Starting /dee2/code/volunteer_pipeline.sh SRR7169747 current disk space = 3050989080576 free memory = 1417540644 SRR7169747 SRAfilesize 1d7d77ba0548d75067648fe2280269a4 SRR7169747.sra SRR7169747.sra file validated SRR7169747 is paired end SRR7169747 is conventional basespace SRR7169747 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169747_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.99 32.0 18.0 33.0 18.0 33.0 2 25.12 25.0 18.0 31.0 18.0 33.0 3 29.13675 30.0 27.0 31.0 25.0 33.0 4 31.5425 33.0 31.0 33.0 29.0 33.0 5 32.40525 33.0 33.0 33.0 32.0 33.0 6 36.748 38.0 37.0 38.0 34.0 38.0 7 37.262 38.0 38.0 38.0 36.0 38.0 8 37.55975 38.0 38.0 38.0 37.0 38.0 9 37.689 38.0 38.0 38.0 38.0 38.0 10-14 37.68965 38.0 38.0 38.0 38.0 38.0 15-19 37.72545 38.0 38.0 38.0 38.0 38.0 20-24 37.69930000000001 38.0 38.0 38.0 38.0 38.0 25-29 37.620250000000006 38.0 38.0 38.0 37.8 38.0 30-34 37.582499999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.496500000000005 38.0 38.0 38.0 37.8 38.0 40-44 37.42569999999999 38.0 38.0 38.0 37.4 38.0 45-49 37.5133 38.0 38.0 38.0 37.8 38.0 50-54 37.53205 38.0 38.0 38.0 38.0 38.0 55-59 37.518649999999994 38.0 38.0 38.0 37.6 38.0 60-64 37.4461 38.0 38.0 38.0 37.0 38.0 65-69 37.082899999999995 38.0 38.0 38.0 36.0 38.0 70-74 37.330999999999996 38.0 38.0 38.0 37.0 38.0 75-79 36.65235 38.0 37.6 38.0 34.2 38.0 80-84 37.15115 38.0 38.0 38.0 36.0 38.0 85-89 37.03025 38.0 38.0 38.0 36.0 38.0 90-94 36.9925 38.0 38.0 38.0 36.0 38.0 95-99 36.95075 38.0 38.0 38.0 35.8 38.0 100-104 36.902249999999995 38.0 38.0 38.0 35.8 38.0 105-109 36.7233 38.0 38.0 38.0 34.8 38.0 110-114 36.10085 38.0 37.4 38.0 32.0 38.0 115-119 35.37865 38.0 36.0 38.0 29.4 38.0 120-124 36.234750000000005 38.0 37.6 38.0 33.6 38.0 125-129 36.08485 38.0 37.0 38.0 33.4 38.0 130-134 35.70395 38.0 36.2 38.0 31.6 38.0 135-139 35.3212 38.0 35.8 38.0 29.4 38.0 140-144 34.59995 38.0 34.8 38.0 26.8 38.0 145-149 34.61829999999999 38.0 35.0 38.0 28.0 38.0 150-151 31.073375 36.5 29.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 3.0 17 0.0 18 6.0 19 3.0 20 2.0 21 1.0 22 0.0 23 2.0 24 4.0 25 9.0 26 9.0 27 16.0 28 17.0 29 17.0 30 28.0 31 36.0 32 66.0 33 94.0 34 127.0 35 278.0 36 965.0 37 2316.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.39253279515641 11.553985872855701 6.659939455095863 35.39354187689202 2 24.425 14.399999999999999 35.325 25.85 3 19.3 19.55 26.275 34.875 4 21.775 29.925 22.775000000000002 25.525 5 22.45 33.074999999999996 23.575 20.9 6 19.575 34.699999999999996 24.65 21.075 7 14.424999999999999 27.075 40.075 18.425 8 17.150000000000002 26.35 31.05 25.45 9 16.925 23.849999999999998 34.25 24.975 10-14 20.175 29.12 27.165 23.54 15-19 20.375 28.000000000000004 27.900000000000002 23.724999999999998 20-24 20.195 28.055000000000003 28.349999999999998 23.400000000000002 25-29 20.145 29.37 27.54 22.945 30-34 20.06 28.88 27.389999999999997 23.669999999999998 35-39 19.955000000000002 28.244999999999997 27.875 23.925 40-44 20.05 28.515 28.025 23.41 45-49 20.200000000000003 28.810000000000002 27.415 23.575 50-54 20.335 28.249999999999996 27.96 23.455000000000002 55-59 20.54 27.839999999999996 27.634999999999998 23.985 60-64 20.115 28.16 27.284999999999997 24.44 65-69 19.785 28.565 27.839999999999996 23.810000000000002 70-74 20.205000000000002 28.09 28.095 23.61 75-79 19.97 28.715000000000003 27.73 23.585 80-84 20.4 28.694999999999997 27.565 23.34 85-89 20.849999999999998 28.415000000000003 27.425 23.31 90-94 20.26 28.499999999999996 27.644999999999996 23.595 95-99 20.52 28.205000000000002 27.700000000000003 23.575 100-104 21.154999999999998 28.865000000000002 26.895000000000003 23.085 105-109 20.315 28.125 28.194999999999997 23.365 110-114 20.66 28.32 27.375 23.645 115-119 21.21 28.01 27.07 23.71 120-124 21.167116711671166 28.64786478647865 26.732673267326735 23.452345234523452 125-129 20.75 28.095 27.065 24.09 130-134 21.085 28.585 26.565 23.765 135-139 21.145 27.925 26.905 24.025 140-144 21.52 27.860000000000003 26.395000000000003 24.224999999999998 145-149 21.725 28.475 25.965 23.835 150-151 21.099999999999998 28.575 25.55 24.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 3.5 26 4.5 27 4.5 28 9.5 29 14.5 30 16.0 31 20.5 32 26.0 33 32.0 34 42.5 35 65.0 36 85.0 37 106.0 38 136.0 39 157.0 40 181.0 41 208.0 42 243.5 43 251.5 44 266.5 45 317.0 46 316.0 47 272.5 48 228.0 49 192.0 50 173.0 51 143.5 52 110.0 53 97.5 54 79.0 55 55.0 56 42.5 57 33.0 58 19.5 59 12.0 60 9.5 61 7.5 62 6.0 63 3.5 64 1.5 65 1.0 66 1.5 67 2.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8999999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.01 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54773869346734 99.05000000000001 2 0.4271356783919598 0.8500000000000001 3 0.0 0.0 4 0.02512562814070352 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.4375 0.0 0.0 0.0 0.0 86-87 0.5125 0.0 0.0 0.0 0.0 88-89 0.6625 0.0 0.0 0.0 0.0 90-91 0.8 0.0 0.0 0.0 0.0 92-93 0.8875 0.0 0.0 0.0 0.0 94-95 1.0875 0.0 0.0 0.0 0.0 96-97 1.2625000000000002 0.0 0.0 0.0 0.0 98-99 1.4875 0.0 0.0 0.0 0.0 100-101 1.7125 0.0 0.0 0.0 0.0 102-103 2.125 0.0 0.0 0.0 0.0 104-105 2.525 0.0 0.0 0.0 0.0 106-107 2.7874999999999996 0.0 0.0 0.0 0.0 108-109 3.15 0.0 0.0 0.0 0.0 110-111 3.5625 0.0 0.0 0.0 0.0 112-113 4.1 0.0 0.0 0.0 0.0 114-115 4.699999999999999 0.0 0.0 0.0 0.0 116-117 5.225 0.0 0.0 0.0 0.0 118-119 5.7125 0.0 0.0 0.0 0.0 120-121 6.4125 0.0 0.0 0.0 0.0 122-123 7.0625 0.0 0.0 0.0 0.0 124-125 7.65 0.0 0.0 0.0 0.0 126-127 8.350000000000001 0.0 0.0 0.0 0.0 128-129 8.912500000000001 0.0 0.0 0.0 0.0 130-131 9.575 0.0 0.0 0.0 0.0 132-133 10.2 0.0 0.0 0.0 0.0 134-135 10.9625 0.0 0.0 0.0 0.0 136-137 11.8625 0.0 0.0 0.0 0.0 138-139 12.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169747 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169747_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.934 33.0 33.0 34.0 32.0 34.0 2 33.0555 34.0 33.0 34.0 32.0 34.0 3 33.12225 34.0 33.0 34.0 32.0 34.0 4 32.99625 34.0 33.0 34.0 32.0 34.0 5 33.07175 34.0 33.0 34.0 33.0 34.0 6 37.27425 38.0 38.0 38.0 37.0 38.0 7 37.35225 38.0 38.0 38.0 37.0 38.0 8 37.382 38.0 38.0 38.0 37.0 38.0 9 37.274 38.0 38.0 38.0 37.0 38.0 10-14 37.333 38.0 38.0 38.0 37.0 38.0 15-19 36.65865000000001 38.0 37.6 38.0 34.4 38.0 20-24 37.148199999999996 38.0 38.0 38.0 36.6 38.0 25-29 35.75905 38.0 37.0 38.0 29.8 38.0 30-34 37.11355 38.0 38.0 38.0 36.6 38.0 35-39 37.2175 38.0 38.0 38.0 37.0 38.0 40-44 37.17505 38.0 38.0 38.0 37.0 38.0 45-49 36.99105 38.0 38.0 38.0 36.2 38.0 50-54 37.05385 38.0 38.0 38.0 36.4 38.0 55-59 37.00685 38.0 38.0 38.0 36.4 38.0 60-64 37.021550000000005 38.0 38.0 38.0 36.0 38.0 65-69 35.275999999999996 38.0 35.4 38.0 28.0 38.0 70-74 35.79185 38.0 36.6 38.0 29.2 38.0 75-79 36.759100000000004 38.0 38.0 38.0 35.4 38.0 80-84 36.40565 38.0 37.6 38.0 33.8 38.0 85-89 36.67945 38.0 38.0 38.0 35.4 38.0 90-94 36.69295 38.0 38.0 38.0 35.2 38.0 95-99 36.6213 38.0 38.0 38.0 34.8 38.0 100-104 36.2896 38.0 38.0 38.0 33.8 38.0 105-109 35.245799999999996 38.0 36.4 38.0 28.4 38.0 110-114 35.20135 38.0 37.0 38.0 28.6 38.0 115-119 33.77735 38.0 35.6 38.0 21.4 38.0 120-124 33.7652 38.0 35.2 38.0 18.4 38.0 125-129 33.896300000000004 38.0 34.8 38.0 21.4 38.0 130-134 34.8502 38.0 35.6 38.0 27.4 38.0 135-139 34.718999999999994 38.0 35.2 38.0 27.8 38.0 140-144 34.3857 38.0 34.6 38.0 26.6 38.0 145-149 33.43575 38.0 33.8 38.0 20.2 38.0 150-151 28.956375 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 2.0 5 0.0 6 0.0 7 1.0 8 0.0 9 1.0 10 0.0 11 3.0 12 0.0 13 2.0 14 1.0 15 2.0 16 6.0 17 2.0 18 5.0 19 5.0 20 5.0 21 4.0 22 9.0 23 16.0 24 14.0 25 19.0 26 22.0 27 18.0 28 29.0 29 31.0 30 66.0 31 66.0 32 124.0 33 149.0 34 214.0 35 358.0 36 791.0 37 2031.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.81990995497749 22.486243121560783 11.005502751375689 26.688344172086044 2 27.200000000000003 26.424999999999997 31.25 15.125 3 20.175 28.425 31.45 19.950000000000003 4 24.15 33.925 24.075 17.849999999999998 5 23.799999999999997 36.825 21.7 17.675 6 20.8 38.85 23.425 16.925 7 19.375 21.725 39.300000000000004 19.6 8 21.8 25.974999999999998 27.3 24.925 9 21.975 24.825 30.225 22.975 10-14 22.82 28.405 26.950000000000003 21.825 15-19 22.58 27.894999999999996 28.52 21.005 20-24 22.8 27.900000000000002 27.794999999999998 21.505 25-29 23.185 28.095 27.88 20.84 30-34 22.42 28.285 28.325 20.97 35-39 22.975 28.075 27.685 21.265 40-44 22.830000000000002 27.639999999999997 28.665000000000003 20.865000000000002 45-49 23.34 28.000000000000004 28.035 20.625 50-54 22.79 28.215 27.834999999999997 21.16 55-59 23.075000000000003 27.91 27.88 21.135 60-64 22.91 27.96 28.544999999999998 20.585 65-69 22.975 28.494999999999997 28.13 20.4 70-74 23.26 27.865000000000002 27.875 21.0 75-79 23.127444099067482 27.96550686854507 28.21117015943046 20.695878872956982 80-84 23.165 28.125 28.244999999999997 20.465 85-89 24.01 27.900000000000002 28.165000000000003 19.925 90-94 23.665 27.405 28.075 20.855 95-99 23.575 27.85 28.015 20.560000000000002 100-104 24.03523699884879 27.68406827168527 27.629010460984034 20.651684268481908 105-109 24.085243264977883 27.90510655408122 27.678930438279053 20.33071974266184 110-114 24.50071326676177 27.807214183819035 27.425106990014264 20.26696555940493 115-119 24.44842293718077 27.88162813964509 27.671002053604337 19.998946869569796 120-124 24.882408278457195 28.049545312010032 27.28650569666562 19.781540712867145 125-129 24.921814919251474 27.726224045116638 27.310945911304795 20.041015124327096 130-134 25.5005005005005 27.44744744744745 26.736736736736738 20.315315315315317 135-139 25.0 28.005000000000003 27.525 19.470000000000002 140-144 25.81 27.694999999999997 26.445 20.05 145-149 25.900000000000002 27.955000000000002 26.55 19.595000000000002 150-151 27.5625 26.650000000000002 26.7125 19.075 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 2.0 26 2.5 27 2.5 28 6.0 29 9.5 30 11.0 31 11.5 32 21.5 33 38.5 34 48.0 35 65.5 36 91.5 37 108.0 38 144.0 39 177.0 40 199.5 41 223.5 42 254.0 43 275.5 44 286.5 45 298.5 46 310.0 47 289.5 48 227.0 49 182.0 50 157.0 51 135.0 52 113.0 53 83.5 54 56.5 55 43.0 56 32.5 57 26.5 58 17.5 59 12.5 60 10.0 61 7.0 62 5.0 63 5.5 64 4.0 65 0.5 66 0.5 67 0.5 68 0.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.27 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.105 105-109 0.52 110-114 1.8599999999999999 115-119 5.045 120-124 4.33 125-129 2.475 130-134 0.1 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.32499999999999996 0.0 0.0 0.0 0.0 82-83 0.3875 0.0 0.0 0.0 0.0 84-85 0.4875 0.0 0.0 0.0 0.0 86-87 0.5625 0.0 0.0 0.0 0.0 88-89 0.7125 0.0 0.0 0.0 0.0 90-91 0.8500000000000001 0.0 0.0 0.0 0.0 92-93 0.9375 0.0 0.0 0.0 0.0 94-95 1.1375000000000002 0.0 0.0 0.0 0.0 96-97 1.3125 0.0 0.0 0.0 0.0 98-99 1.5125 0.0 0.0 0.0 0.0 100-101 1.7375 0.0 0.0 0.0 0.0 102-103 2.0999999999999996 0.0 0.0 0.0 0.0 104-105 2.45 0.0 0.0 0.0 0.0 106-107 2.6875 0.0 0.0 0.0 0.0 108-109 3.0125 0.0 0.0 0.0 0.0 110-111 3.4124999999999996 0.0 0.0 0.0 0.0 112-113 3.9124999999999996 0.0 0.0 0.0 0.0 114-115 4.487500000000001 0.0 0.0 0.0 0.0 116-117 4.9625 0.0 0.0 0.0 0.0 118-119 5.4375 0.0 0.0 0.0 0.0 120-121 6.1 0.0 0.0 0.0 0.0 122-123 6.7125 0.0 0.0 0.0 0.0 124-125 7.2875 0.0 0.0 0.0 0.0 126-127 7.9375 0.0 0.0 0.0 0.0 128-129 8.5125 0.0 0.0 0.0 0.0 130-131 9.175 0.0 0.0 0.0 0.0 132-133 9.7875 0.0 0.0 0.0 0.0 134-135 10.55 0.0 0.0 0.0 0.0 136-137 11.5125 0.0 0.0 0.0 0.0 138-139 12.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACCAC 10 0.0069845165 143.925 2 TCAGCTG 10 0.0069845165 143.925 9 AACCACA 10 0.0069845165 143.925 3 CAGATAT 10 0.0069845165 143.925 1 TTCAGCT 10 0.0069845165 143.925 8 >>END_MODULE Read 955558 spots for SRR7169747.sra Written 955558 spots for SRR7169747.sra Read 955558 spots for SRR7169747.sra Written 955558 spots for SRR7169747.sra Read 955558 spots for SRR7169747.sra Written 955558 spots for SRR7169747.sra Read 955558 spots for SRR7169747.sra Written 955558 spots for SRR7169747.sra Read 955558 spots for SRR7169747.sra Written 955558 spots for SRR7169747.sra Read 955558 spots for SRR7169747.sra Written 955558 spots for SRR7169747.sra Read 955558 spots for SRR7169747.sra Written 955558 spots for SRR7169747.sra Read 955558 spots for SRR7169747.sra Written 955558 spots for SRR7169747.sra Read 955558 spots for SRR7169747.sra Written 955558 spots for SRR7169747.sra Read 955558 spots for SRR7169747.sra Written 955558 spots for SRR7169747.sra Read 955558 spots for SRR7169747.sra Written 955558 spots for SRR7169747.sra Read 955558 spots for SRR7169747.sra Written 955558 spots for SRR7169747.sra Read 955558 spots for SRR7169747.sra Written 955558 spots for SRR7169747.sra Read 955558 spots for SRR7169747.sra Written 955558 spots for SRR7169747.sra Read 955558 spots for SRR7169747.sra Written 955558 spots for SRR7169747.sra Read 955558 spots for SRR7169747.sra Written 955558 spots for SRR7169747.sra Read 955571 spots for SRR7169747.sra Written 955571 spots for SRR7169747.sra Read 955558 spots for SRR7169747.sra Written 955558 spots for SRR7169747.sra Read 955558 spots for SRR7169747.sra Written 955558 spots for SRR7169747.sra Read 955558 spots for SRR7169747.sra Written 955558 spots for SRR7169747.sra SRR ids: ['SRR7169747.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xmnebfnx SRR7169747.sra spots: 19111173 blocks: [[1, 955558], [955559, 1911116], [1911117, 2866674], [2866675, 3822232], [3822233, 4777790], [4777791, 5733348], [5733349, 6688906], [6688907, 7644464], [7644465, 8600022], [8600023, 9555580], [9555581, 10511138], [10511139, 11466696], [11466697, 12422254], [12422255, 13377812], [13377813, 14333370], [14333371, 15288928], [15288929, 16244486], [16244487, 17200044], [17200045, 18155602], [18155603, 19111173]] SRR7169747 file size 6454449 SRR7169747 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169747 SRR7169747_1.fastq SRR7169747_2.fastq Input file: SRR7169747_1.fastq Paired file: SRR7169747_2.fastq trimmed: SRR7169747-trimmed-pair1.fastq, SRR7169747-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 12:17:05 2025 >> started Tue Feb 11 12:17:38 2025 >> done (33.168s) 19111173 read pairs processed; of these: 9304 ( 0.05%) short read pairs filtered out after trimming by size control 11195 ( 0.06%) empty read pairs filtered out after trimming by size control 19090674 (99.89%) read pairs available; of these: 9652065 (50.56%) trimmed read pairs available after processing 9438609 (49.44%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 9 0.00% 21 4 0.00% 22 7 0.00% 23 9 0.00% 24 7 0.00% 25 9 0.00% 26 7 0.00% 27 13 0.00% 28 6 0.00% 29 7 0.00% 30 14 0.00% 31 17 0.00% 32 17 0.00% 33 14 0.00% 34 10 0.00% 35 28 0.00% 36 27 0.00% 37 25 0.00% 38 38 0.00% 39 31 0.00% 40 67 0.00% 41 49 0.00% 42 69 0.00% 43 78 0.00% 44 94 0.00% 45 77 0.00% 46 106 0.00% 47 115 0.00% 48 125 0.00% 49 178 0.00% 50 184 0.00% 51 242 0.00% 52 261 0.00% 53 278 0.00% 54 325 0.00% 55 341 0.00% 56 408 0.00% 57 418 0.00% 58 566 0.00% 59 593 0.00% 60 730 0.00% 61 900 0.00% 62 1002 0.01% 63 1156 0.01% 64 1317 0.01% 65 1356 0.01% 66 1511 0.01% 67 1738 0.01% 68 2008 0.01% 69 2277 0.01% 70 2537 0.01% 71 3000 0.02% 72 3556 0.02% 73 3988 0.02% 74 4542 0.02% 75 4991 0.03% 76 5539 0.03% 77 5993 0.03% 78 6387 0.03% 79 7227 0.04% 80 8002 0.04% 81 9147 0.05% 82 10404 0.05% 83 11475 0.06% 84 13146 0.07% 85 14634 0.08% 86 15412 0.08% 87 16212 0.08% 88 17283 0.09% 89 18132 0.09% 90 19806 0.10% 91 21322 0.11% 92 23094 0.12% 93 25234 0.13% 94 26703 0.14% 95 28141 0.15% 96 29338 0.15% 97 30394 0.16% 98 31502 0.17% 99 32719 0.17% 100 34115 0.18% 101 35542 0.19% 102 37921 0.20% 103 39434 0.21% 104 41409 0.22% 105 43509 0.23% 106 45515 0.24% 107 45983 0.24% 108 47052 0.25% 109 47473 0.25% 110 48522 0.25% 111 50484 0.26% 112 52589 0.28% 113 54135 0.28% 114 56465 0.30% 115 58749 0.31% 116 60199 0.32% 117 60905 0.32% 118 61964 0.32% 119 62721 0.33% 120 63384 0.33% 121 65519 0.34% 122 66751 0.35% 123 69254 0.36% 124 72014 0.38% 125 74529 0.39% 126 77003 0.40% 127 78899 0.41% 128 79986 0.42% 129 81227 0.43% 130 82811 0.43% 131 82435 0.43% 132 86755 0.45% 133 88495 0.46% 134 90784 0.48% 135 94713 0.50% 136 97817 0.51% 137 101378 0.53% 138 104797 0.55% 139 108983 0.57% 140 113922 0.60% 141 121054 0.63% 142 129702 0.68% 143 141422 0.74% 144 158470 0.83% 145 182801 0.96% 146 218282 1.14% 147 280480 1.47% 148 408923 2.14% 149 778839 4.08% 150 3997215 20.94% 151 9438609 49.44% 19090674 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=12.14 fanout-score-rank=12 prefix-density=0.29 prefix-fanout=6.5 sequence=CAACCTCAACAGT criterion=fanout-score sequence-density=0.09 sequence-density-rank=27 fanout-score=252.63 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=29.0 sequence=TTCTTCTTCTTT criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=37 prefix-density=0.29 prefix-fanout=2.2 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=21 fanout-score=296.39 fanout-score-rank=1 prefix-density=0.99 prefix-fanout=28.2 sequence=AAGAAGAAGAAA SRR7169747 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 12:18:38 Started mapping on | Feb 11 12:18:38 Finished on | Feb 11 12:20:50 Mapping speed, Million of reads per hour | 520.65 Number of input reads | 19090674 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 18291095 Uniquely mapped reads % | 95.81% Average mapped length | 288.97 Number of splices: Total | 17204650 Number of splices: Annotated (sjdb) | 16913121 Number of splices: GT/AG | 16942929 Number of splices: GC/AG | 206913 Number of splices: AT/AC | 15185 Number of splices: Non-canonical | 39623 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 345845 % of reads mapped to multiple loci | 1.81% Number of reads mapped to too many loci | 66029 % of reads mapped to too many loci | 0.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.97% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 463152 463152 463152 N_multimapping 345845 345845 345845 N_noFeature 464169 18055490 612276 N_ambiguous 155098 1078 66757 UnstrandedReadsAssigned:17671828 PositiveStrandReadsAssigned:234527 NegativeStrandReadsAssigned:17612062 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7169747 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169747-trimmed-pair1.fastq SRR7169747-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,090,674 reads, 17,554,679 reads pseudoaligned [quant] estimated average fragment length: 210.872 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,111 rounds 52401 SRR7169747.ke.tsv 34699 SRR7169747.se.tsv 87100 total ==> SRR7169747.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1808.13 326 10.9423 Potri.005G024800.1.v4.1 1035 825.128 58 4.26607 Potri.004G059700.1.v4.1 961 751.161 2 0.161592 Potri.007G009000.2.v4.1 1416 1206.13 0 0 Potri.003G141000.2.v4.1 2943 2733.13 337.063 7.48467 Potri.016G087400.1.v4.1 270 94.9444 1531.53 978.987 Potri.015G069301.1.v4.1 564 356.651 0 0 Potri.010G195200.1.v4.1 1773 1563.13 30 1.16479 Potri.012G127500.1.v4.1 977 767.155 9300 735.734 ==> SRR7169747.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1146 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 249 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169747 completed mapping pipeline successfully