Starting /dee2/code/volunteer_pipeline.sh SRR7169751 current disk space = 3050621739008 free memory = 1471612608 SRR7169751 SRAfilesize 93494d43c4157905e94e0494d0f9cffb SRR7169751.sra SRR7169751.sra file validated SRR7169751 is paired end SRR7169751 is conventional basespace SRR7169751 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169751_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.96275 33.0 32.0 33.0 25.0 34.0 2 31.79375 33.0 31.0 33.0 29.0 34.0 3 32.08575 33.0 31.0 33.0 30.0 34.0 4 32.005 33.0 31.0 33.0 30.0 34.0 5 32.59425 33.0 33.0 33.0 32.0 34.0 6 36.84925 38.0 37.0 38.0 35.0 38.0 7 37.20825 38.0 38.0 38.0 36.0 38.0 8 37.4535 38.0 38.0 38.0 37.0 38.0 9 37.505 38.0 38.0 38.0 37.0 38.0 10-14 37.540000000000006 38.0 38.0 38.0 38.0 38.0 15-19 37.54735 38.0 38.0 38.0 38.0 38.0 20-24 37.552949999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.585 38.0 38.0 38.0 38.0 38.0 30-34 37.5367 38.0 38.0 38.0 38.0 38.0 35-39 37.4984 38.0 38.0 38.0 38.0 38.0 40-44 37.45925 38.0 38.0 38.0 37.4 38.0 45-49 37.3662 38.0 38.0 38.0 37.4 38.0 50-54 37.392999999999994 38.0 38.0 38.0 37.0 38.0 55-59 37.357600000000005 38.0 38.0 38.0 37.0 38.0 60-64 36.724 38.0 37.8 38.0 34.6 38.0 65-69 37.09705 38.0 38.0 38.0 36.4 38.0 70-74 37.2185 38.0 38.0 38.0 36.8 38.0 75-79 37.119749999999996 38.0 38.0 38.0 36.0 38.0 80-84 37.0835 38.0 38.0 38.0 36.0 38.0 85-89 37.05595 38.0 38.0 38.0 36.0 38.0 90-94 36.75744999999999 38.0 38.0 38.0 35.2 38.0 95-99 36.803399999999996 38.0 38.0 38.0 35.4 38.0 100-104 36.88995 38.0 38.0 38.0 35.8 38.0 105-109 36.59115 38.0 38.0 38.0 34.8 38.0 110-114 36.56085 38.0 38.0 38.0 34.8 38.0 115-119 36.5256 38.0 38.0 38.0 34.4 38.0 120-124 36.3601 38.0 38.0 38.0 33.8 38.0 125-129 36.25675 38.0 38.0 38.0 33.8 38.0 130-134 36.04325 38.0 37.4 38.0 33.0 38.0 135-139 35.8863 38.0 36.8 38.0 32.6 38.0 140-144 35.646049999999995 38.0 36.2 38.0 32.0 38.0 145-149 35.04995 38.0 35.8 38.0 30.4 38.0 150-151 31.207500000000003 35.5 30.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 2.0 16 2.0 17 0.0 18 2.0 19 5.0 20 1.0 21 1.0 22 4.0 23 2.0 24 6.0 25 5.0 26 13.0 27 12.0 28 20.0 29 29.0 30 25.0 31 41.0 32 63.0 33 89.0 34 120.0 35 239.0 36 556.0 37 2761.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.47302383939774 12.095357590966122 8.732747804265998 39.69887076537014 2 21.65 16.55 35.225 26.575 3 20.455113778444613 20.40510127531883 25.481370342585645 33.65841460365091 4 23.05 30.45 21.825 24.675 5 23.375 33.525 23.7 19.400000000000002 6 18.675 36.225 25.45 19.650000000000002 7 15.075 25.825 41.825 17.275 8 17.05 25.45 32.95 24.55 9 17.349999999999998 25.174999999999997 32.85 24.625 10-14 20.105 29.909999999999997 27.125 22.86 15-19 20.085 28.945 27.939999999999998 23.03 20-24 20.145 29.354999999999997 27.134999999999998 23.365 25-29 20.09 28.985 27.015 23.91 30-34 19.90099504975249 28.39141957097855 27.60138006900345 24.106205310265512 35-39 19.930996549827494 29.411470573528675 27.081354067703383 23.576178808940448 40-44 20.305 28.494999999999997 27.685 23.515 45-49 19.794999999999998 28.16 28.194999999999997 23.849999999999998 50-54 19.895 28.455000000000002 27.644999999999996 24.005000000000003 55-59 19.900000000000002 29.054999999999996 27.375 23.669999999999998 60-64 20.294999999999998 28.804999999999996 27.075 23.825 65-69 20.565 28.42 27.63 23.385 70-74 20.01 28.294999999999998 28.285 23.41 75-79 20.18 28.335 27.365000000000002 24.12 80-84 20.635 28.505000000000003 27.389999999999997 23.47 85-89 20.74 28.52 26.884999999999998 23.855 90-94 20.4 29.325000000000003 27.04 23.235 95-99 20.88604430221511 28.72143607180359 26.961348067403367 23.43117155857793 100-104 20.737073707370737 28.702870287028702 26.887688768876888 23.672367236723673 105-109 20.695530166366005 28.27720986169573 27.054519943876524 23.972740028061736 110-114 20.64464303644944 28.61231047293905 27.236670348428554 23.50637614218295 115-119 21.085 28.999999999999996 26.83 23.085 120-124 21.195 28.68 25.955000000000002 24.169999999999998 125-129 21.415 27.93 27.04 23.615 130-134 21.21 28.785 26.674999999999997 23.330000000000002 135-139 21.815 27.694999999999997 26.400000000000002 24.09 140-144 21.26 28.275 26.26 24.205 145-149 21.39 27.555000000000003 26.56 24.495 150-151 21.702712839104887 27.29091136392049 26.303287910988875 24.70308788598575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 2.0 25 2.5 26 4.5 27 5.0 28 5.5 29 11.0 30 16.0 31 21.0 32 33.5 33 51.5 34 69.0 35 74.0 36 84.0 37 100.5 38 124.5 39 158.5 40 195.0 41 219.0 42 225.5 43 252.5 44 274.0 45 274.5 46 270.0 47 259.0 48 243.5 49 212.0 50 180.5 51 157.0 52 117.0 53 79.0 54 67.0 55 58.5 56 38.5 57 29.5 58 26.5 59 15.0 60 9.0 61 8.0 62 7.0 63 4.5 64 3.0 65 3.0 66 2.0 67 1.5 68 1.0 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.005 100-104 0.01 105-109 0.22 110-114 0.41000000000000003 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52249308871576 99.0 2 0.42724302588590096 0.8500000000000001 3 0.050263885398341285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.5125 0.0 0.0 0.0 0.0 90-91 0.7125 0.0 0.0 0.0 0.0 92-93 0.925 0.0 0.0 0.0 0.0 94-95 1.075 0.0 0.0 0.0 0.0 96-97 1.325 0.0 0.0 0.0 0.0 98-99 1.5 0.0 0.0 0.0 0.0 100-101 1.7 0.0 0.0 0.0 0.0 102-103 1.9375 0.0 0.0 0.0 0.0 104-105 2.1875 0.0 0.0 0.0 0.0 106-107 2.4375 0.0 0.0 0.0 0.0 108-109 2.8625 0.0 0.0 0.0 0.0 110-111 3.2 0.0 0.0 0.0 0.0 112-113 3.6125 0.0 0.0 0.0 0.0 114-115 3.9875 0.0 0.0 0.0 0.0 116-117 4.6375 0.0 0.0 0.0 0.0 118-119 5.175 0.0 0.0 0.0 0.0 120-121 5.6625 0.0 0.0 0.0 0.0 122-123 6.2 0.0 0.0 0.0 0.0 124-125 6.8 0.0 0.0 0.0 0.0 126-127 7.262499999999999 0.0 0.0 0.0 0.0 128-129 7.9 0.0 0.0 0.0 0.0 130-131 8.412500000000001 0.0 0.0 0.0 0.0 132-133 8.925 0.0 0.0 0.0 0.0 134-135 9.6375 0.0 0.0 0.0 0.0 136-137 10.3375 0.0 0.0 0.0 0.0 138-139 11.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGTTCC 10 0.006830828 145.0 2 CCAGTTC 10 0.006830828 145.0 1 TGAGAGG 10 0.006830828 145.0 2 GTCTGAA 30 0.0017973486 72.5 145 >>END_MODULE SRR7169751 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169751_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.99475 33.0 33.0 34.0 32.0 34.0 2 33.0955 34.0 33.0 34.0 32.0 34.0 3 33.134 34.0 33.0 34.0 33.0 34.0 4 33.078 34.0 33.0 34.0 33.0 34.0 5 33.10075 34.0 33.0 34.0 33.0 34.0 6 37.266 38.0 38.0 38.0 37.0 38.0 7 37.40525 38.0 38.0 38.0 37.0 38.0 8 37.3605 38.0 38.0 38.0 37.0 38.0 9 37.29075 38.0 38.0 38.0 37.0 38.0 10-14 37.18825 38.0 38.0 38.0 37.0 38.0 15-19 37.16625 38.0 38.0 38.0 37.0 38.0 20-24 37.21815 38.0 38.0 38.0 37.0 38.0 25-29 37.12005 38.0 38.0 38.0 37.0 38.0 30-34 37.087849999999996 38.0 38.0 38.0 37.0 38.0 35-39 36.63405 38.0 38.0 38.0 35.0 38.0 40-44 36.99715 38.0 38.0 38.0 36.6 38.0 45-49 37.075649999999996 38.0 38.0 38.0 36.8 38.0 50-54 36.96195 38.0 38.0 38.0 36.4 38.0 55-59 36.846199999999996 38.0 38.0 38.0 36.0 38.0 60-64 36.9399 38.0 38.0 38.0 36.0 38.0 65-69 37.01195 38.0 38.0 38.0 36.4 38.0 70-74 36.556149999999995 38.0 38.0 38.0 35.6 38.0 75-79 35.5153 38.0 38.0 38.0 32.8 38.0 80-84 36.13105 38.0 38.0 38.0 33.0 38.0 85-89 36.6924 38.0 38.0 38.0 35.6 38.0 90-94 36.563900000000004 38.0 38.0 38.0 35.0 38.0 95-99 36.4109 38.0 38.0 38.0 34.4 38.0 100-104 36.29260000000001 38.0 38.0 38.0 34.0 38.0 105-109 35.171800000000005 38.0 37.8 38.0 30.2 38.0 110-114 33.8935 38.0 36.8 38.0 18.6 38.0 115-119 32.66414999999999 38.0 35.8 38.0 4.2 38.0 120-124 33.140950000000004 38.0 35.2 38.0 12.2 38.0 125-129 33.2626 38.0 34.6 38.0 17.6 38.0 130-134 34.97965 38.0 36.0 38.0 27.8 38.0 135-139 35.07900000000001 38.0 36.0 38.0 30.6 38.0 140-144 34.61095 38.0 36.0 38.0 27.6 38.0 145-149 33.8647 38.0 34.2 38.0 24.4 38.0 150-151 29.894375 35.5 28.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 6.0 4 2.0 5 2.0 6 0.0 7 3.0 8 0.0 9 0.0 10 2.0 11 3.0 12 2.0 13 1.0 14 1.0 15 3.0 16 4.0 17 6.0 18 4.0 19 4.0 20 9.0 21 15.0 22 11.0 23 20.0 24 13.0 25 24.0 26 20.0 27 31.0 28 40.0 29 60.0 30 87.0 31 76.0 32 88.0 33 104.0 34 156.0 35 273.0 36 496.0 37 2433.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.25 21.8 13.075000000000001 26.875 2 26.875 26.224999999999998 30.75 16.150000000000002 3 19.76976976976977 28.653653653653656 31.88188188188188 19.694694694694697 4 23.2982982982983 33.708708708708706 24.174174174174173 18.81881881881882 5 24.312156078039017 35.542771385692845 22.661330665332667 17.483741870935468 6 21.075 36.275 23.45 19.2 7 19.625 20.599999999999998 40.45 19.325 8 22.775000000000002 24.925 27.200000000000003 25.1 9 20.75 24.95 31.025000000000002 23.275000000000002 10-14 23.472347234723472 28.30783078307831 26.61766176617662 21.602160216021602 15-19 23.01230123012301 27.642764276427645 27.817781778177817 21.527152715271527 20-24 23.209283713485394 27.651060424169664 28.241296518607445 20.898359343737493 25-29 22.70113505675284 28.626431321566077 27.646382319115958 21.026051302565126 30-34 23.206962088626586 27.718315494648394 28.0334100230069 21.041312393718115 35-39 23.391051946752075 27.880092082874587 28.130317285557 20.598538684816333 40-44 23.665382498624105 27.682993946064943 27.973182568669635 20.678440986641316 45-49 23.0880808282899 27.724703646276193 28.38993647776722 20.797279047666684 50-54 22.846423211605803 27.988994497248626 27.953976988494244 21.210605302651324 55-59 23.5370611183355 27.59327798339502 28.483545063519056 20.386115834750427 60-64 22.830000000000002 27.99 27.74 21.44 65-69 23.135 28.335 28.105000000000004 20.424999999999997 70-74 22.950489059191288 27.35202178078048 28.370474942018753 21.32701421800948 75-79 23.57753041677453 27.27931659332125 28.36655449132798 20.776598498576234 80-84 23.04699343102577 27.614957049014656 28.160687215765538 21.177362304194038 85-89 23.477347734773478 28.587858785878588 27.247724772477248 20.687068706870686 90-94 23.71 28.310000000000002 28.000000000000004 19.98 95-99 23.494999999999997 28.09 27.97 20.445 100-104 23.850732829773396 27.55239857936071 27.792506627982593 20.8043619628833 105-109 24.160486196950966 27.503090234857847 28.069633292130202 20.26679027606098 110-114 24.104617026954898 27.91032826261009 27.89431545236189 20.090739258073125 115-119 24.366826684323787 27.90928654196325 27.660983280913754 20.062903492799204 120-124 24.41511053874222 28.128353723975103 27.13028546898476 20.32625026829792 125-129 24.515009726092213 27.9322853688029 27.08585247883918 20.466852426265707 130-134 24.906095056843792 27.750788801522514 27.009565783542843 20.33355035809085 135-139 24.815 28.1 27.034999999999997 20.05 140-144 25.14 27.74 27.325 19.794999999999998 145-149 25.759999999999998 27.205000000000002 27.250000000000004 19.785 150-151 26.533934385174057 26.67167543200601 26.884547958928124 19.90984222389181 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.0 25 2.0 26 4.0 27 5.0 28 7.0 29 10.5 30 14.0 31 15.5 32 20.5 33 42.0 34 58.5 35 58.0 36 73.0 37 114.0 38 134.5 39 152.0 40 196.0 41 226.5 42 266.0 43 295.0 44 291.0 45 280.0 46 280.5 47 253.5 48 220.0 49 217.0 50 186.5 51 152.0 52 115.0 53 82.5 54 61.5 55 43.5 56 35.0 57 25.5 58 18.0 59 10.0 60 8.0 61 6.0 62 2.5 63 3.0 64 1.5 65 0.5 66 3.0 67 3.0 68 1.5 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.1 4 0.1 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.01 15-19 0.01 20-24 0.04 25-29 0.005 30-34 0.03 35-39 0.09 40-44 0.065 45-49 0.034999999999999996 50-54 0.05 55-59 0.03 60-64 0.0 65-69 0.0 70-74 0.83 75-79 3.4250000000000003 80-84 1.05 85-89 0.01 90-94 0.0 95-99 0.0 100-104 0.045 105-109 2.92 110-114 6.325 115-119 9.385 120-124 6.819999999999999 125-129 4.8950000000000005 130-134 0.165 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.17500000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77443609022556 99.52499999999999 2 0.20050125313283207 0.4 3 0.02506265664160401 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.4875 0.0 0.0 0.0 0.0 90-91 0.6875 0.0 0.0 0.0 0.0 92-93 0.925 0.0 0.0 0.0 0.0 94-95 1.075 0.0 0.0 0.0 0.0 96-97 1.325 0.0 0.0 0.0 0.0 98-99 1.4874999999999998 0.0 0.0 0.0 0.0 100-101 1.675 0.0 0.0 0.0 0.0 102-103 1.9125 0.0 0.0 0.0 0.0 104-105 2.1500000000000004 0.0 0.0 0.0 0.0 106-107 2.3625 0.0 0.0 0.0 0.0 108-109 2.725 0.0 0.0 0.0 0.0 110-111 3.0125 0.0 0.0 0.0 0.0 112-113 3.4124999999999996 0.0 0.0 0.0 0.0 114-115 3.7249999999999996 0.0 0.0 0.0 0.0 116-117 4.25 0.0 0.0 0.0 0.0 118-119 4.699999999999999 0.0 0.0 0.0 0.0 120-121 5.15 0.0 0.0 0.0 0.0 122-123 5.6625 0.0 0.0 0.0 0.0 124-125 6.2375 0.0 0.0 0.0 0.0 126-127 6.725 0.0 0.0 0.0 0.0 128-129 7.3375 0.0 0.0 0.0 0.0 130-131 7.8375 0.0 0.0 0.0 0.0 132-133 8.3625 0.0 0.0 0.0 0.0 134-135 9.0625 0.0 0.0 0.0 0.0 136-137 9.7375 0.0 0.0 0.0 0.0 138-139 10.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCGTTT 10 0.0071093175 143.075 145 ACGTTAA 10 0.0071093175 143.075 6 GACGTTA 10 0.0071093175 143.075 5 TGTAGGG 25 9.188525E-4 85.845 145 >>END_MODULE Read 797875 spots for SRR7169751.sra Written 797875 spots for SRR7169751.sra Read 797875 spots for SRR7169751.sra Written 797875 spots for SRR7169751.sra Read 797875 spots for SRR7169751.sra Written 797875 spots for SRR7169751.sra Read 797875 spots for SRR7169751.sra Written 797875 spots for SRR7169751.sra Read 797875 spots for SRR7169751.sra Written 797875 spots for SRR7169751.sra Read 797892 spots for SRR7169751.sra Written 797892 spots for SRR7169751.sra Read 797875 spots for SRR7169751.sra Written 797875 spots for SRR7169751.sra Read 797875 spots for SRR7169751.sra Written 797875 spots for SRR7169751.sra Read 797875 spots for SRR7169751.sra Written 797875 spots for SRR7169751.sra Read 797875 spots for SRR7169751.sra Written 797875 spots for SRR7169751.sra Read 797875 spots for SRR7169751.sra Written 797875 spots for SRR7169751.sra Read 797875 spots for SRR7169751.sra Written 797875 spots for SRR7169751.sra Read 797875 spots for SRR7169751.sra Written 797875 spots for SRR7169751.sra Read 797875 spots for SRR7169751.sra Written 797875 spots for SRR7169751.sra Read 797875 spots for SRR7169751.sra Written 797875 spots for SRR7169751.sra Read 797875 spots for SRR7169751.sra Written 797875 spots for SRR7169751.sra Read 797875 spots for SRR7169751.sra Written 797875 spots for SRR7169751.sra Read 797875 spots for SRR7169751.sra Written 797875 spots for SRR7169751.sra Read 797875 spots for SRR7169751.sra Written 797875 spots for SRR7169751.sra Read 797875 spots for SRR7169751.sra Written 797875 spots for SRR7169751.sra SRR ids: ['SRR7169751.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3pk4ypp4 SRR7169751.sra spots: 15957517 blocks: [[1, 797875], [797876, 1595750], [1595751, 2393625], [2393626, 3191500], [3191501, 3989375], [3989376, 4787250], [4787251, 5585125], [5585126, 6383000], [6383001, 7180875], [7180876, 7978750], [7978751, 8776625], [8776626, 9574500], [9574501, 10372375], [10372376, 11170250], [11170251, 11968125], [11968126, 12766000], [12766001, 13563875], [13563876, 14361750], [14361751, 15159625], [15159626, 15957517]] SRR7169751 file size 5385778 SRR7169751 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169751 SRR7169751_1.fastq SRR7169751_2.fastq Input file: SRR7169751_1.fastq Paired file: SRR7169751_2.fastq trimmed: SRR7169751-trimmed-pair1.fastq, SRR7169751-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 12:59:57 2025 >> started Tue Feb 11 13:00:20 2025 >> done (23.143s) 15957517 read pairs processed; of these: 13416 ( 0.08%) short read pairs filtered out after trimming by size control 12614 ( 0.08%) empty read pairs filtered out after trimming by size control 15931487 (99.84%) read pairs available; of these: 7512108 (47.15%) trimmed read pairs available after processing 8419379 (52.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 2 0.00% 21 3 0.00% 22 4 0.00% 23 1 0.00% 24 4 0.00% 25 5 0.00% 26 8 0.00% 27 9 0.00% 28 6 0.00% 29 7 0.00% 30 5 0.00% 31 2 0.00% 32 6 0.00% 33 10 0.00% 34 16 0.00% 35 10 0.00% 36 23 0.00% 37 23 0.00% 38 21 0.00% 39 30 0.00% 40 38 0.00% 41 49 0.00% 42 42 0.00% 43 54 0.00% 44 52 0.00% 45 68 0.00% 46 69 0.00% 47 75 0.00% 48 59 0.00% 49 105 0.00% 50 152 0.00% 51 155 0.00% 52 165 0.00% 53 181 0.00% 54 226 0.00% 55 245 0.00% 56 265 0.00% 57 310 0.00% 58 349 0.00% 59 405 0.00% 60 510 0.00% 61 613 0.00% 62 644 0.00% 63 712 0.00% 64 761 0.00% 65 918 0.01% 66 963 0.01% 67 1132 0.01% 68 1215 0.01% 69 1417 0.01% 70 1636 0.01% 71 1984 0.01% 72 2228 0.01% 73 2572 0.02% 74 2846 0.02% 75 3275 0.02% 76 3565 0.02% 77 3979 0.02% 78 4037 0.03% 79 4633 0.03% 80 5038 0.03% 81 5907 0.04% 82 6720 0.04% 83 7564 0.05% 84 8837 0.06% 85 10269 0.06% 86 10705 0.07% 87 11322 0.07% 88 12028 0.08% 89 12812 0.08% 90 14000 0.09% 91 15188 0.10% 92 16493 0.10% 93 18163 0.11% 94 19416 0.12% 95 20943 0.13% 96 21793 0.14% 97 22406 0.14% 98 23513 0.15% 99 24323 0.15% 100 25840 0.16% 101 27095 0.17% 102 29005 0.18% 103 30959 0.19% 104 32663 0.21% 105 34006 0.21% 106 35409 0.22% 107 35962 0.23% 108 36699 0.23% 109 37498 0.24% 110 38612 0.24% 111 39747 0.25% 112 42041 0.26% 113 43874 0.28% 114 46100 0.29% 115 47378 0.30% 116 48677 0.31% 117 49430 0.31% 118 49876 0.31% 119 50056 0.31% 120 51304 0.32% 121 52423 0.33% 122 53571 0.34% 123 55311 0.35% 124 58371 0.37% 125 60393 0.38% 126 62709 0.39% 127 64266 0.40% 128 64064 0.40% 129 64500 0.40% 130 65438 0.41% 131 66209 0.42% 132 67402 0.42% 133 69854 0.44% 134 71857 0.45% 135 74581 0.47% 136 77193 0.48% 137 79077 0.50% 138 81693 0.51% 139 84601 0.53% 140 87429 0.55% 141 92328 0.58% 142 98419 0.62% 143 105960 0.67% 144 119905 0.75% 145 139286 0.87% 146 158384 0.99% 147 202296 1.27% 148 290489 1.82% 149 544808 3.42% 150 3236715 20.32% 151 8419379 52.85% 15931487 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=38 prefix-density=0.16 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.10 sequence-density-rank=17 fanout-score=250.85 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=28.4 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=3.46 fanout-score-rank=31 prefix-density=0.25 prefix-fanout=2.8 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.08 sequence-density-rank=34 fanout-score=265.21 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=27.1 sequence=GAAGAAGAAGAAA SRR7169751 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 13:01:03 Started mapping on | Feb 11 13:01:03 Finished on | Feb 11 13:02:33 Mapping speed, Million of reads per hour | 637.26 Number of input reads | 15931487 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 15219906 Uniquely mapped reads % | 95.53% Average mapped length | 289.91 Number of splices: Total | 13872994 Number of splices: Annotated (sjdb) | 13631721 Number of splices: GT/AG | 13663660 Number of splices: GC/AG | 164119 Number of splices: AT/AC | 11054 Number of splices: Non-canonical | 34161 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 287059 % of reads mapped to multiple loci | 1.80% Number of reads mapped to too many loci | 31778 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.42% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 436153 436153 436153 N_multimapping 287059 287059 287059 N_noFeature 426374 15034571 529129 N_ambiguous 144212 855 61153 UnstrandedReadsAssigned:14649320 PositiveStrandReadsAssigned:184480 NegativeStrandReadsAssigned:14629624 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169751 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169751-trimmed-pair1.fastq SRR7169751-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,931,487 reads, 14,532,469 reads pseudoaligned [quant] estimated average fragment length: 214.308 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,185 rounds 52401 SRR7169751.ke.tsv 34699 SRR7169751.se.tsv 87100 total ==> SRR7169751.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1804.69 250 10.2983 Potri.005G024800.1.v4.1 1035 821.692 45 4.07127 Potri.004G059700.1.v4.1 961 747.71 1 0.0994245 Potri.007G009000.2.v4.1 1416 1202.69 0 0 Potri.003G141000.2.v4.1 2943 2729.69 227 6.18214 Potri.016G087400.1.v4.1 270 94.1793 1018 803.562 Potri.015G069301.1.v4.1 564 353.56 0 0 Potri.010G195200.1.v4.1 1773 1559.69 18 0.857947 Potri.012G127500.1.v4.1 977 763.698 6510 633.703 ==> SRR7169751.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1628 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 402 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7169751 completed mapping pipeline successfully