Starting /dee2/code/volunteer_pipeline.sh SRR7169750 current disk space = 3050632437760 free memory = 1484775456 SRR7169750 SRAfilesize f306d2db0ded656ac3b4219d8b33be1b SRR7169750.sra SRR7169750.sra file validated SRR7169750 is paired end SRR7169750 is conventional basespace SRR7169750 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169750_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.8015 33.0 31.0 33.0 25.0 34.0 2 32.21675 33.0 31.0 33.0 29.0 34.0 3 32.6985 33.0 33.0 34.0 31.0 34.0 4 32.636 33.0 33.0 34.0 31.0 34.0 5 33.162 33.0 33.0 34.0 33.0 34.0 6 37.15725 38.0 37.0 38.0 36.0 38.0 7 37.4805 38.0 38.0 38.0 37.0 38.0 8 37.60675 38.0 38.0 38.0 38.0 38.0 9 37.6565 38.0 38.0 38.0 38.0 38.0 10-14 37.70525 38.0 38.0 38.0 38.0 38.0 15-19 37.7133 38.0 38.0 38.0 38.0 38.0 20-24 37.7196 38.0 38.0 38.0 38.0 38.0 25-29 37.7022 38.0 38.0 38.0 38.0 38.0 30-34 37.660650000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.68975 38.0 38.0 38.0 38.0 38.0 40-44 37.60535 38.0 38.0 38.0 38.0 38.0 45-49 37.573899999999995 38.0 38.0 38.0 38.0 38.0 50-54 37.4666 38.0 38.0 38.0 37.6 38.0 55-59 37.554649999999995 38.0 38.0 38.0 38.0 38.0 60-64 37.4105 38.0 38.0 38.0 37.6 38.0 65-69 37.4123 38.0 38.0 38.0 37.4 38.0 70-74 37.414 38.0 38.0 38.0 37.2 38.0 75-79 37.3857 38.0 38.0 38.0 37.2 38.0 80-84 37.316649999999996 38.0 38.0 38.0 37.0 38.0 85-89 37.2481 38.0 38.0 38.0 36.8 38.0 90-94 37.172399999999996 38.0 38.0 38.0 36.6 38.0 95-99 37.2024 38.0 38.0 38.0 36.4 38.0 100-104 37.07015 38.0 38.0 38.0 36.4 38.0 105-109 36.5009 38.0 38.0 38.0 35.4 38.0 110-114 36.4818 38.0 38.0 38.0 35.0 38.0 115-119 36.74635000000001 38.0 38.0 38.0 35.0 38.0 120-124 36.7353 38.0 38.0 38.0 35.0 38.0 125-129 36.58575 38.0 38.0 38.0 34.8 38.0 130-134 36.442949999999996 38.0 38.0 38.0 34.0 38.0 135-139 36.138999999999996 38.0 37.8 38.0 33.4 38.0 140-144 35.78055 38.0 36.2 38.0 32.2 38.0 145-149 35.61055 38.0 36.0 38.0 32.6 38.0 150-151 32.2205 36.5 32.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 1.0 20 2.0 21 1.0 22 0.0 23 2.0 24 6.0 25 2.0 26 7.0 27 11.0 28 12.0 29 26.0 30 21.0 31 24.0 32 39.0 33 60.0 34 138.0 35 193.0 36 425.0 37 3025.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.24289665577068 11.013326628111642 8.59944681921046 38.144329896907216 2 20.65 16.3 35.075 27.975 3 19.675 21.125 25.825 33.375 4 22.411205602801402 30.015007503751878 22.736368184092047 24.83741870935468 5 21.875 34.300000000000004 23.200000000000003 20.625 6 18.9 36.9 24.6 19.6 7 14.45 24.925 42.55 18.075 8 18.025 25.624999999999996 30.675 25.674999999999997 9 17.7 25.15 33.475 23.674999999999997 10-14 19.935 29.665000000000003 26.884999999999998 23.515 15-19 19.425 28.860000000000003 27.775 23.94 20-24 19.900000000000002 28.335 28.175 23.59 25-29 19.735 28.645 27.884999999999998 23.735 30-34 20.206010300515025 28.7764388219411 27.726386319315964 23.291164558227912 35-39 19.689999999999998 29.535 27.08 23.695 40-44 19.72 28.939999999999998 27.58 23.76 45-49 19.814999999999998 28.910000000000004 27.46 23.815 50-54 20.265 28.525 27.595 23.615 55-59 20.21 28.455000000000002 27.584999999999997 23.75 60-64 19.935852460659518 28.50556279442718 28.109652200060136 23.448932544853164 65-69 20.185 28.845 26.955000000000002 24.015 70-74 19.994999999999997 28.884999999999998 27.965 23.155 75-79 19.845 28.585 27.400000000000002 24.169999999999998 80-84 20.28 28.375 27.779999999999998 23.565 85-89 20.27 28.749999999999996 27.250000000000004 23.73 90-94 20.275000000000002 29.080000000000002 27.025 23.62 95-99 20.24 28.310000000000002 27.625 23.825 100-104 20.994031796980792 28.185967199959876 27.162846682381264 23.657154320678067 105-109 20.82298687477829 28.510616733390766 27.208229868747786 23.45816652308316 110-114 20.25796661608498 28.214466363176534 27.561962569549824 23.965604451188668 115-119 20.575 28.685 26.58 24.16 120-124 20.419999999999998 28.799999999999997 26.965 23.815 125-129 20.345 28.815 27.229999999999997 23.61 130-134 20.645 28.285 26.705000000000002 24.365000000000002 135-139 20.625 27.955000000000002 27.525 23.895 140-144 20.580000000000002 28.65 26.365 24.404999999999998 145-149 20.94 29.23 25.83 24.0 150-151 20.625 28.787499999999998 26.974999999999998 23.6125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 2.5 24 3.0 25 2.5 26 4.5 27 9.5 28 12.0 29 12.0 30 15.0 31 30.5 32 37.5 33 39.5 34 47.5 35 58.0 36 77.0 37 99.5 38 128.5 39 167.0 40 192.0 41 220.0 42 272.0 43 272.0 44 262.0 45 266.0 46 258.5 47 275.5 48 243.0 49 196.0 50 176.5 51 147.5 52 122.5 53 99.5 54 74.0 55 50.0 56 34.0 57 24.5 58 19.0 59 10.5 60 8.5 61 9.0 62 5.0 63 2.5 64 2.0 65 1.5 66 2.0 67 1.0 68 1.0 69 2.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.575 2 0.0 3 0.0 4 0.05 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.22999999999999998 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.305 105-109 1.335 110-114 1.15 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47209653092006 98.925 2 0.5027652086475616 1.0 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.025 0.0 0.0 0.0 3 0.0 0.025 0.0 0.0 0.0 4 0.0 0.025 0.0 0.0 0.0 5 0.0 0.025 0.0 0.0 0.0 6 0.0 0.025 0.0 0.0 0.0 7 0.0 0.025 0.0 0.0 0.0 8 0.0 0.025 0.0 0.0 0.0 9 0.0 0.025 0.0 0.0 0.0 10-11 0.0 0.025 0.0 0.0 0.0 12-13 0.0 0.025 0.0 0.0 0.0 14-15 0.0 0.025 0.0 0.0 0.0 16-17 0.0 0.025 0.0 0.0 0.0 18-19 0.0 0.025 0.0 0.0 0.0 20-21 0.0 0.025 0.0 0.0 0.0 22-23 0.0 0.025 0.0 0.0 0.0 24-25 0.0 0.025 0.0 0.0 0.0 26-27 0.0 0.025 0.0 0.0 0.0 28-29 0.0 0.025 0.0 0.0 0.0 30-31 0.0 0.025 0.0 0.0 0.0 32-33 0.0 0.025 0.0 0.0 0.0 34-35 0.0 0.025 0.0 0.0 0.0 36-37 0.0 0.025 0.0 0.0 0.0 38-39 0.0 0.025 0.0 0.0 0.0 40-41 0.0 0.025 0.0 0.0 0.0 42-43 0.0 0.025 0.0 0.0 0.0 44-45 0.0 0.025 0.0 0.0 0.0 46-47 0.0 0.025 0.0 0.0 0.0 48-49 0.0 0.025 0.0 0.0 0.0 50-51 0.0 0.025 0.0 0.0 0.0 52-53 0.0 0.025 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.037500000000000006 0.0 0.0 0.0 62-63 0.0 0.05 0.0 0.0 0.0 64-65 0.0 0.05 0.0 0.0 0.0 66-67 0.0 0.05 0.0 0.0 0.0 68-69 0.0125 0.05 0.0 0.0 0.0 70-71 0.025 0.05 0.0 0.0 0.0 72-73 0.037500000000000006 0.05 0.0 0.0 0.0 74-75 0.05 0.05 0.0 0.0 0.0 76-77 0.05 0.05 0.0 0.0 0.0 78-79 0.1 0.05 0.0 0.0 0.0 80-81 0.16249999999999998 0.05 0.0 0.0 0.0 82-83 0.3 0.05 0.0 0.0 0.0 84-85 0.4 0.05 0.0 0.0 0.0 86-87 0.475 0.05 0.0 0.0 0.0 88-89 0.5875 0.05 0.0 0.0 0.0 90-91 0.7625 0.05 0.0 0.0 0.0 92-93 0.9375 0.05 0.0 0.0 0.0 94-95 1.1625 0.05 0.0 0.0 0.0 96-97 1.3250000000000002 0.05 0.0 0.0 0.0 98-99 1.5875 0.05 0.0 0.0 0.0 100-101 1.75 0.05 0.0 0.0 0.0 102-103 1.9125 0.05 0.0 0.0 0.0 104-105 2.1500000000000004 0.05 0.0 0.0 0.0 106-107 2.55 0.05 0.0 0.0 0.0 108-109 3.0875 0.05 0.0 0.0 0.0 110-111 3.35 0.05 0.0 0.0 0.0 112-113 3.8 0.05 0.0 0.0 0.0 114-115 4.475 0.05 0.0 0.0 0.0 116-117 4.85 0.05 0.0 0.0 0.0 118-119 5.3 0.05 0.0 0.0 0.0 120-121 5.7875 0.05 0.0 0.0 0.0 122-123 6.387499999999999 0.05 0.0 0.0 0.0 124-125 6.8125 0.05 0.0 0.0 0.0 126-127 7.225 0.05 0.0 0.0 0.0 128-129 7.8 0.05 0.0 0.0 0.0 130-131 8.325 0.05 0.0 0.0 0.0 132-133 8.9375 0.05 0.0 0.0 0.0 134-135 9.5 0.05 0.0 0.0 0.0 136-137 10.225000000000001 0.05 0.0 0.0 0.0 138-139 10.9125 0.05 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAACCT 10 0.006899958 144.51251 1 CCTACAG 10 0.006899958 144.51251 1 >>END_MODULE SRR7169750 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169750_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.15625 34.0 33.0 34.0 33.0 34.0 2 33.166 34.0 33.0 34.0 33.0 34.0 3 33.252 34.0 33.0 34.0 33.0 34.0 4 33.137 34.0 33.0 34.0 33.0 34.0 5 33.20225 34.0 33.0 34.0 33.0 34.0 6 37.44725 38.0 38.0 38.0 38.0 38.0 7 37.47675 38.0 38.0 38.0 38.0 38.0 8 37.42475 38.0 38.0 38.0 38.0 38.0 9 37.4385 38.0 38.0 38.0 38.0 38.0 10-14 37.4562 38.0 38.0 38.0 38.0 38.0 15-19 37.423500000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.3538 38.0 38.0 38.0 38.0 38.0 25-29 37.27485 38.0 38.0 38.0 38.0 38.0 30-34 37.2903 38.0 38.0 38.0 38.0 38.0 35-39 37.2512 38.0 38.0 38.0 37.8 38.0 40-44 37.2735 38.0 38.0 38.0 37.8 38.0 45-49 37.192099999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.06675 38.0 38.0 38.0 36.8 38.0 55-59 36.922349999999994 38.0 38.0 38.0 36.2 38.0 60-64 36.252649999999996 38.0 37.6 38.0 32.6 38.0 65-69 37.131299999999996 38.0 38.0 38.0 37.0 38.0 70-74 36.7731 38.0 38.0 38.0 36.6 38.0 75-79 35.84575 38.0 38.0 38.0 35.0 38.0 80-84 36.458450000000006 38.0 38.0 38.0 35.2 38.0 85-89 36.9542 38.0 38.0 38.0 36.6 38.0 90-94 36.96130000000001 38.0 38.0 38.0 36.8 38.0 95-99 36.868649999999995 38.0 38.0 38.0 36.2 38.0 100-104 36.5459 38.0 38.0 38.0 35.4 38.0 105-109 35.144600000000004 38.0 38.0 38.0 31.2 38.0 110-114 34.34310000000001 38.0 37.8 38.0 23.0 38.0 115-119 33.78985 38.0 37.2 38.0 16.6 38.0 120-124 33.76925 38.0 36.6 38.0 19.4 38.0 125-129 34.222500000000004 38.0 36.8 38.0 23.4 38.0 130-134 35.00455 38.0 36.8 38.0 27.6 38.0 135-139 35.30525 38.0 36.4 38.0 31.0 38.0 140-144 34.41305 38.0 35.4 38.0 25.2 38.0 145-149 34.5777 38.0 35.8 38.0 28.8 38.0 150-151 30.7165 35.5 29.5 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 2.0 4 3.0 5 3.0 6 0.0 7 1.0 8 0.0 9 1.0 10 3.0 11 1.0 12 4.0 13 5.0 14 3.0 15 1.0 16 1.0 17 1.0 18 2.0 19 7.0 20 7.0 21 4.0 22 11.0 23 30.0 24 19.0 25 15.0 26 9.0 27 40.0 28 27.0 29 47.0 30 67.0 31 60.0 32 60.0 33 94.0 34 124.0 35 181.0 36 449.0 37 2712.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.37018509254627 19.30965482741371 13.48174087043522 26.8384192096048 2 25.795938831787414 26.17197292554525 30.13286537979443 17.8992228628729 3 20.560280140070038 28.76438219109555 30.990495247623812 19.684842421210604 4 23.64864864864865 34.434434434434436 23.7987987987988 18.11811811811812 5 23.88694347173587 37.16858429214607 22.311155577788895 16.633316658329164 6 21.2 37.9 23.325000000000003 17.575 7 20.474999999999998 21.025 38.824999999999996 19.675 8 21.55 24.925 28.125 25.4 9 22.175 24.95 28.975 23.9 10-14 23.52 28.525 26.615 21.34 15-19 23.47 27.36 28.315 20.855 20-24 22.659531906381275 27.89057811562313 28.540708141628322 20.909181836367274 25-29 23.060377169726376 28.342754239407736 27.84753138912511 20.749337201740783 30-34 22.961480740370185 27.57878939469735 28.969484742371186 20.490245122561284 35-39 23.104259472446067 27.92432053656339 28.219630612142748 20.75178937884779 40-44 22.989943463251112 28.223345174363335 28.0182118376945 20.76849952469105 45-49 23.42319811934177 27.58465462912019 28.620017005952082 20.372130245585954 50-54 23.42234223422342 27.792779277927792 28.377837783778375 20.407040704070408 55-59 23.39254440830623 27.700775581686266 28.431323492619466 20.47535651738804 60-64 23.217321732173218 27.477747774777477 28.73287328732873 20.572057205720572 65-69 23.86738673867387 27.672767276727672 27.992799279927993 20.467046704670466 70-74 23.378392010491275 27.90275395944719 28.00867547664683 20.710178553414707 75-79 22.946161000310013 27.22951327890875 29.39444042575178 20.42988529502945 80-84 24.091459721380982 27.52877044215627 28.134463961235618 20.245305875227135 85-89 23.82310270648857 27.950372704987743 28.465656110860976 19.760868477662715 90-94 24.23969587835134 27.63605442176871 27.951180472188874 20.173069227691077 95-99 23.69 27.750000000000004 28.37 20.19 100-104 24.43384383630429 27.54205372834547 27.858398192317345 20.165704243032888 105-109 24.22715228347275 27.90045201849639 28.071907310230166 19.800488387800698 110-114 23.965269269695842 28.05092419964843 27.848505832845046 20.135300697810685 115-119 24.48968571119991 27.778377794578248 27.75137703855708 19.98055945566476 120-124 24.641467185584048 27.659007303939866 28.384069947219704 19.315455563256386 125-129 24.735762738602304 27.55955197980754 28.04332965241626 19.661355629173897 130-134 25.368091972569584 27.84893102057281 27.455627269060106 19.3273497377975 135-139 25.895000000000003 28.055000000000003 27.250000000000004 18.8 140-144 25.48519407763105 27.926170468187273 27.410964385754298 19.177671068427372 145-149 25.665133026605318 27.270454090818163 27.19543908781756 19.86897379475895 150-151 25.354430379746834 26.468354430379748 28.27848101265823 19.89873417721519 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 0.0 24 2.0 25 3.0 26 3.5 27 6.5 28 7.5 29 8.5 30 13.5 31 19.0 32 28.0 33 40.5 34 50.0 35 66.0 36 90.5 37 108.5 38 128.0 39 155.0 40 201.0 41 254.5 42 264.5 43 267.5 44 284.5 45 295.0 46 270.0 47 251.0 48 238.5 49 197.5 50 175.0 51 138.5 52 112.0 53 97.0 54 65.5 55 45.5 56 32.5 57 22.0 58 15.5 59 11.0 60 9.5 61 6.5 62 3.5 63 3.0 64 1.0 65 0.5 66 0.5 67 1.0 68 1.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.05 2 0.27499999999999997 3 0.05 4 0.1 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.02 25-29 0.045 30-34 0.05 35-39 0.105 40-44 0.065 45-49 0.034999999999999996 50-54 0.01 55-59 0.075 60-64 0.01 65-69 0.01 70-74 0.8699999999999999 75-79 3.2300000000000004 80-84 0.9400000000000001 85-89 0.055 90-94 0.04 95-99 0.0 100-104 0.42500000000000004 105-109 3.765 110-114 6.135 115-119 7.41 120-124 6.215 125-129 4.915 130-134 0.84 135-139 0.0 140-144 0.04 145-149 0.02 150-151 1.25 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.44999999999999996 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.7125 0.0 0.0 0.0 0.0 92-93 0.8875 0.0 0.0 0.0 0.0 94-95 1.1375 0.0 0.0 0.0 0.0 96-97 1.2999999999999998 0.0 0.0 0.0 0.0 98-99 1.5625 0.0 0.0 0.0 0.0 100-101 1.725 0.0 0.0 0.0 0.0 102-103 1.8875 0.0 0.0 0.0 0.0 104-105 2.0875 0.0 0.0 0.0 0.0 106-107 2.475 0.0 0.0 0.0 0.0 108-109 2.9625 0.0 0.0 0.0 0.0 110-111 3.2375 0.0 0.0 0.0 0.0 112-113 3.6875 0.0 0.0 0.0 0.0 114-115 4.262499999999999 0.0 0.0 0.0 0.0 116-117 4.6 0.0 0.0 0.0 0.0 118-119 5.0125 0.0 0.0 0.0 0.0 120-121 5.487500000000001 0.0 0.0 0.0 0.0 122-123 6.025 0.0 0.0 0.0 0.0 124-125 6.45 0.0 0.0 0.0 0.0 126-127 6.85 0.0 0.0 0.0 0.0 128-129 7.4 0.0 0.0 0.0 0.0 130-131 7.9375 0.0 0.0 0.0 0.0 132-133 8.524999999999999 0.0 0.0 0.0 0.0 134-135 9.05 0.0 0.0 0.0 0.0 136-137 9.75 0.0 0.0 0.0 0.0 138-139 10.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 619959 spots for SRR7169750.sra Written 619959 spots for SRR7169750.sra Read 619959 spots for SRR7169750.sra Written 619959 spots for SRR7169750.sra Read 619959 spots for SRR7169750.sra Written 619959 spots for SRR7169750.sra Read 619959 spots for SRR7169750.sra Written 619959 spots for SRR7169750.sra Read 619959 spots for SRR7169750.sra Written 619959 spots for SRR7169750.sra Read 619959 spots for SRR7169750.sra Written 619959 spots for SRR7169750.sra Read 619959 spots for SRR7169750.sra Written 619959 spots for SRR7169750.sra Read 619959 spots for SRR7169750.sra Written 619959 spots for SRR7169750.sra Read 619959 spots for SRR7169750.sra Written 619959 spots for SRR7169750.sra Read 619959 spots for SRR7169750.sra Written 619959 spots for SRR7169750.sra Read 619959 spots for SRR7169750.sra Written 619959 spots for SRR7169750.sra Read 619959 spots for SRR7169750.sra Written 619959 spots for SRR7169750.sra Read 619959 spots for SRR7169750.sra Written 619959 spots for SRR7169750.sra Read 619959 spots for SRR7169750.sra Written 619959 spots for SRR7169750.sra Read 619959 spots for SRR7169750.sra Written 619959 spots for SRR7169750.sra Read 619959 spots for SRR7169750.sra Written 619959 spots for SRR7169750.sra Read 619959 spots for SRR7169750.sra Written 619959 spots for SRR7169750.sra Read 619959 spots for SRR7169750.sra Written 619959 spots for SRR7169750.sra Read 619976 spots for SRR7169750.sra Written 619976 spots for SRR7169750.sra Read 619959 spots for SRR7169750.sra Written 619959 spots for SRR7169750.sra SRR ids: ['SRR7169750.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dnil2ejx SRR7169750.sra spots: 12399197 blocks: [[1, 619959], [619960, 1239918], [1239919, 1859877], [1859878, 2479836], [2479837, 3099795], [3099796, 3719754], [3719755, 4339713], [4339714, 4959672], [4959673, 5579631], [5579632, 6199590], [6199591, 6819549], [6819550, 7439508], [7439509, 8059467], [8059468, 8679426], [8679427, 9299385], [9299386, 9919344], [9919345, 10539303], [10539304, 11159262], [11159263, 11779221], [11779222, 12399197]] SRR7169750 file size 4179980 SRR7169750 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169750 SRR7169750_1.fastq SRR7169750_2.fastq Input file: SRR7169750_1.fastq Paired file: SRR7169750_2.fastq trimmed: SRR7169750-trimmed-pair1.fastq, SRR7169750-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 13:00:18 2025 >> started Tue Feb 11 13:00:32 2025 >> done (13.299s) 12399197 read pairs processed; of these: 8141 ( 0.07%) short read pairs filtered out after trimming by size control 8275 ( 0.07%) empty read pairs filtered out after trimming by size control 12382781 (99.87%) read pairs available; of these: 5305880 (42.85%) trimmed read pairs available after processing 7076901 (57.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 5 0.00% 21 2 0.00% 22 2 0.00% 23 3 0.00% 24 3 0.00% 25 1 0.00% 26 2 0.00% 27 4 0.00% 28 4 0.00% 29 5 0.00% 30 7 0.00% 31 8 0.00% 32 6 0.00% 33 10 0.00% 34 6 0.00% 35 7 0.00% 36 8 0.00% 37 20 0.00% 38 16 0.00% 39 13 0.00% 40 20 0.00% 41 22 0.00% 42 33 0.00% 43 28 0.00% 44 41 0.00% 45 28 0.00% 46 36 0.00% 47 42 0.00% 48 58 0.00% 49 72 0.00% 50 70 0.00% 51 105 0.00% 52 86 0.00% 53 119 0.00% 54 133 0.00% 55 131 0.00% 56 152 0.00% 57 167 0.00% 58 188 0.00% 59 228 0.00% 60 301 0.00% 61 359 0.00% 62 420 0.00% 63 444 0.00% 64 488 0.00% 65 554 0.00% 66 629 0.01% 67 680 0.01% 68 732 0.01% 69 915 0.01% 70 975 0.01% 71 1096 0.01% 72 1342 0.01% 73 1618 0.01% 74 1685 0.01% 75 1941 0.02% 76 2104 0.02% 77 2279 0.02% 78 2438 0.02% 79 2829 0.02% 80 3100 0.03% 81 3589 0.03% 82 4100 0.03% 83 4613 0.04% 84 5606 0.05% 85 6289 0.05% 86 6475 0.05% 87 6923 0.06% 88 7331 0.06% 89 7901 0.06% 90 8440 0.07% 91 9248 0.07% 92 10214 0.08% 93 11179 0.09% 94 12135 0.10% 95 12777 0.10% 96 13479 0.11% 97 13593 0.11% 98 13996 0.11% 99 14713 0.12% 100 15346 0.12% 101 16538 0.13% 102 17731 0.14% 103 19191 0.15% 104 20252 0.16% 105 21391 0.17% 106 21602 0.17% 107 22113 0.18% 108 22656 0.18% 109 23091 0.19% 110 24117 0.19% 111 25069 0.20% 112 26364 0.21% 113 27100 0.22% 114 28738 0.23% 115 29992 0.24% 116 30751 0.25% 117 31147 0.25% 118 31235 0.25% 119 31299 0.25% 120 32207 0.26% 121 33402 0.27% 122 34331 0.28% 123 35541 0.29% 124 37252 0.30% 125 38633 0.31% 126 40566 0.33% 127 41070 0.33% 128 41076 0.33% 129 42043 0.34% 130 41628 0.34% 131 42889 0.35% 132 44135 0.36% 133 45313 0.37% 134 47025 0.38% 135 49613 0.40% 136 50711 0.41% 137 51936 0.42% 138 53895 0.44% 139 55853 0.45% 140 58445 0.47% 141 61822 0.50% 142 66358 0.54% 143 70681 0.57% 144 80546 0.65% 145 89067 0.72% 146 105804 0.85% 147 135483 1.09% 148 197867 1.60% 149 408126 3.30% 150 2485416 20.07% 151 7076901 57.15% 12382781 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=35 prefix-density=0.17 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.10 sequence-density-rank=24 fanout-score=255.92 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=28.6 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=3.15 fanout-score-rank=26 prefix-density=0.25 prefix-fanout=2.6 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.11 sequence-density-rank=13 fanout-score=68.93 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=16.4 sequence=TGTTGGTGGTGG SRR7169750 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 13:01:14 Started mapping on | Feb 11 13:01:14 Finished on | Feb 11 13:02:21 Mapping speed, Million of reads per hour | 665.34 Number of input reads | 12382781 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 11880373 Uniquely mapped reads % | 95.94% Average mapped length | 291.87 Number of splices: Total | 11213552 Number of splices: Annotated (sjdb) | 11034884 Number of splices: GT/AG | 11053211 Number of splices: GC/AG | 129136 Number of splices: AT/AC | 8488 Number of splices: Non-canonical | 22717 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 205806 % of reads mapped to multiple loci | 1.66% Number of reads mapped to too many loci | 20474 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.19% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 305156 305156 305156 N_multimapping 205806 205806 205806 N_noFeature 294495 11755424 352903 N_ambiguous 112082 512 45213 UnstrandedReadsAssigned:11473796 PositiveStrandReadsAssigned:124437 NegativeStrandReadsAssigned:11482257 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169750 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169750-trimmed-pair1.fastq SRR7169750-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,382,781 reads, 11,396,944 reads pseudoaligned [quant] estimated average fragment length: 221.475 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,018 rounds 52401 SRR7169750.ke.tsv 34699 SRR7169750.se.tsv 87100 total ==> SRR7169750.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1797.52 201 10.7874 Potri.005G024800.1.v4.1 1035 814.525 47 5.5666 Potri.004G059700.1.v4.1 961 740.525 0 0 Potri.007G009000.2.v4.1 1416 1195.52 0 0 Potri.003G141000.2.v4.1 2943 2722.52 269.117 9.53599 Potri.016G087400.1.v4.1 270 89.8109 727 780.911 Potri.015G069301.1.v4.1 564 346.469 0 0 Potri.010G195200.1.v4.1 1773 1552.52 3 0.186414 Potri.012G127500.1.v4.1 977 756.525 3916 499.363 ==> SRR7169750.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 712 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 132 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169750 completed mapping pipeline successfully