0 0.0 0.0 92-93 0.775 0.0 0.0 0.0 0.0 94-95 0.875 0.0 0.0 0.0 0.0 96-97 1.025 0.0 0.0 0.0 0.0 98-99 1.1875 0.0 0.0 0.0 0.0 100-101 1.425 0.0 0.0 0.0 0.0 102-103 1.7999999999999998 0.0 0.0 0.0 0.0 104-105 2.25 0.0 0.0 0.0 0.0 106-107 2.7125000000000004 0.0 0.0 0.0 0.0 108-109 3.05 0.0 0.0 0.0 0.0 110-111 3.425 0.0 0.0 0.0 0.0 112-113 3.7375 0.0 0.0 0.0 0.0 114-115 4.0125 0.0 0.0 0.0 0.0 116-117 4.425 0.0 0.0 0.0 0.0 118-119 4.8375 0.0 0.0 0.0 0.0 120-121 5.4 0.0 0.0 0.0 0.0 122-123 5.975 0.0 0.0 0.0 0.0 124-125 6.525 0.0 0.0 0.0 0.0 126-127 7.125 0.0 0.0 0.0 0.0 128-129 7.725 0.0 0.0 0.0 0.0 130-131 8.175 0.0 0.0 0.0 0.0 132-133 8.675 0.0 0.0 0.0 0.0 134-135 9.325 0.0 0.0 0.0 0.0 136-137 9.8875 0.0 0.0 0.0 0.0 138-139 10.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTGTGC 10 0.0068590776 144.79999 1 TGGGGAC 10 0.0068590776 144.79999 3 GGGGACA 10 0.0068590776 144.79999 4 GAAAAAT 20 3.6074626E-4 108.59999 8 >>END_MODULE SRR7169745 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169745_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.914 33.0 33.0 34.0 32.0 34.0 2 33.05375 34.0 33.0 34.0 32.0 34.0 3 33.08425 34.0 33.0 34.0 32.0 34.0 4 33.09875 34.0 33.0 34.0 33.0 34.0 5 33.038 34.0 33.0 34.0 33.0 34.0 6 37.20575 38.0 38.0 38.0 37.0 38.0 7 37.2425 38.0 38.0 38.0 37.0 38.0 8 37.185 38.0 38.0 38.0 37.0 38.0 9 37.28475 38.0 38.0 38.0 37.0 38.0 10-14 37.22035 38.0 38.0 38.0 36.8 38.0 15-19 37.213800000000006 38.0 38.0 38.0 37.0 38.0 20-24 37.10215 38.0 38.0 38.0 37.0 38.0 25-29 37.1515 38.0 38.0 38.0 37.0 38.0 30-34 36.9828 38.0 38.0 38.0 36.6 38.0 35-39 36.796749999999996 38.0 38.0 38.0 35.6 38.0 40-44 36.892250000000004 38.0 38.0 38.0 36.0 38.0 45-49 36.918 38.0 38.0 38.0 36.0 38.0 50-54 36.422850000000004 38.0 38.0 38.0 34.0 38.0 55-59 36.34075 38.0 37.8 38.0 33.0 38.0 60-64 36.67100000000001 38.0 38.0 38.0 35.2 38.0 65-69 36.9177 38.0 38.0 38.0 36.0 38.0 70-74 36.614250000000006 38.0 38.0 38.0 35.4 38.0 75-79 35.94205 38.0 38.0 38.0 34.2 38.0 80-84 36.3985 38.0 38.0 38.0 34.4 38.0 85-89 36.49725 38.0 38.0 38.0 34.4 38.0 90-94 36.5437 38.0 38.0 38.0 34.6 38.0 95-99 36.31175 38.0 37.8 38.0 33.8 38.0 100-104 36.117000000000004 38.0 38.0 38.0 33.6 38.0 105-109 35.4719 38.0 37.2 38.0 31.4 38.0 110-114 33.922900000000006 38.0 35.8 38.0 20.6 38.0 115-119 34.00985 38.0 36.2 38.0 21.8 38.0 120-124 34.14745 38.0 36.0 38.0 23.6 38.0 125-129 34.44255 38.0 36.0 38.0 25.2 38.0 130-134 34.790800000000004 38.0 35.6 38.0 26.4 38.0 135-139 34.47865 38.0 35.4 38.0 26.2 38.0 140-144 33.948 38.0 34.6 38.0 22.4 38.0 145-149 33.55775 38.0 33.0 38.0 21.6 38.0 150-151 29.11825 35.5 25.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 4.0 4 2.0 5 3.0 6 0.0 7 1.0 8 1.0 9 1.0 10 2.0 11 1.0 12 2.0 13 4.0 14 3.0 15 1.0 16 1.0 17 5.0 18 3.0 19 2.0 20 6.0 21 13.0 22 11.0 23 18.0 24 13.0 25 23.0 26 17.0 27 20.0 28 50.0 29 51.0 30 64.0 31 68.0 32 107.0 33 121.0 34 192.0 35 268.0 36 593.0 37 2324.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.025 21.025 13.875000000000002 27.075 2 27.05 26.1 30.575000000000003 16.275000000000002 3 19.975 29.099999999999998 31.674999999999997 19.25 4 23.775 34.2 23.549999999999997 18.475 5 24.112056028014006 35.34267133566784 22.11105552776388 18.434217108554275 6 20.905226306576644 38.159539884971245 23.080770192548137 17.854463615903978 7 20.125 20.974999999999998 37.375 21.525 8 20.705176294073517 26.056514128532132 27.68192048012003 25.55638909727432 9 22.725 24.825 29.299999999999997 23.150000000000002 10-14 23.316165808290414 28.206410320516024 27.001350067503378 21.476073803690184 15-19 23.280820205051263 28.11202800700175 27.771942985746435 20.83520880220055 20-24 23.522056616985097 28.473542062618783 27.828348504551364 20.176052815844752 25-29 23.84215264579374 27.52825847754326 27.908372511753527 20.721216364909473 30-34 23.171951585475643 27.678303491047313 28.748624587376213 20.40112033610083 35-39 23.618266393237633 27.864752663432203 27.469614365027763 21.047366578302405 40-44 23.523528529279393 27.744161624243635 28.564284642696403 20.16802520378057 45-49 22.99304756664833 27.02946031110889 28.88510978842595 21.092382333816836 50-54 23.591795897948977 28.01400700350175 28.18409204602301 20.210105052526263 55-59 23.577967882335287 27.58016909300115 27.830306668667763 21.011556355995797 60-64 23.271981594478344 28.088426527958386 28.20846253876163 20.43112933880164 65-69 23.00075018754689 27.506876719179797 28.40710177544386 21.085271317829456 70-74 23.013478173405755 27.932005632669483 28.424864212432105 20.629651981492657 75-79 23.39892665474061 27.6616406848965 28.520316892409912 20.419115767952977 80-84 23.84758457748957 27.657970140250338 27.98974513648017 20.50470014577992 85-89 23.845730578760442 27.55239857936071 28.107648441798812 20.494222400080037 90-94 23.695663048371767 28.47281276574459 27.747486368865992 20.08403781701766 95-99 23.868353923873357 27.799729905466915 27.809733406692345 20.52218276396739 100-104 23.913478870418587 28.324654516322852 27.688764269977966 20.073102343280596 105-109 23.749363219561896 27.967396841569027 27.947019867549667 20.336220071319406 110-114 24.259210870133263 27.71883982231513 28.335510844003135 19.686438463548473 115-119 24.726848414129627 27.522011244298294 27.51670733000955 20.234433011562533 120-124 24.449558077506406 27.629308090581034 28.40855603786413 19.51257779404843 125-129 24.57828831625789 27.951981786194764 27.71396046776363 19.75576942978371 130-134 26.07625458381474 27.75405636208369 27.276837293414374 18.892851760687197 135-139 25.28132033008252 27.636909227306827 27.196799199799948 19.884971242810703 140-144 25.008753063572247 27.684689641374483 27.90476666833392 19.40179062671935 145-149 25.637691307392217 28.30849254776433 27.07812343703111 18.975692707812346 150-151 25.5415049455365 26.968824339551773 26.981344685113307 20.508326029798425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 2.0 26 2.0 27 4.5 28 5.0 29 6.5 30 12.5 31 22.5 32 26.5 33 36.0 34 47.0 35 58.0 36 81.0 37 106.5 38 122.5 39 150.5 40 201.5 41 236.0 42 262.0 43 270.0 44 280.0 45 307.5 46 287.5 47 263.5 48 253.0 49 211.5 50 172.5 51 146.5 52 114.0 53 91.0 54 68.5 55 44.5 56 31.0 57 20.5 58 15.5 59 10.0 60 7.5 61 4.0 62 2.0 63 2.0 64 2.0 65 1.5 66 1.5 67 1.0 68 0.5 69 1.5 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.05 6 0.025 7 0.0 8 0.025 9 0.0 10-14 0.005 15-19 0.025 20-24 0.03 25-29 0.03 30-34 0.03 35-39 0.034999999999999996 40-44 0.015 45-49 0.034999999999999996 50-54 0.05 55-59 0.055 60-64 0.03 65-69 0.025 70-74 0.58 75-79 2.175 80-84 0.5349999999999999 85-89 0.045 90-94 0.045 95-99 0.034999999999999996 100-104 0.13999999999999999 105-109 1.8499999999999999 110-114 4.324999999999999 115-119 5.7299999999999995 120-124 4.3950000000000005 125-129 3.37 130-134 0.46499999999999997 135-139 0.025 140-144 0.034999999999999996 145-149 0.03 150-151 0.1625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06612821807168 98.125 2 0.9086320040383644 1.7999999999999998 3 0.025239777889954566 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.425 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.6625 0.0 0.0 0.0 0.0 92-93 0.775 0.0 0.0 0.0 0.0 94-95 0.875 0.0 0.0 0.0 0.0 96-97 1.025 0.0 0.0 0.0 0.0 98-99 1.175 0.0 0.0 0.0 0.0 100-101 1.4 0.0 0.0 0.0 0.0 102-103 1.75 0.0 0.0 0.0 0.0 104-105 2.15 0.0 0.0 0.0 0.0 106-107 2.6 0.0 0.0 0.0 0.0 108-109 2.875 0.0 0.0 0.0 0.0 110-111 3.1875 0.0 0.0 0.0 0.0 112-113 3.45 0.0 0.0 0.0 0.0 114-115 3.7125000000000004 0.0 0.0 0.0 0.0 116-117 4.075 0.0 0.0 0.0 0.0 118-119 4.449999999999999 0.0 0.0 0.0 0.0 120-121 4.975 0.0 0.0 0.0 0.0 122-123 5.525 0.0 0.0 0.0 0.0 124-125 6.025 0.0 0.0 0.0 0.0 126-127 6.5875 0.0 0.0 0.0 0.0 128-129 7.1375 0.0 0.0 0.0 0.0 130-131 7.574999999999999 0.0 0.0 0.0 0.0 132-133 8.0625 0.0 0.0 0.0 0.0 134-135 8.7 0.0 0.0 0.0 0.0 136-137 9.2375 0.0 0.0 0.0 0.0 138-139 10.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCCTTT 10 0.0071241944 142.975 8 AAGAAAT 35 0.0035022858 61.274998 9 CAAGAAA 45 0.009469301 47.658333 8 >>END_MODULE Read 444194 spots for SRR7169745.sra Written 444194 spots for SRR7169745.sra Read 444194 spots for SRR7169745.sra Written 444194 spots for SRR7169745.sra Read 444194 spots for SRR7169745.sra Written 444194 spots for SRR7169745.sra Read 444194 spots for SRR7169745.sra Written 444194 spots for SRR7169745.sra Read 444194 spots for SRR7169745.sra Written 444194 spots for SRR7169745.sra Read 444194 spots for SRR7169745.sra Written 444194 spots for SRR7169745.sra Read 444194 spots for SRR7169745.sra Written 444194 spots for SRR7169745.sra Read 444194 spots for SRR7169745.sra Written 444194 spots for SRR7169745.sra Read 444194 spots for SRR7169745.sra Written 444194 spots for SRR7169745.sra Read 444194 spots for SRR7169745.sra Written 444194 spots for SRR7169745.sra Read 444194 spots for SRR7169745.sra Written 444194 spots for SRR7169745.sra Read 444194 spots for SRR7169745.sra Written 444194 spots for SRR7169745.sra Read 444194 spots for SRR7169745.sra Written 444194 spots for SRR7169745.sra Read 444194 spots for SRR7169745.sra Written 444194 spots for SRR7169745.sra Read 444194 spots for SRR7169745.sra Written 444194 spots for SRR7169745.sra Read 444194 spots for SRR7169745.sra Written 444194 spots for SRR7169745.sra Read 444194 spots for SRR7169745.sra Written 444194 spots for SRR7169745.sra Read 444194 spots for SRR7169745.sra Written 444194 spots for SRR7169745.sra Read 444210 spots for SRR7169745.sra Written 444210 spots for SRR7169745.sra Read 444194 spots for SRR7169745.sra Written 444194 spots for SRR7169745.sra SRR ids: ['SRR7169745.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i4xmb8_u SRR7169745.sra spots: 8883896 blocks: [[1, 444194], [444195, 888388], [888389, 1332582], [1332583, 1776776], [1776777, 2220970], [2220971, 2665164], [2665165, 3109358], [3109359, 3553552], [3553553, 3997746], [3997747, 4441940], [4441941, 4886134], [4886135, 5330328], [5330329, 5774522], [5774523, 6218716], [6218717, 6662910], [6662911, 7107104], [7107105, 7551298], [7551299, 7995492], [7995493, 8439686], [8439687, 8883896]] SRR7169745 file size 2990940 SRR7169745 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169745 SRR7169745_1.fastq SRR7169745_2.fastq Input file: SRR7169745_1.fastq Paired file: SRR7169745_2.fastq trimmed: SRR7169745-trimmed-pair1.fastq, SRR7169745-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 12:49:05 2025 >> started Tue Feb 11 12:49:15 2025 >> done (10.596s) 8883896 read pairs processed; of these: 9170 ( 0.10%) short read pairs filtered out after trimming by size control 7694 ( 0.09%) empty read pairs filtered out after trimming by size control 8867032 (99.81%) read pairs available; of these: 4171129 (47.04%) trimmed read pairs available after processing 4695903 (52.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 0 0.00% 21 1 0.00% 22 0 0.00% 23 0 0.00% 24 3 0.00% 25 1 0.00% 26 4 0.00% 27 3 0.00% 28 2 0.00% 29 1 0.00% 30 5 0.00% 31 3 0.00% 32 5 0.00% 33 6 0.00% 34 3 0.00% 35 6 0.00% 36 8 0.00% 37 12 0.00% 38 12 0.00% 39 14 0.00% 40 22 0.00% 41 20 0.00% 42 28 0.00% 43 31 0.00% 44 22 0.00% 45 42 0.00% 46 29 0.00% 47 39 0.00% 48 57 0.00% 49 64 0.00% 50 75 0.00% 51 75 0.00% 52 93 0.00% 53 109 0.00% 54 114 0.00% 55 101 0.00% 56 128 0.00% 57 149 0.00% 58 191 0.00% 59 181 0.00% 60 204 0.00% 61 274 0.00% 62 326 0.00% 63 367 0.00% 64 416 0.00% 65 420 0.00% 66 459 0.01% 67 502 0.01% 68 573 0.01% 69 654 0.01% 70 762 0.01% 71 867 0.01% 72 1091 0.01% 73 1161 0.01% 74 1287 0.01% 75 1512 0.02% 76 1673 0.02% 77 1852 0.02% 78 1926 0.02% 79 2031 0.02% 80 2349 0.03% 81 2674 0.03% 82 3070 0.03% 83 3415 0.04% 84 4123 0.05% 85 4688 0.05% 86 4979 0.06% 87 5415 0.06% 88 5604 0.06% 89 5931 0.07% 90 6479 0.07% 91 6989 0.08% 92 7712 0.09% 93 8424 0.10% 94 9252 0.10% 95 9553 0.11% 96 10308 0.12% 97 10518 0.12% 98 10854 0.12% 99 11409 0.13% 100 12224 0.14% 101 12760 0.14% 102 13616 0.15% 103 14809 0.17% 104 15846 0.18% 105 16301 0.18% 106 17009 0.19% 107 17269 0.19% 108 17876 0.20% 109 18096 0.20% 110 18554 0.21% 111 19395 0.22% 112 20935 0.24% 113 21389 0.24% 114 22551 0.25% 115 23286 0.26% 116 24238 0.27% 117 24472 0.28% 118 24896 0.28% 119 24475 0.28% 120 25229 0.28% 121 26040 0.29% 122 27146 0.31% 123 27468 0.31% 124 28997 0.33% 125 29964 0.34% 126 31301 0.35% 127 31788 0.36% 128 32356 0.36% 129 32702 0.37% 130 33315 0.38% 131 33720 0.38% 132 34838 0.39% 133 35800 0.40% 134 37333 0.42% 135 38943 0.44% 136 40773 0.46% 137 41700 0.47% 138 43581 0.49% 139 45684 0.52% 140 48334 0.55% 141 50977 0.57% 142 54986 0.62% 143 59209 0.67% 144 67695 0.76% 145 78261 0.88% 146 94025 1.06% 147 122911 1.39% 148 179431 2.02% 149 343551 3.87% 150 1859310 20.97% 151 4695903 52.96% 8867032 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=43 prefix-density=0.18 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.15 sequence-density-rank=7 fanout-score=59.41 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=14.0 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=3.21 fanout-score-rank=29 prefix-density=0.24 prefix-fanout=2.7 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.01 sequence-density-rank=45 fanout-score=71.31 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.9 sequence=AAGCAATTTCTTCATCCTCTTCTGTGATAATCACTCCTACCTTTTTGCTTCTTACAGTTTTCTTTTGTATCCCAGCTGTGCTTTATTTTCCTTCTAGTTCCAATGGCCACTGTTGAGGTTG SRR7169745 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 12:50:23 Started mapping on | Feb 11 12:50:23 Finished on | Feb 11 12:51:17 Mapping speed, Million of reads per hour | 591.14 Number of input reads | 8867032 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 8529166 Uniquely mapped reads % | 96.19% Average mapped length | 291.14 Number of splices: Total | 7886654 Number of splices: Annotated (sjdb) | 7759151 Number of splices: GT/AG | 7776439 Number of splices: GC/AG | 87340 Number of splices: AT/AC | 6058 Number of splices: Non-canonical | 16817 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 141953 % of reads mapped to multiple loci | 1.60% Number of reads mapped to too many loci | 17468 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.97% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 202942 202942 202942 N_multimapping 141953 141953 141953 N_noFeature 226755 8436229 270097 N_ambiguous 81542 433 31644 UnstrandedReadsAssigned:8220869 PositiveStrandReadsAssigned:92504 NegativeStrandReadsAssigned:8227425 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169745 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169745-trimmed-pair1.fastq SRR7169745-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,867,032 reads, 8,179,955 reads pseudoaligned [quant] estimated average fragment length: 218.418 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,012 rounds 52401 SRR7169745.ke.tsv 34699 SRR7169745.se.tsv 87100 total ==> SRR7169745.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1800.58 189 14.435 Potri.005G024800.1.v4.1 1035 817.582 14 2.35486 Potri.004G059700.1.v4.1 961 743.582 0 0 Potri.007G009000.2.v4.1 1416 1198.58 0 0 Potri.003G141000.2.v4.1 2943 2725.58 149 7.51789 Potri.016G087400.1.v4.1 270 90.3912 799 1215.6 Potri.015G069301.1.v4.1 564 349.16 0 0 Potri.010G195200.1.v4.1 1773 1555.58 15 1.32607 Potri.012G127500.1.v4.1 977 759.582 2062 373.322 ==> SRR7169745.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 840 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 120 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169745 completed mapping pipeline successfully