Starting /dee2/code/volunteer_pipeline.sh SRR7169746 current disk space = 3050695639040 free memory = 1502629164 SRR7169746 SRAfilesize 8afbba606e406649c6b0646eefa7d41d SRR7169746.sra SRR7169746.sra file validated SRR7169746 is paired end SRR7169746 is conventional basespace SRR7169746 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169746_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.44275 25.0 18.0 33.0 18.0 33.0 2 22.81075 18.0 18.0 29.0 18.0 33.0 3 27.015 28.0 25.0 31.0 18.0 33.0 4 30.7045 31.0 30.0 33.0 29.0 33.0 5 32.027 33.0 32.0 33.0 31.0 33.0 6 36.049 37.0 36.0 38.0 33.0 38.0 7 36.919 38.0 37.0 38.0 35.0 38.0 8 37.0455 38.0 38.0 38.0 36.0 38.0 9 37.416 38.0 38.0 38.0 37.0 38.0 10-14 37.39005 38.0 38.0 38.0 36.6 38.0 15-19 36.9364 38.0 38.0 38.0 35.2 38.0 20-24 37.615899999999996 38.0 38.0 38.0 37.8 38.0 25-29 37.5945 38.0 38.0 38.0 38.0 38.0 30-34 37.3281 38.0 38.0 38.0 37.0 38.0 35-39 37.474000000000004 38.0 38.0 38.0 37.4 38.0 40-44 37.3749 38.0 38.0 38.0 37.0 38.0 45-49 36.9516 38.0 38.0 38.0 35.8 38.0 50-54 37.448 38.0 38.0 38.0 37.0 38.0 55-59 37.4216 38.0 38.0 38.0 37.0 38.0 60-64 37.387899999999995 38.0 38.0 38.0 37.0 38.0 65-69 37.301249999999996 38.0 38.0 38.0 36.6 38.0 70-74 37.21395 38.0 38.0 38.0 36.2 38.0 75-79 37.13355 38.0 38.0 38.0 36.0 38.0 80-84 37.054950000000005 38.0 38.0 38.0 36.0 38.0 85-89 36.9761 38.0 38.0 38.0 35.8 38.0 90-94 36.8609 38.0 38.0 38.0 35.6 38.0 95-99 36.78875 38.0 38.0 38.0 35.2 38.0 100-104 36.682300000000005 38.0 38.0 38.0 34.8 38.0 105-109 36.4887 38.0 38.0 38.0 34.2 38.0 110-114 36.1744 38.0 37.4 38.0 33.4 38.0 115-119 36.157849999999996 38.0 37.0 38.0 33.6 38.0 120-124 36.05544999999999 38.0 37.0 38.0 33.2 38.0 125-129 35.85625 38.0 36.4 38.0 32.2 38.0 130-134 35.3118 38.0 35.8 38.0 29.8 38.0 135-139 35.08255 38.0 35.0 38.0 29.0 38.0 140-144 35.0089 38.0 35.0 38.0 29.4 38.0 145-149 34.581849999999996 38.0 35.0 38.0 28.6 38.0 150-151 30.752625000000002 36.5 29.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 2.0 18 3.0 19 9.0 20 3.0 21 1.0 22 1.0 23 4.0 24 7.0 25 7.0 26 6.0 27 12.0 28 13.0 29 19.0 30 18.0 31 36.0 32 77.0 33 115.0 34 154.0 35 344.0 36 1096.0 37 2070.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.40905679259444 10.70803102326745 9.98248686514886 33.90042531898924 2 24.775 14.549999999999999 31.5 29.175 3 20.77173640691556 19.293410172889 24.730643948884993 35.20420947131045 4 24.05 27.125 23.05 25.775 5 24.099999999999998 29.599999999999998 24.625 21.675 6 20.3 34.525 24.875 20.3 7 15.049999999999999 25.575 40.925 18.45 8 18.875 25.924999999999997 30.4 24.8 9 16.975 24.8 33.775 24.45 10-14 20.05 29.830000000000002 27.224999999999998 22.895 15-19 20.345 28.285 27.860000000000003 23.51 20-24 20.16 28.294999999999998 27.99 23.555 25-29 19.895 28.575 27.215 24.315 30-34 20.395 28.610000000000003 27.284999999999997 23.71 35-39 20.445 28.52 27.134999999999998 23.9 40-44 20.315 28.595 27.735 23.355 45-49 20.8 27.935 27.41 23.855 50-54 19.98 28.9 27.315 23.805 55-59 20.119999999999997 27.785 28.055000000000003 24.04 60-64 19.74 28.794999999999998 27.37 24.095 65-69 20.135 28.985 27.250000000000004 23.630000000000003 70-74 20.9 28.13 27.700000000000003 23.27 75-79 20.735 27.900000000000002 27.495000000000005 23.87 80-84 20.215 28.389999999999997 27.35 24.044999999999998 85-89 20.565 27.875 27.47 24.09 90-94 19.91 29.185 27.500000000000004 23.405 95-99 20.36 28.785 26.919999999999998 23.935000000000002 100-104 21.335 28.38 26.88 23.405 105-109 21.292452358325413 28.03481218426449 26.634322012704448 24.038413444705647 110-114 21.285 28.605000000000004 26.919999999999998 23.189999999999998 115-119 21.355 28.794999999999998 26.119999999999997 23.73 120-124 20.96 28.199999999999996 26.655 24.185000000000002 125-129 21.029999999999998 28.125 26.72 24.125 130-134 21.490000000000002 28.095 26.305 24.11 135-139 21.105 27.955000000000002 26.685 24.255 140-144 20.995 27.755000000000003 26.224999999999998 25.025 145-149 21.044999999999998 28.22 26.505000000000003 24.23 150-151 21.1375 27.425 26.974999999999998 24.462500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.5 19 1.5 20 1.0 21 0.5 22 2.5 23 2.5 24 1.0 25 0.5 26 2.0 27 6.5 28 9.5 29 12.5 30 18.5 31 21.5 32 23.0 33 32.5 34 43.0 35 58.5 36 81.5 37 103.0 38 128.0 39 137.5 40 169.0 41 212.0 42 232.5 43 260.0 44 288.5 45 293.5 46 283.5 47 257.0 48 229.5 49 209.0 50 170.5 51 145.0 52 124.5 53 105.0 54 88.0 55 64.5 56 42.5 57 32.5 58 24.5 59 19.0 60 16.0 61 8.0 62 7.5 63 8.0 64 6.0 65 4.5 66 3.0 67 1.0 68 1.0 69 2.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.22499999999999998 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.034999999999999996 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64824120603015 99.15 2 0.32663316582914576 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.02512562814070352 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTCATTATCTCGTAT 8 0.2 TruSeq Adapter, Index 2 (97% over 37bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.48750000000000004 0.0 0.0 0.0 0.0 88-89 0.575 0.0 0.0 0.0 0.0 90-91 0.7 0.0 0.0 0.0 0.0 92-93 0.9125 0.0 0.0 0.0 0.0 94-95 1.225 0.0 0.0 0.0 0.0 96-97 1.4375 0.0 0.0 0.0 0.0 98-99 1.6124999999999998 0.0 0.0 0.0 0.0 100-101 1.9375 0.0 0.0 0.0 0.0 102-103 2.275 0.0 0.0 0.0 0.0 104-105 2.625 0.0 0.0 0.0 0.0 106-107 3.1 0.0 0.0 0.0 0.0 108-109 3.5375 0.0 0.0 0.0 0.0 110-111 3.9000000000000004 0.0 0.0 0.0 0.0 112-113 4.1875 0.0 0.0 0.0 0.0 114-115 4.6625 0.0 0.0 0.0 0.0 116-117 5.2 0.0 0.0 0.0 0.0 118-119 5.9625 0.0 0.0 0.0 0.0 120-121 6.6875 0.0 0.0 0.0 0.0 122-123 7.175000000000001 0.0 0.0 0.0 0.0 124-125 7.7125 0.0 0.0 0.0 0.0 126-127 8.4125 0.0 0.0 0.0 0.0 128-129 9.1375 0.0 0.0 0.0 0.0 130-131 9.7875 0.0 0.0 0.0 0.0 132-133 10.45 0.0 0.0 0.0 0.0 134-135 11.2375 0.0 0.0 0.0 0.0 136-137 11.925 0.0 0.0 0.0 0.0 138-139 12.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 35 0.0035366106 20.714287 120-124 >>END_MODULE SRR7169746 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169746_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9575 33.0 33.0 34.0 32.0 34.0 2 33.09275 34.0 33.0 34.0 32.0 34.0 3 33.055 34.0 33.0 34.0 32.0 34.0 4 33.1025 34.0 33.0 34.0 33.0 34.0 5 33.08325 34.0 33.0 34.0 33.0 34.0 6 37.33025 38.0 38.0 38.0 37.0 38.0 7 37.24975 38.0 38.0 38.0 37.0 38.0 8 37.32825 38.0 38.0 38.0 37.0 38.0 9 37.04825 38.0 38.0 38.0 37.0 38.0 10-14 36.8656 38.0 38.0 38.0 35.4 38.0 15-19 37.141600000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.10209999999999 38.0 38.0 38.0 36.8 38.0 25-29 37.09815 38.0 38.0 38.0 37.0 38.0 30-34 36.845150000000004 38.0 38.0 38.0 35.6 38.0 35-39 37.06495 38.0 38.0 38.0 36.8 38.0 40-44 36.72765 38.0 38.0 38.0 34.8 38.0 45-49 37.0429 38.0 38.0 38.0 36.6 38.0 50-54 36.4992 38.0 37.4 38.0 32.8 38.0 55-59 36.58624999999999 38.0 37.8 38.0 34.8 38.0 60-64 36.81865 38.0 38.0 38.0 35.8 38.0 65-69 36.71685 38.0 38.0 38.0 35.4 38.0 70-74 36.660000000000004 38.0 38.0 38.0 35.6 38.0 75-79 36.556 38.0 38.0 38.0 35.0 38.0 80-84 36.041700000000006 38.0 37.4 38.0 32.2 38.0 85-89 36.5726 38.0 38.0 38.0 34.8 38.0 90-94 35.94409999999999 38.0 37.4 38.0 32.4 38.0 95-99 36.481049999999996 38.0 38.0 38.0 34.8 38.0 100-104 36.08390000000001 38.0 38.0 38.0 33.6 38.0 105-109 35.3816 38.0 37.0 38.0 31.0 38.0 110-114 34.8161 38.0 36.8 38.0 27.8 38.0 115-119 34.52835 38.0 36.6 38.0 26.0 38.0 120-124 33.886399999999995 38.0 35.0 38.0 21.8 38.0 125-129 34.46275 38.0 35.4 38.0 25.2 38.0 130-134 34.448750000000004 38.0 34.8 38.0 24.6 38.0 135-139 34.586650000000006 38.0 35.0 38.0 27.0 38.0 140-144 34.2853 38.0 34.4 38.0 25.8 38.0 145-149 33.46445000000001 38.0 33.4 38.0 21.0 38.0 150-151 29.04925 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 6.0 4 2.0 5 0.0 6 2.0 7 2.0 8 0.0 9 1.0 10 2.0 11 6.0 12 3.0 13 1.0 14 2.0 15 2.0 16 4.0 17 9.0 18 7.0 19 12.0 20 4.0 21 8.0 22 11.0 23 6.0 24 12.0 25 5.0 26 17.0 27 16.0 28 15.0 29 36.0 30 48.0 31 69.0 32 123.0 33 126.0 34 201.0 35 309.0 36 700.0 37 2227.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.6 19.900000000000002 16.325 28.175 2 25.974999999999998 25.775 29.875 18.375 3 20.45 28.025 31.624999999999996 19.900000000000002 4 24.725 33.475 22.55 19.25 5 25.025 35.4 22.925 16.650000000000002 6 20.825 37.15 23.05 18.975 7 19.675 21.025 38.925 20.375 8 21.425 25.775 27.200000000000003 25.6 9 22.275 24.95 29.95 22.825 10-14 23.544999999999998 28.455000000000002 26.5 21.5 15-19 23.810000000000002 27.310000000000002 27.939999999999998 20.94 20-24 23.225 28.055000000000003 27.725 20.995 25-29 23.565 28.585 26.665 21.185000000000002 30-34 22.975 27.939999999999998 27.38 21.705 35-39 23.645 27.389999999999997 27.435 21.529999999999998 40-44 23.615 27.71 27.96 20.715 45-49 23.48 28.265 27.325 20.93 50-54 23.119999999999997 27.495000000000005 28.044999999999998 21.34 55-59 23.9 27.46 28.03 20.61 60-64 23.580000000000002 27.305 27.845 21.27 65-69 23.580000000000002 28.194999999999997 27.505000000000003 20.72 70-74 23.838141025641026 27.589142628205128 27.468950320512818 21.103766025641026 75-79 23.57650355248674 27.43920744521165 28.04463124186931 20.939657760432304 80-84 23.45086271567892 28.08202050512628 27.536884221055264 20.930232558139537 85-89 24.525 27.255000000000003 27.99 20.23 90-94 23.755000000000003 28.055000000000003 27.355 20.835 95-99 23.695 27.625 27.71 20.97 100-104 24.74737368684342 27.64382191095548 27.018509254627315 20.590295147573787 105-109 24.704097116843702 27.258472432979264 27.61254425897825 20.424886191198784 110-114 24.545268751277334 27.45248313917842 27.278765583486614 20.723482526057634 115-119 24.596440397350992 27.71109271523179 27.13162251655629 20.560844370860927 120-124 24.41591784338896 27.60975609756098 27.080872913992298 20.893453145057766 125-129 25.10986513108047 28.408344698691725 26.402990352073548 20.078799818154266 130-134 25.530424339471576 27.85728582866293 26.65132105684548 19.960968775020017 135-139 25.88 27.915 26.455000000000002 19.75 140-144 25.885 28.07 25.915 20.13 145-149 26.855 27.76 26.07 19.314999999999998 150-151 26.8375 26.8125 26.450000000000003 19.900000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 1.5 25 1.5 26 2.0 27 4.0 28 6.0 29 8.5 30 9.5 31 10.5 32 10.0 33 15.0 34 29.5 35 44.5 36 64.0 37 100.0 38 125.5 39 148.5 40 190.5 41 223.0 42 256.5 43 274.0 44 288.0 45 325.5 46 310.5 47 260.5 48 248.0 49 220.0 50 180.0 51 153.0 52 122.5 53 92.5 54 65.0 55 50.0 56 39.5 57 29.0 58 23.5 59 18.5 60 11.0 61 8.0 62 4.0 63 5.0 64 5.0 65 2.0 66 2.5 67 1.5 68 2.0 69 2.0 70 1.0 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.16 75-79 0.06999999999999999 80-84 0.025 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.05 105-109 1.15 110-114 2.1399999999999997 115-119 3.36 120-124 2.625 125-129 1.015 130-134 0.08 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67336683417085 99.175 2 0.3015075376884422 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.02512562814070352 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTCAGAGCCGTGTAGATCT 9 0.22499999999999998 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.675 0.0 0.0 0.0 0.0 92-93 0.8875 0.0 0.0 0.0 0.0 94-95 1.2 0.0 0.0 0.0 0.0 96-97 1.4125 0.0 0.0 0.0 0.0 98-99 1.5875 0.0 0.0 0.0 0.0 100-101 1.9249999999999998 0.0 0.0 0.0 0.0 102-103 2.25 0.0 0.0 0.0 0.0 104-105 2.6 0.0 0.0 0.0 0.0 106-107 3.075 0.0 0.0 0.0 0.0 108-109 3.5125 0.0 0.0 0.0 0.0 110-111 3.875 0.0 0.0 0.0 0.0 112-113 4.175000000000001 0.0 0.0 0.0 0.0 114-115 4.612500000000001 0.0 0.0 0.0 0.0 116-117 5.0625 0.0 0.0 0.0 0.0 118-119 5.85 0.0 0.0 0.0 0.0 120-121 6.550000000000001 0.0 0.0 0.0 0.0 122-123 7.0 0.0 0.0 0.0 0.0 124-125 7.5125 0.0 0.0 0.0 0.0 126-127 8.2 0.0 0.0 0.0 0.0 128-129 8.975000000000001 0.0 0.0 0.0 0.0 130-131 9.6625 0.0 0.0 0.0 0.0 132-133 10.3625 0.0 0.0 0.0 0.0 134-135 11.162500000000001 0.0 0.0 0.0 0.0 136-137 11.9125 0.0 0.0 0.0 0.0 138-139 12.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGTTCA 10 0.006916044 144.40001 1 GGGGGGG 20 0.0060565947 28.880001 10-14 CCCCCCC 35 0.003622645 20.628572 35-39 >>END_MODULE Read 616537 spots for SRR7169746.sra Written 616537 spots for SRR7169746.sra Read 616537 spots for SRR7169746.sra Written 616537 spots for SRR7169746.sra Read 616537 spots for SRR7169746.sra Written 616537 spots for SRR7169746.sra Read 616537 spots for SRR7169746.sra Written 616537 spots for SRR7169746.sra Read 616537 spots for SRR7169746.sra Written 616537 spots for SRR7169746.sra Read 616537 spots for SRR7169746.sra Written 616537 spots for SRR7169746.sra Read 616537 spots for SRR7169746.sra Written 616537 spots for SRR7169746.sra Read 616537 spots for SRR7169746.sra Written 616537 spots for SRR7169746.sra Read 616537 spots for SRR7169746.sra Written 616537 spots for SRR7169746.sra Read 616537 spots for SRR7169746.sra Written 616537 spots for SRR7169746.sra Read 616537 spots for SRR7169746.sra Written 616537 spots for SRR7169746.sra Read 616549 spots for SRR7169746.sra Written 616549 spots for SRR7169746.sra Read 616537 spots for SRR7169746.sra Written 616537 spots for SRR7169746.sra Read 616537 spots for SRR7169746.sra Written 616537 spots for SRR7169746.sra Read 616537 spots for SRR7169746.sra Written 616537 spots for SRR7169746.sra Read 616537 spots for SRR7169746.sra Written 616537 spots for SRR7169746.sra Read 616537 spots for SRR7169746.sra Written 616537 spots for SRR7169746.sra Read 616537 spots for SRR7169746.sra Written 616537 spots for SRR7169746.sra Read 616537 spots for SRR7169746.sra Written 616537 spots for SRR7169746.sra Read 616537 spots for SRR7169746.sra Written 616537 spots for SRR7169746.sra SRR ids: ['SRR7169746.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uho5fp8c SRR7169746.sra spots: 12330752 blocks: [[1, 616537], [616538, 1233074], [1233075, 1849611], [1849612, 2466148], [2466149, 3082685], [3082686, 3699222], [3699223, 4315759], [4315760, 4932296], [4932297, 5548833], [5548834, 6165370], [6165371, 6781907], [6781908, 7398444], [7398445, 8014981], [8014982, 8631518], [8631519, 9248055], [9248056, 9864592], [9864593, 10481129], [10481130, 11097666], [11097667, 11714203], [11714204, 12330752]] SRR7169746 file size 4156786 SRR7169746 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169746 SRR7169746_1.fastq SRR7169746_2.fastq Input file: SRR7169746_1.fastq Paired file: SRR7169746_2.fastq trimmed: SRR7169746-trimmed-pair1.fastq, SRR7169746-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 12:55:16 2025 >> started Tue Feb 11 12:55:30 2025 >> done (13.590s) 12330752 read pairs processed; of these: 15447 ( 0.13%) short read pairs filtered out after trimming by size control 32778 ( 0.27%) empty read pairs filtered out after trimming by size control 12282527 (99.61%) read pairs available; of these: 6377286 (51.92%) trimmed read pairs available after processing 5905241 (48.08%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 6 0.00% 21 4 0.00% 22 3 0.00% 23 4 0.00% 24 8 0.00% 25 5 0.00% 26 6 0.00% 27 9 0.00% 28 6 0.00% 29 7 0.00% 30 5 0.00% 31 9 0.00% 32 10 0.00% 33 12 0.00% 34 13 0.00% 35 16 0.00% 36 23 0.00% 37 23 0.00% 38 19 0.00% 39 37 0.00% 40 35 0.00% 41 28 0.00% 42 48 0.00% 43 40 0.00% 44 57 0.00% 45 60 0.00% 46 71 0.00% 47 68 0.00% 48 85 0.00% 49 102 0.00% 50 138 0.00% 51 139 0.00% 52 180 0.00% 53 195 0.00% 54 223 0.00% 55 231 0.00% 56 270 0.00% 57 304 0.00% 58 342 0.00% 59 378 0.00% 60 449 0.00% 61 595 0.00% 62 643 0.01% 63 750 0.01% 64 822 0.01% 65 916 0.01% 66 1011 0.01% 67 1050 0.01% 68 1214 0.01% 69 1374 0.01% 70 1598 0.01% 71 1795 0.01% 72 2047 0.02% 73 2378 0.02% 74 2617 0.02% 75 3090 0.03% 76 3648 0.03% 77 4114 0.03% 78 4127 0.03% 79 4384 0.04% 80 4672 0.04% 81 5357 0.04% 82 5996 0.05% 83 6813 0.06% 84 8139 0.07% 85 9440 0.08% 86 9971 0.08% 87 10538 0.09% 88 11261 0.09% 89 11725 0.10% 90 12699 0.10% 91 13583 0.11% 92 14371 0.12% 93 15881 0.13% 94 17137 0.14% 95 18169 0.15% 96 19054 0.16% 97 19774 0.16% 98 20549 0.17% 99 21450 0.17% 100 22237 0.18% 101 23086 0.19% 102 24663 0.20% 103 25798 0.21% 104 27033 0.22% 105 28420 0.23% 106 29705 0.24% 107 30268 0.25% 108 31190 0.25% 109 31637 0.26% 110 32578 0.27% 111 33691 0.27% 112 34833 0.28% 113 36437 0.30% 114 37436 0.30% 115 39129 0.32% 116 40050 0.33% 117 41222 0.34% 118 41660 0.34% 119 42125 0.34% 120 42229 0.34% 121 43743 0.36% 122 44718 0.36% 123 46286 0.38% 124 48193 0.39% 125 49355 0.40% 126 50500 0.41% 127 52044 0.42% 128 53892 0.44% 129 54028 0.44% 130 54964 0.45% 131 56008 0.46% 132 57341 0.47% 133 59442 0.48% 134 60561 0.49% 135 62869 0.51% 136 64955 0.53% 137 67442 0.55% 138 70549 0.57% 139 72718 0.59% 140 75881 0.62% 141 80633 0.66% 142 86823 0.71% 143 94601 0.77% 144 107120 0.87% 145 124244 1.01% 146 152628 1.24% 147 199447 1.62% 148 282063 2.30% 149 542347 4.42% 150 2568042 20.91% 151 5905241 48.08% 12282527 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.92 fanout-score-rank=37 prefix-density=0.19 prefix-fanout=2.5 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=45 fanout-score=85.08 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=10.4 sequence=CATTCTCATCTCTGAAAACTTCCGTGGATGTCAAGACCAGGTAAGGTTCTTCGCGTTGCATCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCATTTGAGTTTTAACCTTGCGGCCGTACTCCCCAGGCGGTCGACTTAACGCGTTAGCTCCGGAAGCCACGCCTCAAGGGCACAACCTCCAAGTCGACATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCACCTGAGCGTCAGTCTTCGTCCAGGGGGCCGCCTTCGCCACCGGTATTCCTCCAGATCTCTACGCATTTCACCGCTACACCTGGAATTCTACCCCCCTCTACGAGACTCAAGCTTGCCAGTATCAGATGCAGTTCCCAGGTTGAGCCCGGGGATTTCACATCTGACTTAACAAACCGCCTGCGTGCGCTTTACGCCCAGTAATTCCGATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACG criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=8.02 fanout-score-rank=15 prefix-density=0.24 prefix-fanout=5.0 sequence=CAGTTTGTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGATTTCCAATTCCACAAGTGTTGCAGAAGTCTTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGGCGAGGGTATGGAGGAAGGAGAGTTCTCAGAGGCTCGTGAGGATCTTGCTGCCCTGGAGAAGGATTATGAGGAGGTTGGGGCTGAATCTCCCGATGGAGAGGATGGTGATGAAGGAGAT criterion=fanout-score sequence-density=0.04 sequence-density-rank=42 fanout-score=56.33 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=11.8 sequence=TTCTTCTCTTCTCTTCTTTTCTCCCGGAAAATGGCCGGTTTAATTTCAAGATCAGTTCCTTGTGCAATCCTAGTAGTCTTGTGCACGGTGGTGCCCATTTTGGCTAAAGATCACACTGTAGGAGATAGTTCAGGCTGGGCAATTGGTATGGATTATAGCACCTGGACTAGTGGCAAGACCTTTTCAGTTGGCGACAGCCTTGTGTTTAACTACGGAGGAGGCCACACGGTAGATGAAGTGAGAGCCAGTGACTACAGCACATGCACTACAGGCAATGCAATCACTTCAGATAGCAGTGGTGCTACCACAATAGCCCTCAAGACTGCCGGAACTCATTATTTCATTTGTGGTGTTCCTGGCCACTGTGGGAGTGGCATGAAGGTTGCAGTCACTGTTGCAGCAGCAGGATCGAGCACAAGTCCCTCCTCCGGAACTCCATCTTCTGATGGCACTACCACTTCTCCGGCCGGTAGTAACGTCACCAATTACAAGCCTTCATCCAACAACGTAC SRR7169746 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 12:56:11 Started mapping on | Feb 11 12:56:11 Finished on | Feb 11 12:57:20 Mapping speed, Million of reads per hour | 640.83 Number of input reads | 12282527 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 11733342 Uniquely mapped reads % | 95.53% Average mapped length | 288.80 Number of splices: Total | 10251160 Number of splices: Annotated (sjdb) | 10072191 Number of splices: GT/AG | 10099747 Number of splices: GC/AG | 118806 Number of splices: AT/AC | 9074 Number of splices: Non-canonical | 23533 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 211794 % of reads mapped to multiple loci | 1.72% Number of reads mapped to too many loci | 19544 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.55% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 350441 350441 350441 N_multimapping 211794 211794 211794 N_noFeature 270382 11586384 332855 N_ambiguous 130445 725 45436 UnstrandedReadsAssigned:11332515 PositiveStrandReadsAssigned:146233 NegativeStrandReadsAssigned:11355051 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7169746 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169746-trimmed-pair1.fastq SRR7169746-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,282,527 reads, 11,316,260 reads pseudoaligned [quant] estimated average fragment length: 208.426 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,109 rounds 52401 SRR7169746.ke.tsv 34699 SRR7169746.se.tsv 87100 total ==> SRR7169746.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1810.57 214 10.5067 Potri.005G024800.1.v4.1 1035 827.574 43 4.61882 Potri.004G059700.1.v4.1 961 753.574 4 0.47185 Potri.007G009000.2.v4.1 1416 1208.57 0 0 Potri.003G141000.2.v4.1 2943 2735.57 212.036 6.89017 Potri.016G087400.1.v4.1 270 94.6127 1446 1358.59 Potri.015G069301.1.v4.1 564 358.223 0 0 Potri.010G195200.1.v4.1 1773 1565.57 47 2.66866 Potri.012G127500.1.v4.1 977 769.574 4074 470.587 ==> SRR7169746.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1461 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 220 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 21 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169746 completed mapping pipeline successfully