Starting /dee2/code/volunteer_pipeline.sh SRR7169749 current disk space = 3050778157056 free memory = 1416493096 SRR7169749 SRAfilesize b8d903524b9d6684f4e8a7c160b8f50f SRR7169749.sra SRR7169749.sra file validated SRR7169749 is paired end SRR7169749 is conventional basespace SRR7169749 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169749_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.295 30.0 18.0 33.0 18.0 34.0 2 28.292 29.0 25.0 33.0 18.0 33.0 3 31.07375 31.0 30.0 33.0 27.0 33.0 4 32.50525 33.0 33.0 33.0 31.0 34.0 5 32.97525 33.0 33.0 34.0 33.0 34.0 6 36.95625 38.0 37.0 38.0 35.0 38.0 7 37.27525 38.0 38.0 38.0 36.0 38.0 8 37.48375 38.0 38.0 38.0 37.0 38.0 9 37.6255 38.0 38.0 38.0 38.0 38.0 10-14 37.61450000000001 38.0 38.0 38.0 37.8 38.0 15-19 37.680099999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.639050000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.568 38.0 38.0 38.0 38.0 38.0 30-34 37.5554 38.0 38.0 38.0 37.8 38.0 35-39 37.405550000000005 38.0 38.0 38.0 37.2 38.0 40-44 37.3528 38.0 38.0 38.0 37.0 38.0 45-49 37.362350000000006 38.0 38.0 38.0 37.0 38.0 50-54 37.11175000000001 38.0 38.0 38.0 36.0 38.0 55-59 37.352500000000006 38.0 38.0 38.0 36.8 38.0 60-64 37.35085 38.0 38.0 38.0 36.8 38.0 65-69 36.973749999999995 38.0 38.0 38.0 35.4 38.0 70-74 37.2307 38.0 38.0 38.0 36.4 38.0 75-79 37.14945 38.0 38.0 38.0 35.8 38.0 80-84 36.997949999999996 38.0 38.0 38.0 35.6 38.0 85-89 36.74974999999999 38.0 38.0 38.0 35.0 38.0 90-94 36.7513 38.0 38.0 38.0 34.8 38.0 95-99 36.7432 38.0 38.0 38.0 34.8 38.0 100-104 36.63615 38.0 38.0 38.0 34.6 38.0 105-109 36.4833 38.0 37.8 38.0 34.0 38.0 110-114 36.12355 38.0 37.4 38.0 33.2 38.0 115-119 35.477599999999995 38.0 36.2 38.0 29.6 38.0 120-124 36.071299999999994 38.0 37.0 38.0 33.0 38.0 125-129 34.820550000000004 38.0 35.0 38.0 26.4 38.0 130-134 34.947199999999995 38.0 35.4 38.0 27.0 38.0 135-139 35.39945 38.0 36.0 38.0 31.0 38.0 140-144 34.62330000000001 38.0 35.0 38.0 27.4 38.0 145-149 34.138 38.0 35.0 38.0 25.4 38.0 150-151 30.703125 36.5 29.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 3.0 17 1.0 18 1.0 19 2.0 20 0.0 21 2.0 22 5.0 23 4.0 24 11.0 25 4.0 26 8.0 27 7.0 28 28.0 29 34.0 30 28.0 31 37.0 32 63.0 33 96.0 34 177.0 35 342.0 36 962.0 37 2182.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.050632911392405 11.544303797468354 9.037974683544302 41.36708860759494 2 21.425 15.25 34.150000000000006 29.175 3 18.475 19.875 26.55 35.099999999999994 4 22.425 30.375000000000004 21.65 25.55 5 22.45 33.5 24.15 19.900000000000002 6 19.175 36.3 25.525 19.0 7 14.374999999999998 25.75 41.65 18.224999999999998 8 18.875 25.874999999999996 30.599999999999998 24.65 9 17.525 24.6 33.025 24.85 10-14 20.325 30.080000000000002 26.669999999999998 22.925 15-19 20.01 28.98 27.555000000000003 23.455000000000002 20-24 19.6 28.910000000000004 27.425 24.065 25-29 20.275000000000002 28.645 27.42 23.66 30-34 19.785 29.09 27.375 23.75 35-39 20.200000000000003 28.645 27.474999999999998 23.68 40-44 20.525 29.080000000000002 27.155 23.24 45-49 20.73 28.804999999999996 26.939999999999998 23.525 50-54 20.52 28.595 27.35 23.535 55-59 20.23 28.865000000000002 26.795 24.11 60-64 20.03 28.615000000000002 27.355 24.0 65-69 20.595 28.405 27.655 23.345 70-74 20.26 28.715000000000003 27.755000000000003 23.27 75-79 20.3 28.895 26.845000000000002 23.96 80-84 20.525 28.77 27.33 23.375 85-89 21.224999999999998 28.499999999999996 26.979999999999997 23.294999999999998 90-94 20.435 28.560000000000002 26.979999999999997 24.025 95-99 20.674999999999997 28.050000000000004 27.305 23.97 100-104 21.035 28.199999999999996 26.96 23.805 105-109 20.595 28.615000000000002 26.63 24.16 110-114 20.10260021123573 28.949353719257658 26.88729065030428 24.060755419202334 115-119 20.785 28.87 26.955000000000002 23.39 120-124 20.849999999999998 28.825 26.795 23.53 125-129 20.669999999999998 28.28 26.795 24.255 130-134 20.79 29.38 26.605 23.225 135-139 20.925 28.615000000000002 26.534999999999997 23.925 140-144 21.315 28.355000000000004 26.775 23.555 145-149 21.015 29.060000000000002 26.095000000000002 23.830000000000002 150-151 20.7875 28.7 26.275 24.2375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.5 22 0.5 23 0.0 24 0.5 25 2.0 26 2.5 27 5.5 28 10.5 29 11.0 30 11.5 31 17.5 32 35.5 33 41.5 34 47.5 35 68.0 36 86.0 37 111.0 38 128.0 39 147.0 40 178.0 41 209.5 42 234.5 43 250.0 44 271.5 45 283.5 46 267.5 47 266.5 48 247.0 49 207.5 50 184.0 51 159.0 52 128.0 53 94.5 54 78.0 55 63.5 56 40.5 57 29.0 58 28.0 59 18.5 60 9.0 61 5.0 62 4.0 63 3.0 64 1.5 65 2.5 66 3.0 67 1.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.585 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37075257991442 98.7 2 0.5789076264787314 1.15 3 0.05033979360684621 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.21250000000000002 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.3125 0.0 0.0 0.0 0.0 80-81 0.3625 0.0 0.0 0.0 0.0 82-83 0.45 0.0 0.0 0.0 0.0 84-85 0.525 0.0 0.0 0.0 0.0 86-87 0.55 0.0 0.0 0.0 0.0 88-89 0.675 0.0 0.0 0.0 0.0 90-91 0.8625 0.0 0.0 0.0 0.0 92-93 1.0125 0.0 0.0 0.0 0.0 94-95 1.15 0.0 0.0 0.0 0.0 96-97 1.45 0.0 0.0 0.0 0.0 98-99 1.7125 0.0 0.0 0.0 0.0 100-101 1.95 0.0 0.0 0.0 0.0 102-103 2.2249999999999996 0.0 0.0 0.0 0.0 104-105 2.4125 0.0 0.0 0.0 0.0 106-107 2.625 0.0 0.0 0.0 0.0 108-109 2.9000000000000004 0.0 0.0 0.0 0.0 110-111 3.15 0.0 0.0 0.0 0.0 112-113 3.4875 0.0 0.0 0.0 0.0 114-115 3.925 0.0 0.0 0.0 0.0 116-117 4.35 0.0 0.0 0.0 0.0 118-119 4.725 0.0 0.0 0.0 0.0 120-121 5.1875 0.0 0.0 0.0 0.0 122-123 5.625 0.0 0.0 0.0 0.0 124-125 6.275 0.0 0.0 0.0 0.0 126-127 6.7 0.0 0.0 0.0 0.0 128-129 7.1625 0.0 0.0 0.0 0.0 130-131 7.6 0.0 0.0 0.0 0.0 132-133 8.025 0.0 0.0 0.0 0.0 134-135 8.7625 0.0 0.0 0.0 0.0 136-137 9.375 0.0 0.0 0.0 0.0 138-139 10.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGGAGA 10 0.006864391 144.7625 145 >>END_MODULE SRR7169749 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169749_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.84275 33.0 33.0 34.0 32.0 34.0 2 32.97075 33.0 33.0 34.0 32.0 34.0 3 32.05125 33.0 33.0 34.0 28.0 34.0 4 32.46125 33.0 33.0 34.0 31.0 34.0 5 32.97925 33.0 33.0 34.0 32.0 34.0 6 37.3675 38.0 38.0 38.0 37.0 38.0 7 37.41325 38.0 38.0 38.0 37.0 38.0 8 37.4265 38.0 38.0 38.0 38.0 38.0 9 37.5065 38.0 38.0 38.0 38.0 38.0 10-14 37.40745 38.0 38.0 38.0 37.8 38.0 15-19 37.46915 38.0 38.0 38.0 38.0 38.0 20-24 36.84825 38.0 37.8 38.0 35.2 38.0 25-29 37.366550000000004 38.0 38.0 38.0 37.4 38.0 30-34 37.411500000000004 38.0 38.0 38.0 37.6 38.0 35-39 37.418899999999994 38.0 38.0 38.0 37.6 38.0 40-44 37.342150000000004 38.0 38.0 38.0 37.2 38.0 45-49 37.393899999999995 38.0 38.0 38.0 37.6 38.0 50-54 37.35 38.0 38.0 38.0 37.4 38.0 55-59 37.196600000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.114650000000005 38.0 38.0 38.0 36.6 38.0 65-69 37.07215 38.0 38.0 38.0 36.2 38.0 70-74 37.026650000000004 38.0 38.0 38.0 36.0 38.0 75-79 36.6426 38.0 38.0 38.0 36.0 38.0 80-84 36.2357 38.0 37.4 38.0 33.4 38.0 85-89 36.793699999999994 38.0 38.0 38.0 35.4 38.0 90-94 36.9824 38.0 38.0 38.0 36.0 38.0 95-99 36.87285 38.0 38.0 38.0 35.8 38.0 100-104 36.64385 38.0 38.0 38.0 35.0 38.0 105-109 35.208450000000006 38.0 36.6 38.0 28.4 38.0 110-114 34.63485 38.0 37.0 38.0 26.4 38.0 115-119 33.804 38.0 36.6 38.0 18.2 38.0 120-124 33.70495 38.0 36.0 38.0 17.8 38.0 125-129 33.8481 38.0 36.0 38.0 19.8 38.0 130-134 34.67635 38.0 35.8 38.0 25.4 38.0 135-139 35.05955 38.0 36.0 38.0 29.2 38.0 140-144 34.818 38.0 35.8 38.0 29.0 38.0 145-149 34.2221 38.0 34.6 38.0 27.4 38.0 150-151 29.98925 35.5 27.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 1.0 4 2.0 5 1.0 6 0.0 7 0.0 8 1.0 9 0.0 10 2.0 11 1.0 12 2.0 13 0.0 14 1.0 15 1.0 16 3.0 17 3.0 18 0.0 19 2.0 20 10.0 21 11.0 22 6.0 23 9.0 24 16.0 25 13.0 26 11.0 27 22.0 28 31.0 29 36.0 30 62.0 31 73.0 32 113.0 33 140.0 34 142.0 35 245.0 36 587.0 37 2451.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.925000000000004 19.425 15.0 29.65 2 26.700000000000003 25.25 31.0 17.05 3 19.2 28.975 31.424999999999997 20.4 4 23.474999999999998 34.125 24.575 17.825 5 24.4 34.55 23.3 17.75 6 19.475 37.125 24.3 19.1 7 19.400000000000002 21.25 39.975 19.375 8 21.725 24.75 28.4 25.124999999999996 9 21.725 24.275 30.75 23.25 10-14 22.95 28.205000000000002 26.46 22.384999999999998 15-19 23.66 27.04 28.055000000000003 21.245 20-24 22.305 28.335 27.83 21.529999999999998 25-29 22.945 28.194999999999997 27.500000000000004 21.36 30-34 23.669999999999998 27.839999999999996 27.650000000000002 20.84 35-39 22.57 28.42 27.839999999999996 21.17 40-44 22.759999999999998 27.435 28.73 21.075 45-49 23.855 27.334999999999997 28.044999999999998 20.765 50-54 23.53 28.54 27.375 20.555 55-59 24.16 27.084999999999997 28.050000000000004 20.705000000000002 60-64 23.799999999999997 27.43 28.335 20.435 65-69 23.599999999999998 27.700000000000003 27.810000000000002 20.89 70-74 23.53 27.865000000000002 28.075 20.53 75-79 22.950073347159694 27.295260255956293 28.701502352167534 21.053164044716475 80-84 22.821222026653256 28.3077696756349 28.192104601458386 20.678903696253457 85-89 23.415 26.82 29.015 20.75 90-94 23.48 27.365000000000002 28.255000000000003 20.9 95-99 23.84 28.055000000000003 27.555000000000003 20.549999999999997 100-104 23.90814948221522 27.30001500825454 28.29556255940767 20.496272950122567 105-109 24.051463168516648 27.593340060544904 27.825428859737638 20.529767911200807 110-114 24.220097193917542 26.822385953911272 28.494539373987564 20.46297747818362 115-119 24.398864670915223 28.152948106892307 27.644192149092273 19.803995073100197 120-124 24.292977438830633 27.73540938459909 27.841330367545815 20.130282809024468 125-129 25.018500898615077 27.80949360397505 27.60334073369278 19.568664763717095 130-134 25.729040097205345 26.903604698258405 27.490886998784937 19.876468205751316 135-139 25.14 28.065 27.195000000000004 19.6 140-144 26.135 27.93 27.005000000000003 18.93 145-149 25.905 28.53 26.36 19.205 150-151 25.75 27.4125 26.974999999999998 19.8625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 0.5 24 0.0 25 0.0 26 2.5 27 3.0 28 5.5 29 10.0 30 8.0 31 11.5 32 18.0 33 29.5 34 40.0 35 55.5 36 75.0 37 102.0 38 128.0 39 151.5 40 189.5 41 233.5 42 269.0 43 285.0 44 301.5 45 304.5 46 295.5 47 280.0 48 242.5 49 196.5 50 174.0 51 147.5 52 119.0 53 96.0 54 64.0 55 44.5 56 31.0 57 23.0 58 18.5 59 14.0 60 6.5 61 3.0 62 5.0 63 4.5 64 2.5 65 1.5 66 1.0 67 0.0 68 0.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 1.155 80-84 0.575 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.055 105-109 0.8999999999999999 110-114 4.315 115-119 6.635000000000001 120-124 5.59 125-129 5.41 130-134 1.24 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.21250000000000002 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.3125 0.0 0.0 0.0 0.0 80-81 0.3625 0.0 0.0 0.0 0.0 82-83 0.45 0.0 0.0 0.0 0.0 84-85 0.525 0.0 0.0 0.0 0.0 86-87 0.55 0.0 0.0 0.0 0.0 88-89 0.7 0.0 0.0 0.0 0.0 90-91 0.9125000000000001 0.0 0.0 0.0 0.0 92-93 1.0625 0.0 0.0 0.0 0.0 94-95 1.2125 0.0 0.0 0.0 0.0 96-97 1.4874999999999998 0.0 0.0 0.0 0.0 98-99 1.725 0.0 0.0 0.0 0.0 100-101 1.95 0.0 0.0 0.0 0.0 102-103 2.1875 0.0 0.0 0.0 0.0 104-105 2.3625 0.0 0.0 0.0 0.0 106-107 2.5625 0.0 0.0 0.0 0.0 108-109 2.825 0.0 0.0 0.0 0.0 110-111 3.075 0.0 0.0 0.0 0.0 112-113 3.4124999999999996 0.0 0.0 0.0 0.0 114-115 3.85 0.0 0.0 0.0 0.0 116-117 4.275 0.0 0.0 0.0 0.0 118-119 4.675 0.0 0.0 0.0 0.0 120-121 5.075 0.0 0.0 0.0 0.0 122-123 5.475 0.0 0.0 0.0 0.0 124-125 6.125 0.0 0.0 0.0 0.0 126-127 6.5625 0.0 0.0 0.0 0.0 128-129 6.9625 0.0 0.0 0.0 0.0 130-131 7.45 0.0 0.0 0.0 0.0 132-133 7.9125000000000005 0.0 0.0 0.0 0.0 134-135 8.6625 0.0 0.0 0.0 0.0 136-137 9.274999999999999 0.0 0.0 0.0 0.0 138-139 9.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGCTC 10 0.00714285 142.84999 1 >>END_MODULE Read 747938 spots for SRR7169749.sra Written 747938 spots for SRR7169749.sra Read 747938 spots for SRR7169749.sra Written 747938 spots for SRR7169749.sra Read 747938 spots for SRR7169749.sra Written 747938 spots for SRR7169749.sra Read 747938 spots for SRR7169749.sra Written 747938 spots for SRR7169749.sra Read 747938 spots for SRR7169749.sra Written 747938 spots for SRR7169749.sra Read 747938 spots for SRR7169749.sra Written 747938 spots for SRR7169749.sra Read 747938 spots for SRR7169749.sra Written 747938 spots for SRR7169749.sra Read 747938 spots for SRR7169749.sra Written 747938 spots for SRR7169749.sra Read 747938 spots for SRR7169749.sra Written 747938 spots for SRR7169749.sra Read 747938 spots for SRR7169749.sra Written 747938 spots for SRR7169749.sra Read 747938 spots for SRR7169749.sra Written 747938 spots for SRR7169749.sra Read 747938 spots for SRR7169749.sra Written 747938 spots for SRR7169749.sra Read 747938 spots for SRR7169749.sra Written 747938 spots for SRR7169749.sra Read 747938 spots for SRR7169749.sra Written 747938 spots for SRR7169749.sra Read 747938 spots for SRR7169749.sra Written 747938 spots for SRR7169749.sra Read 747938 spots for SRR7169749.sra Written 747938 spots for SRR7169749.sra Read 747938 spots for SRR7169749.sra Written 747938 spots for SRR7169749.sra Read 747954 spots for SRR7169749.sra Written 747954 spots for SRR7169749.sra Read 747938 spots for SRR7169749.sra Written 747938 spots for SRR7169749.sra Read 747938 spots for SRR7169749.sra Written 747938 spots for SRR7169749.sra SRR ids: ['SRR7169749.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r9x2p9hl SRR7169749.sra spots: 14958776 blocks: [[1, 747938], [747939, 1495876], [1495877, 2243814], [2243815, 2991752], [2991753, 3739690], [3739691, 4487628], [4487629, 5235566], [5235567, 5983504], [5983505, 6731442], [6731443, 7479380], [7479381, 8227318], [8227319, 8975256], [8975257, 9723194], [9723195, 10471132], [10471133, 11219070], [11219071, 11967008], [11967009, 12714946], [12714947, 13462884], [13462885, 14210822], [14210823, 14958776]] SRR7169749 file size 5047337 SRR7169749 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169749 SRR7169749_1.fastq SRR7169749_2.fastq Input file: SRR7169749_1.fastq Paired file: SRR7169749_2.fastq trimmed: SRR7169749-trimmed-pair1.fastq, SRR7169749-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 12:34:18 2025 >> started Tue Feb 11 12:34:43 2025 >> done (25.553s) 14958776 read pairs processed; of these: 6535 ( 0.04%) short read pairs filtered out after trimming by size control 8188 ( 0.05%) empty read pairs filtered out after trimming by size control 14944053 (99.90%) read pairs available; of these: 7202506 (48.20%) trimmed read pairs available after processing 7741547 (51.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 4 0.00% 21 2 0.00% 22 0 0.00% 23 8 0.00% 24 3 0.00% 25 4 0.00% 26 11 0.00% 27 6 0.00% 28 5 0.00% 29 4 0.00% 30 6 0.00% 31 8 0.00% 32 5 0.00% 33 8 0.00% 34 7 0.00% 35 12 0.00% 36 11 0.00% 37 11 0.00% 38 8 0.00% 39 29 0.00% 40 29 0.00% 41 22 0.00% 42 35 0.00% 43 41 0.00% 44 31 0.00% 45 35 0.00% 46 51 0.00% 47 62 0.00% 48 71 0.00% 49 74 0.00% 50 82 0.00% 51 112 0.00% 52 110 0.00% 53 150 0.00% 54 148 0.00% 55 164 0.00% 56 190 0.00% 57 209 0.00% 58 250 0.00% 59 299 0.00% 60 348 0.00% 61 349 0.00% 62 474 0.00% 63 511 0.00% 64 557 0.00% 65 598 0.00% 66 725 0.00% 67 772 0.01% 68 885 0.01% 69 1053 0.01% 70 1194 0.01% 71 1378 0.01% 72 1608 0.01% 73 1879 0.01% 74 1986 0.01% 75 2236 0.01% 76 2562 0.02% 77 2775 0.02% 78 3157 0.02% 79 3356 0.02% 80 3722 0.02% 81 4261 0.03% 82 4925 0.03% 83 5467 0.04% 84 6409 0.04% 85 7371 0.05% 86 7982 0.05% 87 8492 0.06% 88 9202 0.06% 89 9675 0.06% 90 10476 0.07% 91 11502 0.08% 92 12310 0.08% 93 13434 0.09% 94 14316 0.10% 95 15771 0.11% 96 16365 0.11% 97 17125 0.11% 98 17874 0.12% 99 18491 0.12% 100 19706 0.13% 101 20701 0.14% 102 21960 0.15% 103 23496 0.16% 104 24907 0.17% 105 26467 0.18% 106 27207 0.18% 107 28408 0.19% 108 28999 0.19% 109 29613 0.20% 110 30454 0.20% 111 31892 0.21% 112 33038 0.22% 113 34579 0.23% 114 36563 0.24% 115 37695 0.25% 116 38871 0.26% 117 39387 0.26% 118 40422 0.27% 119 40711 0.27% 120 42105 0.28% 121 43072 0.29% 122 43833 0.29% 123 45983 0.31% 124 47504 0.32% 125 49151 0.33% 126 51281 0.34% 127 51854 0.35% 128 53232 0.36% 129 54182 0.36% 130 55618 0.37% 131 56323 0.38% 132 57647 0.39% 133 60330 0.40% 134 62382 0.42% 135 64484 0.43% 136 67534 0.45% 137 69745 0.47% 138 72124 0.48% 139 75284 0.50% 140 78601 0.53% 141 85196 0.57% 142 92226 0.62% 143 98560 0.66% 144 112639 0.75% 145 131564 0.88% 146 158239 1.06% 147 212793 1.42% 148 314319 2.10% 149 625767 4.19% 150 3307963 22.14% 151 7741547 51.80% 14944053 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=40 prefix-density=0.22 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=44 fanout-score=223.32 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=17.0 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=5.83 fanout-score-rank=18 prefix-density=0.32 prefix-fanout=3.8 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.06 sequence-density-rank=44 fanout-score=56.64 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=14.3 sequence=TTCTTTTCTTTTCACCTTCTTCAACCTTTTGTTTCCTTAAAGAATTCAATCTTGATCAAGATGGGTTCAACAGGTGAAACTCAGATGACTCCAACTCAGGTATCAGATGAAGAGGCACACCTCTTTGCCATGCAACTAGCCAGTGCTTCAGTTCTACCAATGATCCTCAAAACAGCCATTGAACTCGACCTTCTTGAAATCATGGCTAAAGCTGGCCCTGGTGCTTTCTTGTCCACATCT SRR7169749 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 12:35:38 Started mapping on | Feb 11 12:35:39 Finished on | Feb 11 12:37:29 Mapping speed, Million of reads per hour | 489.08 Number of input reads | 14944053 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 14310274 Uniquely mapped reads % | 95.76% Average mapped length | 291.46 Number of splices: Total | 13450168 Number of splices: Annotated (sjdb) | 13233405 Number of splices: GT/AG | 13265308 Number of splices: GC/AG | 146262 Number of splices: AT/AC | 11279 Number of splices: Non-canonical | 27319 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 243980 % of reads mapped to multiple loci | 1.63% Number of reads mapped to too many loci | 44212 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.25% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 397974 397974 397974 N_multimapping 243980 243980 243980 N_noFeature 299333 14149618 368299 N_ambiguous 145093 686 52887 UnstrandedReadsAssigned:13865848 PositiveStrandReadsAssigned:159970 NegativeStrandReadsAssigned:13889088 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169749 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169749-trimmed-pair1.fastq SRR7169749-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,944,053 reads, 13,817,531 reads pseudoaligned [quant] estimated average fragment length: 216.007 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,048 rounds 52401 SRR7169749.ke.tsv 34699 SRR7169749.se.tsv 87100 total ==> SRR7169749.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1802.99 281 11.9663 Potri.005G024800.1.v4.1 1035 819.993 31 2.90269 Potri.004G059700.1.v4.1 961 746.007 4 0.411685 Potri.007G009000.2.v4.1 1416 1200.99 0 0 Potri.003G141000.2.v4.1 2943 2727.99 307.071 8.64258 Potri.016G087400.1.v4.1 270 89.9891 1577.57 1346.01 Potri.015G069301.1.v4.1 564 351.086 0 0 Potri.010G195200.1.v4.1 1773 1557.99 7 0.34497 Potri.012G127500.1.v4.1 977 762 4884 492.118 ==> SRR7169749.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 882 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 236 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169749 completed mapping pipeline successfully