Starting /dee2/code/volunteer_pipeline.sh SRR7169748 current disk space = 3050686414848 free memory = 1161169476 SRR7169748 SRAfilesize 4413ea774b93a041c14cf4c1da3ab069 SRR7169748.sra SRR7169748.sra file validated SRR7169748 is paired end SRR7169748 is conventional basespace SRR7169748 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169748_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.4105 30.0 18.0 33.0 18.0 33.0 2 25.5955 27.0 18.0 31.0 18.0 33.0 3 29.1325 30.0 27.0 33.0 25.0 33.0 4 31.54525 33.0 31.0 33.0 29.0 33.0 5 32.43 33.0 33.0 33.0 32.0 33.0 6 35.82025 37.0 36.0 38.0 32.0 38.0 7 36.31425 38.0 37.0 38.0 33.0 38.0 8 36.484 38.0 37.0 38.0 34.0 38.0 9 37.151 38.0 38.0 38.0 36.0 38.0 10-14 37.1028 38.0 38.0 38.0 35.8 38.0 15-19 36.65955 38.0 37.6 38.0 34.2 38.0 20-24 37.49905 38.0 38.0 38.0 36.8 38.0 25-29 37.53585 38.0 38.0 38.0 37.8 38.0 30-34 37.21065 38.0 38.0 38.0 36.4 38.0 35-39 37.3871 38.0 38.0 38.0 36.8 38.0 40-44 37.233399999999996 38.0 38.0 38.0 36.8 38.0 45-49 36.84785 38.0 37.8 38.0 34.8 38.0 50-54 37.35275 38.0 38.0 38.0 37.0 38.0 55-59 37.3691 38.0 38.0 38.0 37.0 38.0 60-64 37.312 38.0 38.0 38.0 36.8 38.0 65-69 37.246 38.0 38.0 38.0 36.0 38.0 70-74 37.12695 38.0 38.0 38.0 36.0 38.0 75-79 37.07275 38.0 38.0 38.0 36.0 38.0 80-84 36.970150000000004 38.0 38.0 38.0 35.4 38.0 85-89 36.9194 38.0 38.0 38.0 35.4 38.0 90-94 36.7976 38.0 38.0 38.0 35.0 38.0 95-99 36.589549999999996 38.0 38.0 38.0 34.2 38.0 100-104 36.56185 38.0 38.0 38.0 34.0 38.0 105-109 36.397400000000005 38.0 37.6 38.0 33.8 38.0 110-114 35.9134 38.0 36.6 38.0 32.0 38.0 115-119 35.89235 38.0 37.0 38.0 32.0 38.0 120-124 35.947250000000004 38.0 36.8 38.0 33.0 38.0 125-129 35.53405 38.0 36.0 38.0 30.6 38.0 130-134 35.0715 38.0 35.4 38.0 28.4 38.0 135-139 34.83565 38.0 35.0 38.0 27.6 38.0 140-144 34.63295 38.0 35.0 38.0 27.0 38.0 145-149 33.99965 38.0 35.0 38.0 24.2 38.0 150-151 30.054249999999996 36.0 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 4.0 19 3.0 20 3.0 21 1.0 22 3.0 23 5.0 24 5.0 25 7.0 26 14.0 27 9.0 28 25.0 29 29.0 30 34.0 31 63.0 32 62.0 33 116.0 34 213.0 35 384.0 36 1099.0 37 1919.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.788944723618094 9.824120603015075 7.989949748743719 49.39698492462312 2 20.200000000000003 12.7 34.949999999999996 32.15 3 18.47580847330158 17.297568312860363 26.548007019303082 37.67861619453497 4 22.6 25.275 22.475 29.65 5 23.275000000000002 31.0 24.65 21.075 6 18.5 35.875 25.2 20.424999999999997 7 13.475000000000001 27.474999999999998 40.975 18.075 8 16.825000000000003 27.1 32.75 23.325000000000003 9 17.075000000000003 24.875 34.5 23.549999999999997 10-14 19.25 30.475 27.195000000000004 23.080000000000002 15-19 19.245 28.99 27.49 24.275 20-24 19.395 29.375 27.474999999999998 23.755000000000003 25-29 19.42 29.98 27.165 23.435 30-34 19.425 29.09 28.065 23.419999999999998 35-39 19.285 29.654999999999998 27.615000000000002 23.445 40-44 19.675 29.28 27.495000000000005 23.549999999999997 45-49 19.759999999999998 28.549999999999997 27.29 24.4 50-54 19.57 29.110000000000003 27.26 24.060000000000002 55-59 19.415 29.26 27.26 24.065 60-64 19.64 28.625 27.450000000000003 24.285 65-69 19.605 28.939999999999998 28.000000000000004 23.455000000000002 70-74 20.265 28.449999999999996 27.51 23.775 75-79 20.16 27.99 27.3 24.55 80-84 19.925 28.725 27.375 23.974999999999998 85-89 20.07 28.299999999999997 27.389999999999997 24.240000000000002 90-94 20.235 28.375 27.18 24.21 95-99 20.105 28.95 27.400000000000002 23.544999999999998 100-104 20.09 28.82 27.48 23.61 105-109 20.823329331732694 28.15126050420168 26.850740296118445 24.17466986794718 110-114 20.155 28.88 27.229999999999997 23.735 115-119 21.095 28.87 26.534999999999997 23.5 120-124 20.515 28.665000000000003 26.815 24.005000000000003 125-129 20.89 28.34 26.41 24.36 130-134 20.595 28.825 26.484999999999996 24.095 135-139 20.630000000000003 28.294999999999998 26.5 24.575 140-144 20.26 28.455000000000002 26.395000000000003 24.89 145-149 21.27 28.275 25.86 24.595 150-151 20.8875 28.487499999999997 26.1625 24.462500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 0.5 23 1.0 24 3.0 25 4.0 26 4.0 27 4.0 28 5.0 29 9.0 30 14.5 31 24.0 32 33.0 33 48.0 34 63.0 35 76.0 36 92.0 37 107.5 38 127.5 39 150.0 40 189.0 41 227.0 42 239.5 43 248.5 44 275.5 45 288.5 46 275.5 47 262.5 48 241.5 49 204.0 50 172.5 51 150.5 52 123.0 53 90.0 54 63.0 55 49.5 56 38.5 57 28.5 58 20.5 59 13.0 60 8.5 61 6.5 62 4.5 63 2.5 64 3.5 65 3.5 66 1.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5 2 0.0 3 0.27499999999999997 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.04 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.32499999999999996 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.625 0.0 0.0 0.0 0.0 90-91 0.7375 0.0 0.0 0.0 0.0 92-93 0.9375 0.0 0.0 0.0 0.0 94-95 1.15 0.0 0.0 0.0 0.0 96-97 1.3375 0.0 0.0 0.0 0.0 98-99 1.5625 0.0 0.0 0.0 0.0 100-101 1.8375 0.0 0.0 0.0 0.0 102-103 2.05 0.0 0.0 0.0 0.0 104-105 2.25 0.0 0.0 0.0 0.0 106-107 2.55 0.0 0.0 0.0 0.0 108-109 2.8125 0.0 0.0 0.0 0.0 110-111 3.3 0.0 0.0 0.0 0.0 112-113 3.675 0.0 0.0 0.0 0.0 114-115 4.0375 0.0 0.0 0.0 0.0 116-117 4.5875 0.0 0.0 0.0 0.0 118-119 5.237500000000001 0.0 0.0 0.0 0.0 120-121 5.9375 0.0 0.0 0.0 0.0 122-123 6.574999999999999 0.0 0.0 0.0 0.0 124-125 7.3125 0.0 0.0 0.0 0.0 126-127 8.100000000000001 0.0 0.0 0.0 0.0 128-129 9.0 0.0 0.0 0.0 0.0 130-131 10.0375 0.0 0.0 0.0 0.0 132-133 10.625 0.0 0.0 0.0 0.0 134-135 11.2125 0.0 0.0 0.0 0.0 136-137 11.962499999999999 0.0 0.0 0.0 0.0 138-139 12.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCATCCC 10 0.006830828 145.0 8 CAGCAAT 30 0.0017973486 72.5 1 GGAAGAG 40 0.005621335 54.375 145 >>END_MODULE SRR7169748 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169748_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.051 33.0 33.0 34.0 32.0 34.0 2 33.2085 34.0 33.0 34.0 33.0 34.0 3 33.2305 34.0 33.0 34.0 33.0 34.0 4 33.2315 34.0 33.0 34.0 33.0 34.0 5 33.24075 34.0 33.0 34.0 33.0 34.0 6 37.46075 38.0 38.0 38.0 38.0 38.0 7 37.474 38.0 38.0 38.0 38.0 38.0 8 37.5375 38.0 38.0 38.0 38.0 38.0 9 37.36525 38.0 38.0 38.0 37.0 38.0 10-14 37.06685 38.0 38.0 38.0 35.6 38.0 15-19 37.410450000000004 38.0 38.0 38.0 37.4 38.0 20-24 37.32935 38.0 38.0 38.0 37.0 38.0 25-29 37.35210000000001 38.0 38.0 38.0 37.0 38.0 30-34 37.07925 38.0 38.0 38.0 36.4 38.0 35-39 37.3069 38.0 38.0 38.0 37.0 38.0 40-44 36.9978 38.0 38.0 38.0 35.6 38.0 45-49 37.38895000000001 38.0 38.0 38.0 37.0 38.0 50-54 36.921749999999996 38.0 37.6 38.0 34.8 38.0 55-59 37.0122 38.0 37.8 38.0 35.6 38.0 60-64 37.2094 38.0 38.0 38.0 36.6 38.0 65-69 37.011199999999995 38.0 38.0 38.0 36.0 38.0 70-74 36.959 38.0 38.0 38.0 36.0 38.0 75-79 36.9022 38.0 38.0 38.0 35.6 38.0 80-84 36.44145 38.0 37.6 38.0 33.4 38.0 85-89 36.9873 38.0 38.0 38.0 36.0 38.0 90-94 36.40415 38.0 37.6 38.0 33.4 38.0 95-99 36.8358 38.0 38.0 38.0 35.0 38.0 100-104 36.51195 38.0 38.0 38.0 34.4 38.0 105-109 35.66045 38.0 37.2 38.0 31.8 38.0 110-114 35.16825000000001 38.0 37.0 38.0 29.4 38.0 115-119 34.83665 38.0 37.0 38.0 28.6 38.0 120-124 34.24925 38.0 35.6 38.0 24.4 38.0 125-129 34.83095000000001 38.0 35.6 38.0 27.2 38.0 130-134 34.83655 38.0 35.2 38.0 27.4 38.0 135-139 35.11385 38.0 35.6 38.0 29.0 38.0 140-144 34.91025 38.0 35.2 38.0 29.2 38.0 145-149 34.23350000000001 38.0 33.6 38.0 27.2 38.0 150-151 29.7705 35.5 27.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 1.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 2.0 14 0.0 15 0.0 16 1.0 17 3.0 18 3.0 19 3.0 20 4.0 21 5.0 22 4.0 23 10.0 24 5.0 25 12.0 26 15.0 27 14.0 28 26.0 29 32.0 30 51.0 31 74.0 32 107.0 33 127.0 34 185.0 35 303.0 36 721.0 37 2288.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.050000000000004 21.575 14.075 30.3 2 27.900000000000002 24.65 31.324999999999996 16.125 3 20.075000000000003 26.400000000000002 32.95 20.575 4 25.2 31.15 24.175 19.475 5 25.124999999999996 35.55 23.525 15.8 6 20.575 38.3 22.55 18.575 7 20.3 21.925 38.775 19.0 8 21.349999999999998 25.224999999999998 30.0 23.425 9 22.7 24.65 31.125000000000004 21.525 10-14 23.630000000000003 29.265 25.790000000000003 21.315 15-19 23.76 28.025 27.045 21.17 20-24 23.65 27.92 27.495000000000005 20.935000000000002 25-29 23.34 28.08 27.255000000000003 21.325 30-34 23.724999999999998 28.21 27.435 20.630000000000003 35-39 23.28 28.084999999999997 27.93 20.705000000000002 40-44 24.310000000000002 28.175 27.665 19.85 45-49 23.615 27.950000000000003 28.01 20.424999999999997 50-54 23.669999999999998 27.884999999999998 27.985 20.46 55-59 23.95 27.529999999999998 27.975 20.544999999999998 60-64 23.705000000000002 27.83 28.4 20.064999999999998 65-69 23.825 28.044999999999998 27.575 20.555 70-74 23.780182346458272 27.968139464983473 27.63250175333133 20.619176435226933 75-79 23.4984984984985 27.62262262262262 28.373373373373372 20.505505505505507 80-84 24.51490298059612 27.570514102820564 27.830566113222645 20.084016803360672 85-89 24.654999999999998 27.295 27.675 20.375 90-94 23.785 27.815 28.144999999999996 20.255000000000003 95-99 23.685000000000002 27.88 28.349999999999998 20.085 100-104 24.514708825295177 27.9217530518311 27.70162097258355 19.86191715029017 105-109 23.757298806803757 27.514597613607517 28.783955318608783 19.944148260979944 110-114 24.663515873831297 28.192746326929 27.607109832528508 19.53662796671119 115-119 24.924439812402294 27.65502866076081 27.75403856175091 19.666492965085983 120-124 25.2078706811961 27.40794298404173 27.361462583277387 20.02272375148479 125-129 25.629719730373523 28.295575490345144 26.952511276671228 19.122193502610106 130-134 25.866986938898062 27.96877345743882 27.073012060251212 19.0912275434119 135-139 26.14 28.07 26.91 18.88 140-144 26.66 27.894999999999996 26.365 19.08 145-149 27.175 28.705000000000002 26.345000000000002 17.775 150-151 27.5125 27.6625 26.8 18.025 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 1.0 26 1.5 27 1.0 28 2.5 29 3.0 30 9.0 31 13.0 32 18.5 33 26.5 34 32.5 35 53.5 36 81.0 37 110.5 38 135.0 39 170.0 40 193.0 41 221.5 42 269.5 43 294.0 44 286.5 45 293.0 46 287.5 47 265.0 48 242.0 49 210.0 50 182.0 51 139.0 52 105.0 53 85.0 54 76.5 55 57.5 56 41.0 57 31.0 58 16.0 59 11.0 60 12.0 61 7.5 62 4.0 63 4.0 64 2.5 65 1.0 66 1.0 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.19 75-79 0.1 80-84 0.02 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.06 105-109 1.525 110-114 2.67 115-119 4.05 120-124 3.1850000000000005 125-129 1.345 130-134 0.08499999999999999 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.07500000000000001 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.3 0.0 0.0 0.0 0.0 80-81 0.32499999999999996 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.42500000000000004 0.0 0.0 0.0 0.0 86-87 0.525 0.0 0.0 0.0 0.0 88-89 0.65 0.0 0.0 0.0 0.0 90-91 0.7625 0.0 0.0 0.0 0.0 92-93 0.9625 0.0 0.0 0.0 0.0 94-95 1.2 0.0 0.0 0.0 0.0 96-97 1.3624999999999998 0.0 0.0 0.0 0.0 98-99 1.5875 0.0 0.0 0.0 0.0 100-101 1.8375 0.0 0.0 0.0 0.0 102-103 2.0374999999999996 0.0 0.0 0.0 0.0 104-105 2.2125 0.0 0.0 0.0 0.0 106-107 2.4875 0.0 0.0 0.0 0.0 108-109 2.7125 0.0 0.0 0.0 0.0 110-111 3.1875 0.0 0.0 0.0 0.0 112-113 3.575 0.0 0.0 0.0 0.0 114-115 3.9000000000000004 0.0 0.0 0.0 0.0 116-117 4.4625 0.0 0.0 0.0 0.0 118-119 5.0625 0.0 0.0 0.0 0.0 120-121 5.75 0.0 0.0 0.0 0.0 122-123 6.3875 0.0 0.0 0.0 0.0 124-125 7.0875 0.0 0.0 0.0 0.0 126-127 7.875 0.0 0.0 0.0 0.0 128-129 8.825 0.0 0.0 0.0 0.0 130-131 9.8875 0.0 0.0 0.0 0.0 132-133 10.5125 0.0 0.0 0.0 0.0 134-135 11.1125 0.0 0.0 0.0 0.0 136-137 11.8625 0.0 0.0 0.0 0.0 138-139 12.850000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCCTTA 10 0.007015441 143.7125 145 >>END_MODULE Read 580181 spots for SRR7169748.sra Written 580181 spots for SRR7169748.sra Read 580181 spots for SRR7169748.sra Written 580181 spots for SRR7169748.sra Read 580181 spots for SRR7169748.sra Written 580181 spots for SRR7169748.sra Read 580181 spots for SRR7169748.sra Written 580181 spots for SRR7169748.sra Read 580181 spots for SRR7169748.sra Written 580181 spots for SRR7169748.sra Read 580181 spots for SRR7169748.sra Written 580181 spots for SRR7169748.sra Read 580181 spots for SRR7169748.sra Written 580181 spots for SRR7169748.sra Read 580181 spots for SRR7169748.sra Written 580181 spots for SRR7169748.sra Read 580181 spots for SRR7169748.sra Written 580181 spots for SRR7169748.sra Read 580181 spots for SRR7169748.sra Written 580181 spots for SRR7169748.sra Read 580181 spots for SRR7169748.sra Written 580181 spots for SRR7169748.sra Read 580194 spots for SRR7169748.sra Written 580194 spots for SRR7169748.sra Read 580181 spots for SRR7169748.sra Written 580181 spots for SRR7169748.sra Read 580181 spots for SRR7169748.sra Written 580181 spots for SRR7169748.sra Read 580181 spots for SRR7169748.sra Written 580181 spots for SRR7169748.sra Read 580181 spots for SRR7169748.sra Written 580181 spots for SRR7169748.sra Read 580181 spots for SRR7169748.sra Written 580181 spots for SRR7169748.sra Read 580181 spots for SRR7169748.sra Written 580181 spots for SRR7169748.sra Read 580181 spots for SRR7169748.sra Written 580181 spots for SRR7169748.sra Read 580181 spots for SRR7169748.sra Written 580181 spots for SRR7169748.sra SRR ids: ['SRR7169748.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_53ya3yu0 SRR7169748.sra spots: 11603633 blocks: [[1, 580181], [580182, 1160362], [1160363, 1740543], [1740544, 2320724], [2320725, 2900905], [2900906, 3481086], [3481087, 4061267], [4061268, 4641448], [4641449, 5221629], [5221630, 5801810], [5801811, 6381991], [6381992, 6962172], [6962173, 7542353], [7542354, 8122534], [8122535, 8702715], [8702716, 9282896], [9282897, 9863077], [9863078, 10443258], [10443259, 11023439], [11023440, 11603633]] SRR7169748 file size 3910390 SRR7169748 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169748 SRR7169748_1.fastq SRR7169748_2.fastq Input file: SRR7169748_1.fastq Paired file: SRR7169748_2.fastq trimmed: SRR7169748-trimmed-pair1.fastq, SRR7169748-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 12:44:39 2025 >> started Tue Feb 11 12:44:52 2025 >> done (13.053s) 11603633 read pairs processed; of these: 3130 ( 0.03%) short read pairs filtered out after trimming by size control 5462 ( 0.05%) empty read pairs filtered out after trimming by size control 11595041 (99.93%) read pairs available; of these: 5899621 (50.88%) trimmed read pairs available after processing 5695420 (49.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 2 0.00% 21 2 0.00% 22 4 0.00% 23 5 0.00% 24 6 0.00% 25 7 0.00% 26 7 0.00% 27 5 0.00% 28 5 0.00% 29 4 0.00% 30 8 0.00% 31 8 0.00% 32 8 0.00% 33 14 0.00% 34 12 0.00% 35 15 0.00% 36 24 0.00% 37 28 0.00% 38 39 0.00% 39 29 0.00% 40 28 0.00% 41 42 0.00% 42 38 0.00% 43 56 0.00% 44 45 0.00% 45 64 0.00% 46 61 0.00% 47 76 0.00% 48 61 0.00% 49 83 0.00% 50 98 0.00% 51 148 0.00% 52 133 0.00% 53 149 0.00% 54 189 0.00% 55 183 0.00% 56 206 0.00% 57 267 0.00% 58 271 0.00% 59 307 0.00% 60 366 0.00% 61 437 0.00% 62 476 0.00% 63 548 0.00% 64 617 0.01% 65 682 0.01% 66 755 0.01% 67 848 0.01% 68 932 0.01% 69 1083 0.01% 70 1184 0.01% 71 1386 0.01% 72 1604 0.01% 73 1841 0.02% 74 1967 0.02% 75 2291 0.02% 76 2626 0.02% 77 2875 0.02% 78 3154 0.03% 79 3502 0.03% 80 3739 0.03% 81 4088 0.04% 82 4649 0.04% 83 5397 0.05% 84 6207 0.05% 85 6966 0.06% 86 7480 0.06% 87 8248 0.07% 88 9019 0.08% 89 9677 0.08% 90 10353 0.09% 91 11070 0.10% 92 11865 0.10% 93 12988 0.11% 94 14187 0.12% 95 15423 0.13% 96 16527 0.14% 97 17485 0.15% 98 18412 0.16% 99 19187 0.17% 100 19934 0.17% 101 20707 0.18% 102 22274 0.19% 103 22913 0.20% 104 24477 0.21% 105 25703 0.22% 106 27117 0.23% 107 28150 0.24% 108 29115 0.25% 109 30101 0.26% 110 30548 0.26% 111 31359 0.27% 112 33154 0.29% 113 33569 0.29% 114 34990 0.30% 115 36205 0.31% 116 37759 0.33% 117 38896 0.34% 118 39621 0.34% 119 40268 0.35% 120 41587 0.36% 121 42142 0.36% 122 42633 0.37% 123 43698 0.38% 124 44511 0.38% 125 46468 0.40% 126 47633 0.41% 127 49014 0.42% 128 50419 0.43% 129 51097 0.44% 130 52356 0.45% 131 53174 0.46% 132 54212 0.47% 133 55283 0.48% 134 56788 0.49% 135 57523 0.50% 136 59913 0.52% 137 61788 0.53% 138 65473 0.56% 139 68140 0.59% 140 70083 0.60% 141 74828 0.65% 142 80132 0.69% 143 86706 0.75% 144 95521 0.82% 145 111104 0.96% 146 135903 1.17% 147 177272 1.53% 148 251913 2.17% 149 490842 4.23% 150 2429726 20.95% 151 5695420 49.12% 11595041 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.34 fanout-score-rank=41 prefix-density=0.22 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACGAACTGGATTGTGCGCTTGGTCTTGATGGTAGCCACAGCTGCATTCACATCCTTGGGCACAACATCACCTCTATACATCAGGCAGCAAGCCATGTACTTGCCATGACGTGGGTCACACTTGGCCATCATGGATGATGGCTCAAAAGCACTGTTGGTTATCTCAGCCACAGAGAGCTGCTCATGGTATGCCTTCTCTGCGGAGATGACAGGGGCATAAGAGGAAAGCATGAAATGGATCCTGGGGTATGGAACCAAGTTGGTTTGGAACTCAGTAACATCCACATTAAGAGCTCCATCAAACCTTAATGAGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=20 fanout-score=295.77 fanout-score-rank=1 prefix-density=0.99 prefix-fanout=29.4 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=3.34 fanout-score-rank=32 prefix-density=0.20 prefix-fanout=2.7 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=12 fanout-score=297.92 fanout-score-rank=1 prefix-density=1.06 prefix-fanout=29.2 sequence=AAGAAGAAGAAA SRR7169748 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 12:45:38 Started mapping on | Feb 11 12:45:39 Finished on | Feb 11 12:47:05 Mapping speed, Million of reads per hour | 485.37 Number of input reads | 11595041 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 11129737 Uniquely mapped reads % | 95.99% Average mapped length | 289.37 Number of splices: Total | 10069715 Number of splices: Annotated (sjdb) | 9889165 Number of splices: GT/AG | 9918819 Number of splices: GC/AG | 119648 Number of splices: AT/AC | 8850 Number of splices: Non-canonical | 22398 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 210347 % of reads mapped to multiple loci | 1.81% Number of reads mapped to too many loci | 20595 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.98% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 258089 258089 258089 N_multimapping 210347 210347 210347 N_noFeature 258863 11002183 312950 N_ambiguous 116716 522 42926 UnstrandedReadsAssigned:10754158 PositiveStrandReadsAssigned:127032 NegativeStrandReadsAssigned:10773861 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR7169748 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169748-trimmed-pair1.fastq SRR7169748-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,595,041 reads, 10,712,141 reads pseudoaligned [quant] estimated average fragment length: 205.279 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,051 rounds 52401 SRR7169748.ke.tsv 34699 SRR7169748.se.tsv 87100 total ==> SRR7169748.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1813.72 179 8.66894 Potri.005G024800.1.v4.1 1035 830.721 26 2.74917 Potri.004G059700.1.v4.1 961 756.731 11 1.27683 Potri.007G009000.2.v4.1 1416 1211.72 0 0 Potri.003G141000.2.v4.1 2943 2738.72 199.033 6.38351 Potri.016G087400.1.v4.1 270 94.2235 1431 1334.02 Potri.015G069301.1.v4.1 564 361.029 0 0 Potri.010G195200.1.v4.1 1773 1568.72 23 1.28785 Potri.012G127500.1.v4.1 977 772.731 3947 448.665 ==> SRR7169748.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 862 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 216 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 34 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169748 completed mapping pipeline successfully